Application of circ-21490 in proliferation of porcine skeletal muscle satellite cells

Abstract

The application of Circ-21490 in proliferation of pig skeletal muscle satellite cells relates to the field of molecular genetics, the application of circRNA in proliferation of pig skeletal muscle satellite cells, the circRNA is Circ-21490, the nucleotide sequence of Circ-21490 is shown as SEQ ID No:1.The application successfully clones and identifies a new circRNA sequence-Circ-21490, determines that Circ-21490 is a marker for proliferation of pig skeletal muscle satellite cells through a molecular biology method, and overexpression of Circ-21490 can promote proliferation of pig skeletal muscle satellite cells.A detection kit containing a specific primer pair of Circ-21490 is designed, the expression level of Circ-21490 is analyzed by using the kit, so as to identify the proliferation potential of pig skeletal muscle satellite cells.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular genetics, and particularly relates to a marker Circ-21490 related to proliferation of porcine skeletal muscle satellite cells and application thereof. BACKGROUND

[0002] Pork is an important part of human diet, and accounts for about 40% of the total meat consumption in the diet structure of Chinese residents. The growth and development of skeletal muscle directly determine the pork yield and lean meat rate of pigs. Skeletal muscle is mainly composed of muscle fibers and surrounding intramuscular connective tissue. Skeletal muscle satellite cells are located between the skeletal muscle membrane and the basement membrane, and are a kind of muscle-derived stem cells with self-renewal ability, which have the potential to differentiate into myoblasts. Under normal circumstances, skeletal muscle satellite cells are in a resting state, and are activated to enter the proliferation and differentiation process when stimulated, so as to help muscle tissue repair and restore normal tissue structure, and play a key role in postnatal skeletal muscle development, regeneration and homeostasis. Skeletal muscle satellite cell proliferation is synergistically regulated by a series of transcription factors and non-coding RNAs.

[0003] Circular RNA (circRNA) is an important non-coding RNA discovered recently, which is single-stranded, closed and circular in structure, and is a product of reverse splicing of precursor mRNA in eukaryotes, and plays an important role in gene expression regulation, cell signal transduction and biological process regulation. The functions of circRNA mainly include the following aspects: (1) as a molecular sponge to absorb miRNA, to inhibit the regulation of miRNA on target genes; (2) to regulate the transcription of parent genes and affect the transcription level of parent genes; (3) to interact with proteins to regulate the function and localization of proteins; (4) to participate in the formation of regulatory complexes to affect the stability of mRNA and protein synthesis; (5) some circRNAs can be translated into peptide chains. With the in-depth research, the importance of circRNA in life science has been gradually recognized by researchers, but the current research mainly focuses on the field of human medicine and model animals such as mice, and there are few studies on circRNA related to pig skeletal muscle development. Identifying important circRNAs that regulate pig muscle development can help reveal the mechanism of pig muscle generation and promote the process of pig molecular breeding. SUMMARY

[0004] Therefore, the present application carries out whole transcriptome sequencing on the muscle tissue of Min pig, analyzes the expression characteristics of circRNA in muscle tissue, finds a new circRNA-Circ-21490, and the difference expression of Circ-21490 in the longissimus dorsi muscle of different development periods shows that Circ-21490 may play an important role in muscle development.

[0005] The application of the circRNA in the proliferation of pig skeletal muscle satellite cells, the circRNA is Circ-21490, the nucleotide sequence of Circ-21490 is shown as SEQ ID No: 1.

[0006] Further, the pig skeletal muscle satellite cell is a Min pig skeletal muscle satellite cell.

[0007] The kit contains specific primer pairs for detecting the circRNA marker of the application.

[0008] Further, the kit is used for detecting the expression level of Circ-21490.

[0009] Further, the upstream primer shown as SEQ ID No: 2 and the downstream primer shown as SEQ ID No: 3 are included.

[0010] Further, the expression level of Circ-21490 is the relative expression level of Circ-21490 in the pig skeletal muscle satellite cell, and if the expression level is increased, it indicates that the pig skeletal muscle satellite cell has strong proliferation ability.

[0011] The present application provides a marker Circ-21490 related to the proliferation of pig skeletal muscle satellite cells and the application thereof. The present application successfully clones and identifies a new circRNA sequence-Circ-21490, determines that Circ-21490 is a marker for the proliferation of pig skeletal muscle satellite cells through molecular biology methods, and overexpression of Circ-21490 can promote the proliferation of pig skeletal muscle satellite cells. A detection kit containing specific primer pairs of Circ-21490 is designed, and the expression level of Circ-21490 is analyzed by using the kit, so as to identify the proliferation potential of pig skeletal muscle satellite cells.

[0012] The present application comprises the following beneficial effects:

[0013] (1) A new circRNA-Circ-21490 is cloned and identified in the muscle tissue of Min pig, and it is found that it is mainly located in the cytoplasm and may play a regulatory role as ceRNA to absorb miRNA.

