Use of a fundc1 inhibitor in the preparation of a medicament for preventing or treating skin photo-damage

Abstract

This invention relates to the application of FUNDC1 inhibitors in the preparation of drugs for preventing and treating photodamage to the skin. Specifically, FUNDC1 inhibitors alleviate, reduce, or prevent photodamage by inhibiting or reducing FUNDC1 expression. This invention establishes a photodamage model using mouse skin and HaCaT cells irradiated with UVB. UVB treatment showed downregulation of FUNDC1 expression. Given that FUNDC1 overexpression exacerbates UVB-induced photodamage, this invention explores whether knocking down FUNDC1 can protect HaCaT cells and the mouse model from UVB-induced photodamage. After FUNDC1 knockdown, cell viability increased to 80%, and compared to the UVB group, ROS levels, apoptosis, and γH2Ax expression were reduced. Following UVB irradiation, FUNDC1 knockdown also alleviated mitochondrial damage, manifested as uniform mitochondrial distribution along the cell nucleus, mitochondrial membrane potential repolarization, and reduced mtROS accumulation. This invention proposes that intervening in FUNDC1-mediated mitophagy, by regulating the mitochondrial apoptosis pathway, can protect against UVB-induced mitochondrial and photodamage, providing a potential target for future mitigation of photodamage to the skin.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of FUNDC1 inhibitors in the preparation of drugs for preventing and treating photodamage to the skin. Background Technology

[0002] Mitochondria produce most of the cell's energy through oxidative phosphorylation and ETC, existing in the form of ATP, providing energy for cellular life activities. During oxygen metabolism, mitochondria produce a natural byproduct, mtROS, which leads to mtDNA mutations. Ultraviolet radiation (UVR, 295–400 nm) reaching the Earth's surface includes UVA (long-wave ultraviolet radiation with a dark spot effect, 320–400 nm) and UVB (medium-wave ultraviolet radiation, 280–320 nm). Although UVB accounts for only 5% of the ultraviolet (UV) radiation reaching the Earth's surface, its energy is higher than UVA, and its side effects on the skin are more significant. UVB can penetrate the epidermis, while UVA mainly penetrates the dermis. UV can cause acute or chronic photodamage to human skin, with acute photodamage primarily caused by UVB. Ultraviolet radiation damages mitochondria in skin cells (including keratinocytes, epidermal stem cells, melanocytes, fibroblasts, etc.). UV radiation can induce oxidative stress and damage to mitochondrial DNA (mtDNA), including the production of mitochondrial ROS (mtROS) and mtDNA mutations, leading to mitochondrial depolarization, mitochondrial dysfunction, and consequently, photodamage to the skin. Based on the aforementioned mechanisms, mitochondrial abnormalities are involved in UV-induced skin damage.

[0003] FUNDC1 is a key receptor regulating mitophagy. Composed of 155 amino acids, it is a highly conserved transmembrane protein in most mammals, including humans. FUNDC1 interacts with LC3 to mediate mitophagy. Under normal conditions, FUNDC1 is stably present on the outer mitochondrial membrane without mediating mitophagy. That is, under normal conditions, FUNDC1 is phosphorylated by tyrosine kinases, resulting in a weak affinity for LC3 and inhibiting autophagy. Under ischemic and hypoxic conditions, tyrosine kinases are inactivated, significantly increasing the affinity of FUNDC1 for LC3. Furthermore, FUNDC1 can be activated by serine / threonine protein phosphatases through dephosphorylation, thereby inducing mitophagy.

[0004] Mitophagy clears damaged and unwanted mitochondria from cells and is involved in cellular energy balance under various pathological conditions. During photodamage, PINK1-Parkin-mediated mitophagy is activated only under certain conditions, while BNIP3-mediated mitophagy is sometimes insufficient to protect cells from photodamage. Although studies have shown that light radiation can induce autophagy in some mitochondria, the role of FUNDC1-mediated mitophagy in ultraviolet radiation (UVR) photodamage remains unreported. Investigating the role of FUNDC1 in UVR-induced photodamage is crucial for future efforts to alleviate skin problems.

[0005] Furthermore, on the one hand, there are differences in understanding among those skilled in the art; on the other hand, the applicant studied a large number of documents and patents when making this invention, but due to space limitations, not all details and contents were listed in detail. However, this does not mean that the present invention does not possess the features of these prior art. On the contrary, the present invention already possesses all the features of the prior art, and the applicant reserves the right to add relevant prior art to the background art. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the first aspect of this invention provides the application of FUNDC1 inhibitors in the preparation of drugs for preventing and treating photodamage to the skin. FUNDC1 inhibitors include small molecule compounds, high molecular weight polymers, peptides, proteins, nucleic acid substances, or viruses capable of regulating FUNDC1 expression in a subject. Nucleic acid substances also include substances related to FUNDC1 that have been silenced, knocked out, or partially knocked out through genetic engineering. FUNDC1 inhibitors alleviate, reduce, or prevent photodamage to the skin by inhibiting or reducing FUNDC1 expression.

[0007] According to a preferred embodiment, FUNDC1 inhibitors reduce intracellular ROS levels by inhibiting or reducing the expression of FUNDC1, thereby alleviating, reducing or preventing photodamage to the skin.

[0008] According to a preferred embodiment, FUNDC1 inhibitors reduce cell apoptosis and necrosis by inhibiting or reducing the expression of FUNDC1, thereby alleviating, reducing or preventing photodamage to the skin.

[0009] According to a preferred embodiment, FUNDC1 inhibitors alleviate nuclear damage by inhibiting or reducing the expression of FUNDC1, thereby relieving, reducing, or preventing photodamage to the skin.

[0010] According to a preferred embodiment, FUNDC1 inhibitors reduce the expression level of γH2Ax, which reflects nuclear damage, by inhibiting or reducing the expression of FUNDC1, thereby alleviating, reducing or preventing photodamage to the skin.

[0011] According to a preferred embodiment, FUNDC1 inhibitors alleviate mitochondrial damage by inhibiting or reducing the expression of FUNDC1, thereby relieving, reducing or preventing photodamage to the skin.

[0012] According to a preferred embodiment, FUNDC1 inhibitors regulate mitochondrial distribution by inhibiting or reducing FUNDC1 expression, thereby alleviating, reducing, or preventing photodamage to the skin.

[0013] According to a preferred embodiment, FUNDC1 inhibitors promote uniform mitochondrial distribution by inhibiting or reducing the expression of FUNDC1, thereby alleviating, reducing or preventing photodamage to the skin.

[0014] According to a preferred embodiment, FUNDC1 inhibitors regulate mitochondrial membrane polarization by inhibiting or reducing FUNDC1 expression, thereby alleviating, reducing, or preventing photodamage to the skin.

[0015] According to a preferred embodiment, FUNDC1 inhibitors promote mitochondrial membrane polarization by inhibiting or reducing the expression of FUNDC1, thereby alleviating, reducing or preventing photodamage to the skin.

[0016] According to a preferred embodiment, FUNDC1 inhibitors regulate mitochondrial membrane potential by inhibiting or reducing the expression of FUNDC1, thereby alleviating, reducing or preventing photodamage to the skin.

[0017] According to a preferred embodiment, FUNDC1 inhibitors promote an increase in mitochondrial membrane potential by inhibiting or reducing the expression of FUNDC1, thereby alleviating, reducing or preventing photodamage to the skin.

[0018] According to a preferred embodiment, the FUNDC1 inhibitor promotes the expression of the mitochondrial protein COX4 by inhibiting or reducing the expression of FUNDC1, thereby alleviating, reducing or preventing photodamage to the skin.

[0019] According to a preferred embodiment, FUNDC1 inhibitors protect mitochondria from apoptosis by inhibiting or reducing FUNDC1 expression to complement PINK1-Parkin-mediated mitophagy.

[0020] According to a preferred embodiment, FUNDC1 inhibitors protect mitochondria from apoptosis by inhibiting or reducing the expression of FUNDC1 and upregulating the expression of the anti-apoptotic protein Bcl2.

[0021] According to a preferred embodiment, FUNDC1 inhibitors protect mitochondria from apoptosis by inhibiting or reducing the expression of FUNDC1 and downregulating the expression of the pro-apoptotic protein Bax.

[0022] According to a preferred embodiment, FUNDC1 inhibitors protect mitochondria from apoptosis by inhibiting or reducing the expression of FUNDC1, upregulating the expression of the anti-apoptotic protein Bcl2, and downregulating the expression of the pro-apoptotic protein Bax.

[0023] According to a preferred embodiment, photodamage is damage caused by ultraviolet radiation.

[0024] According to a preferred embodiment, the light damage is damage caused by medium-wave ultraviolet (UVB).

[0025] According to a preferred embodiment, the silencing in the genetic engineering method is to silence the FUNDC1 gene using shRNA.

[0026] According to a preferred embodiment, the shRNA sequence is shown in one of SEQ ID NO: 1 to SEQ ID NO: 3.