[0014] (2) Circ-21490 promotes the proliferation of porcine skeletal muscle satellite cells.

[0015] (3) Circ-21490 can be used as a marker of the proliferation ability of porcine skeletal muscle satellite cells.

[0016] (4) The expression level of Circ-21490 can identify the cell proliferation ability.

[0017] (4) A kit for detecting the proliferation ability of porcine skeletal muscle satellite cells is provided.

[0018] (5) A method for promoting the proliferation of porcine skeletal muscle satellite cells is provided. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Circ-21490 circular structure mode diagram;

[0020] Figure 2 Circ-21490 loop formation identification result diagram; lanes 1 and 5 are DNA molecular weight standards, lanes 2 and 6 are divergent primer amplification results, lanes 3 and 7 are convergent primer amplification results, and lanes 4 and 8 are internal reference β-actin amplification results;

[0021] Figure 3 PCR product sequencing identification result diagram; the arrow indicates the reverse splicing site;

[0022] Figure 4 RNase R enzyme resistance of Circ-21490 analyzed by reverse transcription PCR method diagram; lane 1 is a DNA molecular weight marker; lanes 2 and 4 are divergent primer amplification results, and 3 and 5 are convergent primer amplification results;

[0023] Figure 5 RNase R enzyme resistance of Circ-21490 analyzed by Real-time PCR method diagram;

[0024] Figure 6 Subcellular localization result diagram;

[0025] Figure 7 Circ-21490 overexpression efficiency detection diagram;

[0026] Figure 8 CCK-8 analysis of the effect of Circ-21490 on skeletal muscle satellite cell proliferation diagram;

[0027] Figure 9 EdU analysis of the effect of Circ-21490 on skeletal muscle satellite cell proliferation diagram;

[0028] Figure 10Figure of the effect of Circ-21490 on the expression of cell proliferation marker gene PCNA mRNA;

[0029] Figure 11 Figure of the effect of Circ-21490 on the expression of cell proliferation marker gene PCNA protein. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solutions and advantages of the embodiments of the present application more clear, the spirit of the present application will be described in detail below, and any person skilled in the art can make changes and modifications to the technology taught by the present application content after understanding the embodiments of the present application, without departing from the spirit and scope of the present application content.

[0031] The schematic embodiments of the present application and their descriptions are used to explain the present application, but not as a limitation of the present application.

[0032] Embodiment one

[0033] Circ-21490 loop identification and sequence analysis

[0034] 1. Total RNA extraction: collect the longissimus dorsi muscle of the Min pig / collect porcine skeletal muscle satellite cells, and extract total RNA by using the Trizol method.

[0035] 2. Genomic DNA (gDNA) extraction: take the longissimus dorsi muscle of the Min pig, and perform genomic DNA extraction by using the conventional phenol-chloroform method.

[0036] 3. Reverse transcription to synthesize cDNA: use the PrimeScript RT reagent Kit with gDNAEraser kit of Takara Company, and operate according to the instructions, and the reverse transcription primer is the random primer provided in the kit. TM

[0037] 4. Circ-21490 prediction: circRNA prediction is performed on the whole transcriptome sequencing results of muscle tissue obtained in the laboratory, and it is found that the epidermal growth factor (Epidermal Growth Factor, EGF) gene exists in the circular transcript, which is named Circ-21490. The predicted Circ-21490 loop structure characteristics are shown in Figure 1 ( Figure 1 Circ-21490 is formed by connecting exons 16-18 of the EGF gene).

[0038] The nucleotide sequence of Circ-21490 is as follows:

[0039] ​GTCGTGGGAAAGATCTGAGTGATGGAGTAATGCCAGTGGACACCTTACCCAGA

[0040] AGCAGAGAGCTTGAAGATAACCTTACAGAATCTCAACACATTCTAGTGGCTGAAATC

[0041] ATGGTTTCAGATGACGAGGACTGCGGCGCTGCGGGATGCAGTGCGCAGGCGCGGTG

[0042] TGTTACAGAGGGAGAGGACGCCACGTGTCAGTGTTTGAAAGGATTTGCTGGAGATG

[0043] GAAACCTGTGTTCTGATATAGATGAGTGTGAGCTGGGCACCTCGGTGTGCCCTCCTA

[0044] CCTCCTCCGAGTGCATCAATACCGAAGGTGGTCACGTCTGCCGCTGCTCGGAAGGCT

[0045] ACCAGGGAGATGGGATCCACTGTCTCG。

[0046] 5. Primer design: According to the predicted sequence of Circ-21490 obtained by high-throughput sequencing, Circ-21490-full-F / R primers were designed for amplifying the full length of Circ-21490; divergent primers (Divergent) and convergent primers (Convergent) across the splice site were designed for the loop identification of Circ-21490; and according to the pig beta-actin sequence published on GenBank, amplification primers were designed. The primer sequences are shown in Table 1.