[0027] A second aspect of the present invention provides an shRNA sequence that specifically inhibits or reduces the expression of FUNDC1, the sequence of which is shown in one of SEQ ID NO: 1 to SEQ ID NO: 3.

[0028] A third aspect of the present invention provides a vector comprising the shRNA sequence provided in the second aspect of the present invention.

[0029] The fourth aspect of this invention provides the use of the shRNA sequence provided in the second aspect of this invention or the vector provided in the third aspect of this invention in the preparation of FUNDC1 gene-deleted cell lines.

[0030] The fifth aspect of the present invention provides a kit for knocking down the FUNDC1 gene, which comprises the shRNA sequence provided in the second aspect of the present invention or the vector provided in the third aspect of the present invention.

[0031] The sixth aspect of the present invention provides an sgRNA sequence that specifically inhibits or reduces the expression of FUNDC1, the sequence of which is shown in one of SEQ ID NO: 14 to SEQ ID NO: 16.

[0032] A seventh aspect of the present invention provides a vector comprising the sgRNA sequence provided in the sixth aspect of the present invention.

[0033] The eighth aspect of the present invention provides a kit for knocking down the FUNDC1 gene, which comprises the sgRNA sequence provided in the sixth aspect or the vector provided in the seventh aspect of the present invention.

[0034] The ninth aspect of the present invention provides a pharmaceutical composition for preventing and treating photodamage to the skin. The pharmaceutical composition includes FUNDC1 and a pharmaceutically acceptable carrier or excipient, wherein the FUNDC1 inhibitor includes a small molecule compound, a high molecular weight polymer, a polypeptide, a protein, a nucleic acid substance or a virus capable of regulating the expression of FUNDC1 in a subject, wherein the nucleic acid substance further includes substances related to silencing, knocking out or partially knocking out FUNDC1 based on genetic engineering methods.

[0035] According to a preferred embodiment, the silencing in the genetic engineering method is to silence the FUNDC1 gene using shRNA.

[0036] According to a preferred embodiment, the shRNA sequence is shown in one of SEQ ID NO: 1 to SEQ ID NO: 3.

[0037] According to a preferred embodiment, the silencing in the genetic engineering method is to silence the FUNDC1 gene using sgRNA.

[0038] According to a preferred embodiment, the sequence of the sgRNA is shown in one of SEQ ID NO: 14 to SEQ ID NO: 6.

[0039] The tenth aspect of the present invention provides a method for preparing a drug for preventing and treating photodamage to the skin, the method comprising: providing a FUNDC1 inhibitor; mixing the FUNDC1 inhibitor with a pharmaceutically acceptable carrier or excipient; and preparing the mixture into a pharmaceutical form, wherein the FUNDC1 inhibitor comprises a small molecule compound, a high molecular weight polymer, a polypeptide, a protein, a nucleic acid substance or a virus capable of regulating the expression of FUNDC1 in a subject, wherein the nucleic acid substance further comprises substances related to silencing, knocking out or partially knocking out FUNDC1 based on genetic engineering methods.

[0040] According to a preferred embodiment, the silencing in the genetic engineering method is to silence the FUNDC1 gene using shRNA.

[0041] According to a preferred embodiment, the shRNA sequence is shown in one of SEQ ID NO: 1 to SEQ ID NO: 3.

[0042] The eleventh aspect of this invention provides an application of FUNDC1 as a target in screening drugs for preventing and treating photodamage to the skin.

[0043] The twelfth aspect of this invention provides a method for treating photodamage to a patient's skin. The method includes administering an effective amount of a FUNDC1 inhibitor to the patient. The FUNDC1 inhibitor comprises a small molecule compound, a high molecular weight polymer, a polypeptide, a protein, a nucleic acid substance, or a virus capable of regulating FUNDC1 expression in a subject, wherein the nucleic acid substance further includes substances related to FUNDC1 that have been silenced, knocked out, or partially knocked out through genetic engineering.

[0044] FUNDC1 (FUN14 Domain Containing 1) is a protein associated with mitophagy. Currently, existing technologies provide several methods and compounds for specific inhibition of FUNDC1, such as: small interfering RNA (siRNA) or short hairpin RNA (shRNA): these are gene silencing techniques that can be used to specifically reduce FUNDC1 expression. FUNDC1 phosphorylation regulators: ULK1 inhibitors: such as SBI-0206965, can indirectly affect FUNDC1 activity because ULK1 is involved in FUNDC1 phosphorylation. PGAM5 inhibitors: PGAM5 is a dephosphorylase of FUNDC1, and inhibiting PGAM5 may affect FUNDC1 activity. Mitophagy inhibitors: although not directly targeting FUNDC1, they can affect the FUNDC1-mediated mitophagy process: Mdivi-1: a mitochondrial fission inhibitor; 3-methyladenine (3-MA): an autophagy inhibitor. Antioxidants: Some antioxidants, such as N-acetylcysteine ​​(NAC), may indirectly affect the activity of FUNDC1 by regulating oxidative stress. Specific peptide inhibitors also include small molecule compounds.

[0045] Beneficial Effects: This invention established a skin photodamage model using C57BL / 6 mice. Since UVB primarily penetrates the epidermis, a cellular photodamage model was established by irradiating HaCaT cells with UVB. Gross photographs revealed clinical features of photodamage such as erythema, scaling, and crusting, and significant telangiectasia was observed under dermomicroscopy with polarized light. Histological examination (HE sections) showed that the mouse epidermis began to thicken 24 hours after UVB irradiation, with significant crusting at 72 hours, and extensive infiltration of inflammatory cells in the dermis, thus confirming the successful establishment of a mouse skin photodamage model. Cell viability after UVB irradiation was assessed using CCK8 at 30 mJ / cm². 2 At UVB doses of 30 mJ / cm², cell viability decreased to approximately 60%. 2After irradiation, an increase in intracellular ROS, apoptosis, and necrosis, as well as an increase in γH2Ax expression levels, were observed, further indicating that this study successfully established a UVB-induced photodamage model of HaCaT cells.

[0046] Most studies on the mitochondrial mechanisms involved in UVB-induced photodamage involve mitochondrial function and related signaling pathways. To further explore the mitochondrial mechanism in UVB-induced photodamage, this invention uses the GEO (GSE138800) database to analyze different UVB doses (20 mJ / cm²). 2 and 40mJ / cm 2 The differentially expressed genes before and after irradiation were intersected with mitochondrial-related genes in the Amigo 2 database, and these genes were enriched using KEGG, suggesting that mitophagy plays an important role in UVB-induced photodamage. Furthermore, the second part of this invention explores the roles of mitophagy and mitophagy in UVB-induced skin photodamage.

[0047] In mammals, mitophagy includes PINK1 / Parkin-dependent ubiquitin-mediated mitophagy and BNIP3 / FUNDC1-dependent receptor-mediated mitophagy. This invention used Western blot to detect the expression of mitophagy-related molecules in mouse dorsal skin after UVB irradiation. The results showed that FUNDC1 decreased at 24 and 72 hours after UVB irradiation, while BNIP3, PINK1, and Parkin remained unchanged. These results indicate that FUNDC1 receptor-mediated mitophagy plays a crucial role in UVB-induced photodamage, while ubiquitin-mediated (PINK1 / Parkin) mitophagy is not directly activated after UVB irradiation. Similarly, after exposure to 30 mJ / cm²... 2 In HaCaT cells exposed to UVB, FUNDC1 levels decreased while BNIP3 expression increased, indicating receptor-mediated changes in mitophagy following UVB irradiation. Conversely, PINK1 and Parkin showed no change before and after UVB exposure, consistent with the results in mice. Furthermore, this invention validated FUNDC1 expression in human specimens and found that FUNDC1 expression was reduced in sun-exposed skin, exhibiting a downregulation consistent with both mice and cells.

[0048] The above has demonstrated that FUNDC1-mediated mitophagy is inhibited in UVB-irradiated mouse skin and HaCaT cells. Therefore, this invention aims to alleviate or prevent photodamage by overexpressing FUNDC1 to promote mitophagy, thereby enhancing the ability to clear damaged mitochondria and inhibiting mitochondrial apoptosis. Unexpectedly, FUNDC1 overexpression exacerbated UVB-induced mitochondrial and photodamage. After UVB irradiation, FUNDC1 overexpression led to a decrease in cell viability to 30%, accompanied by increases in ROS, apoptosis, and γH2Ax levels. The aggravation of mitochondrial damage included a more pronounced distribution of mitochondria along the long axis of the nucleus at both poles, a further increase in mtROS, and a further decrease in mitochondrial membrane potential. FUNDC1 overexpression did not protect against mitochondrial apoptosis-mediated photodamage by promoting the clearance of damaged mitochondria. On the contrary, the complete disappearance of the mitochondrial protein COX4 suggests that after FUNDC1 overexpression, UVB irradiation of HaCaT cells may result in the indiscriminate clearance of both healthy and damaged mitochondria.