[0047] Table 1 Circ-21490 cloning and identification primers

[0048]

[0049] 6. PCR Amplification and Sequence Analysis: PCR amplification was performed using porcine longissimus dorsi muscle cDNA and gDNA as templates, with β-actin as an internal control. The amplification primers were the divergent primer Circ-21490-DiV-F / R and the convergent primer Circ-21490-CoN-F / R. The PCR reaction system is shown in Table 2; the reaction conditions were: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension at 1000 bp / min for 32 cycles, final extension at 72℃ for 7 min, and storage at 16℃.

[0050] The results showed that when cDNA was used as a template, both convergent and divergent primers amplified a single target band; however, when gDNA was used as a template, only the convergent primer amplified a band, while the divergent primer did not amplify any band. This proves that Circ-21490 is a circular sequence and is truly expressed in muscle tissue. PCR circularization identification results are shown below. Figure 2 .

[0051] PCR products were extracted using a gel extraction kit from Novizan (Novazia). After purification using the Gel DNA Extraction Mini Kit, the DNA was ligated into the pMD-18T vector, transformed into E. coli DH5α, and after plasmid extraction and identification, positive clones were sent to Beijing BGI Genomics Co., Ltd. for sequencing. Sequencing results are shown below. Figure 3 .

[0052] Table 2 PCR amplification system

[0053]

[0054] Example 2

[0055] Stability and subcellular localization analysis of Circ-21490

[0056] 1. RNase R Digestion Assay: The stability of Circ-21490 was analyzed using an RNase R digestion assay. Total RNA from the longissimus dorsi muscle was treated with RNase R, and cDNA was synthesized by reverse transcription. Conventional PCR amplification was performed using primers Circ-21490-DiV-F / R and Circ-21490-CoN-F / R, respectively. The results showed that both primer pairs amplified bands in the untreated cDNA samples, while the parental linear transcripts were almost completely lost in the RNase R-treated cDNA. Simultaneously, real-time PCR was used to analyze the changes in the expression levels of Circ-21490 and the parental gene's linear transcripts (EGF) before and after RNase R digestion. The results showed that RNase R treatment did not lead to a decrease in the relative expression level of Circ RNA, but the relative expression level of linear transcripts was significantly reduced.

[0057] Total RNA extraction, reverse transcription and PCR amplification were performed according to Example 1. The real-time PCR reaction was performed using TB Green Premix Ex Taq kit from Takara, and the operation was strictly in accordance with the instructions. β-actin was used as an internal reference. Three independent experiments were performed, and each sample was set in triplicate. The relative expression of the target gene was calculated using the 2-ΔΔCt method. The primers for real-time PCR are shown in Table 3. The PCR amplification results are shown in Premix Ex Taq TM II(Tli RNaseH Plus) kit according to the instructions. β-actin was used as an internal reference. Three independent experiments were performed, and each sample was set in triplicate. The relative expression of the target gene was calculated using the 2-ΔΔCt method. The primers for real-time PCR are shown in Table 3. The PCR amplification results are shown in Figure 4 , and the real-time PCR analysis results are shown in Figure 5 .

[0058] Table 3 Real-time PCR primers

[0059]

[0060] 2. Subcellular localization analysis: Total RNA was extracted from muscle tissue, and the RNA of the nucleus and cytoplasm was separated using a cytoplasmic & nuclear RNA purification kit. The operation was strictly in accordance with the instructions. The obtained RNA was quality tested, and then reverse transcribed into nuclear cDNA and cytoplasmic cDNA. The reverse transcription method was the same as in Example 1. The obtained cDNA was used as a template to analyze the subcellular localization of Circ-21490 by real-time PCR method. The results showed that Circ-21490 was mainly located in the cytoplasm, and it was possible to play a regulatory role as an endogenous competitive RNA. The primers for real-time PCR are shown in Table 3; and the subcellular localization analysis results are shown in Figure 6 .

[0061] Example Three

[0062] Effect of Circ-21490 on skeletal muscle satellite cell proliferation

[0063] 1. Skeletal muscle satellite cells: Isolated and preserved by the laboratory in the early stage. The cells were resuscitated and cultured according to the following specific operation:

[0064] (1) Cell resuscitation: The frozen cells were taken out from liquid nitrogen and quickly placed in 37℃ water. The cells were resuscitated by shaking and centrifuged at 1000 rpm for 5 min. The supernatant was discarded, and the complete culture medium was resuspended and transferred to a 6 cm culture dish. The cells were cultured in a 37℃, 5% CO2 cell incubator.

[0065] (2) Passage: the next day to observe the cell density and pollution, such as no pollution, with complete medium continued to culture, when the cell density reached 90% passage.

[0066] 2. Overexpression vector construction

[0067] The full-length sequence of Circ-21490 was amplified by primer Circ-21490-full-F / R, and the full-length sequence and empty vector pCD2.1-CIR were double-digested with KpnI and BamHI, respectively. After purification, the enzyme digestion products were ligated with T4 DNA ligase. The enzyme digestion and ligation system was as follows:

[0068] Enzyme digestion system: total system 20 μL, containing KpnI and BamHI 1 μL each, 10×Buffer 2 μL, DNA 1 μg, adding ddH2O to 20 μL. Reaction conditions: 37°C water bath incubation for 30 min.

[0069] Ligation system: T4 DNA ligase and Buffer 1.0 μL each, linearized vector and full-length DNA sequence were added to the reaction mixture according to the mass ratio of 1:3-1:10, and dd H2O was added to 10 μL. Reaction conditions: 16°C overnight.

[0070] The ligation product was transformed into E. coli DH5α, and after plasmid extraction and identification, the positive clones were sent to Beijing Huada Gene Technology Co., Ltd. for sequencing identification.

[0071] Table 4 Circ-21490 full-length amplification primer

[0072]

[0073] Note: Underline indicates KpnI and BamHI recognition site

[0074] 3. Cell transfection: cells were inoculated into culture plates, and when the confluence reached 60%, the overexpression vector and empty vector were transfected into porcine skeletal muscle satellite cells, respectively. The transfection reagent was Lipofectamine 2000, and the operation was strictly according to the instructions. The blank group, control group and experimental group each had 3 repeats.

[0075] 4. Overexpression efficiency detection

[0076] After transfection for 48 h, the cells were collected, total RNA was extracted, and cDNA was reverse transcribed for real-time PCR amplification. The blank group, control group and experimental group each had 3 repeats. It was determined that the constructed overexpression vector could realize Circ-21490 overexpression in skeletal muscle satellite cells. The detailed methods of RNA extraction, reverse transcription and real-time PCR amplification were shown in Example 1. The amplification results were shown in Figure 7 .

[0077] 5.CCK8 detection

[0078] At 0, 24, 48, 72, 96, and 120 h after transfection, 10 μL enhanced CCK8 solution was added to the cells, and incubated for 2 h. The absorbance was measured at 450 nm, and the obtained values were statistically analyzed and plotted to generate a cell growth viability curve. The results showed that the viability of skeletal muscle satellite cells was significantly increased after overexpression of Circ-21490 (p < 0.01). The results are shown in Figure 8 .

[0079] 5.EdU detection

[0080] The cells were collected at 24 h after transfection, and the operation was performed according to the BeyoClick EdU-555 cell proliferation detection kit of Biyun Tian Company to detect the cell proliferation. It was found that the number of skeletal muscle satellite cells was significantly increased after overexpression of Circ-21490 (p < 0.05). The results are shown in Figure 9 .

[0081] 6.Expression detection of proliferation marker genes

[0082] (1) Real-time PC analysis: The cells were collected at 48 h after transfection, and the total RNA was extracted and reversely transcribed into cDNA. The transcriptional expression of the proliferation marker gene PCNA was detected by real-time PCR method. The detailed methods of RNA extraction, reverse transcription, and real-time PCR amplification are shown in Example I. The results are shown in Figure 10 .

[0083] (2) Western blotting analysis: The cells were collected at 48 h after transfection, and the total protein was extracted by using the RIPAbuffer of Biyun Tian Company. The concentration was determined by using the BCA protein concentration determination kit, and 25-30 μg of total protein was loaded on the SDS-PAGE gel for 2 h of electrophoresis for total protein separation. The electrophoresis results were transferred to the PVDF membrane, which was blocked in 5% skim milk for 1 h. The primary antibody (Proteintech Company) was added at a dilution of 5000 times, and incubated at 4°C overnight. After washing and recovering the PVDF membrane, the fluorescent secondary antibody was added and incubated for 1 h. β-tubulin was used as an internal reference. The hybridization results were detected by using the UVP ChemStudioTM PLUS touch instrument of Analytik Jena Company. The results are shown in Figure 11 .

Claims

1. The application of Circ-21490 in the proliferation of porcine skeletal muscle satellite cells, characterized by... The nucleotide sequence of Circ-21490 is shown in SEQ ID No:1, and the application is for non-therapeutic or non-diagnostic purposes.

2. The application of Circ-21490 as described in claim 1 in the proliferation of porcine skeletal muscle satellite cells, characterized in that, The porcine skeletal muscle satellite cells mentioned are porcine skeletal muscle satellite cells.

3. The application of Circ-21490 according to claim 2 in the proliferation of porcine skeletal muscle satellite cells, characterized in that, The number of skeletal muscle satellite cells increases after Circ-21490 is overexpressed.

Images