[0049] Given that FUNDC1 overexpression exacerbates UVB-induced photodamage, this invention explored whether FUNDC1 knockdown could protect HaCaT cells from UVB-induced photodamage. After FUNDC1 knockdown, cell viability increased to 80%. Compared to the UVB group, ROS levels, apoptosis, and γH2Ax expression were reduced. Following UVB irradiation, FUNDC1 knockdown also alleviated mitochondrial damage, manifested as uniform mitochondrial distribution along the nucleus, mitochondrial membrane potential repolarization, and reduced mtROS accumulation. In terms of mechanism, the results of this invention indicate that FUNDC1 knockdown alleviates mitochondrial and photodamage by compensating for PINK1 / Parkin-mediated mitophagy. Therefore, this invention proposes that intervening in FUNDC1-mediated mitophagy, by regulating the mitochondrial apoptosis pathway, can protect against UVB-induced mitochondrial and photodamage, providing a potential target for future mitigation of skin photodamage. Attached Figure Description

[0050] Figure 1 These are macroscopic photographs before and after UVB irradiation, as well as dermoscopic photographs under unpolarized and polarized light, provided by this invention.

[0051] Figure 2 These are the HE staining results provided by this invention;

[0052] Figure 3 This invention provides the effect of different doses of UVB on the survival rate of HaCaT cells;

[0053] Figure 4 This invention provides the effect of UVB on ROS levels in HaCaT cells;

[0054] Figure 5 This invention provides the levels of cell apoptosis and necrosis after UVB irradiation.

[0055] Figure 6 This invention provides the degree of nuclear damage after UVB irradiation;

[0056] Figure 7 The present invention provides the detection results of COX4 levels in the back of mice and HaCaT cells irradiated with UVB.

[0057] Figure 8 The present invention provides statistical results for measuring ATP levels in mouse back skin and HaCaT cells under UVB irradiation. Figure 9 The present invention describes the change in mitochondrial distribution in HaCaT cells after UVB irradiation.

[0058] Figure 10 This invention provides the level of mtROS in HaCaT cells after UVB irradiation.

[0059] Figure 11 This invention provides the change in mitochondrial membrane potential after UVB irradiation of HaCaT cells;

[0060] Figure 12 This invention provides a control group (UVB concentration of 20 mJ / cm²) of GEO (GSE138800) before and after UVB irradiation. 2 Differential expression of HaCaT cell mRNA was cross-analyzed with mitochondrial-related genes in the Amigo 2 database;

[0061] Figure 13 This invention provides a control group (UVB concentration of 40 mJ / cm²) of GEO (GSE138800) before and after UVB irradiation. 2 Differential expression of HaCaT cell mRNA was cross-analyzed with mitochondrial-related genes in the Amigo 2 database;

[0062] Figure 14 This invention provides changes in the expression of mitochondrial apoptosis-related molecules after UVB irradiation of mouse back skin.

[0063] Figure 15 This invention provides the results of changes in the expression of mitochondrial apoptosis-related molecules after UVB irradiation of mouse back skin;

[0064] Figure 16 This invention provides information on the changes in the expression of mitochondrial apoptosis-related molecules in HaCaT cells after UVB irradiation.

[0065] Figure 17This invention provides the results of changes in the expression of mitochondrial autophagy-related molecules after UVB irradiation of mouse back skin;

[0066] Figure 18 This invention provides the results of colocalization of FUNDC1 and COX4 after UVB irradiation of mouse back skin;

[0067] Figure 19 This invention provides the results of colocalization of LC3B and COX4 detected after UVB irradiation of mouse back skin;

[0068] Figure 20 The results show the expression of mitochondrial autophagy-related molecules after irradiation of mouse HaCaT cells with different doses of UVB provided by this invention.

[0069] Figure 21 This invention provides the results of changes in the expression of mitochondrial autophagy-related molecules at different time points after UVB irradiation of HaCaT cells.

[0070] Figure 22 This invention provides the results of detecting the co-localization of FUNDC1 and COX4 in HaCaT cells after UVB irradiation.

[0071] Figure 23 This invention provides the results of detecting LC3B and COX4 colocalization after UVB irradiation of HaCaT cells;

[0072] Figure 24 This invention provides the results of FUNDC1 expression changes in non-exposed and exposed areas of human skin tissue.

[0073] Figure 25 This is a schematic diagram of the hu6-mcs-cmv-purinemycin lentiviral vector encoding FUNDC1 short hairpin RNA provided by the present invention;

[0074] Figure 26 The result of FUNDC1 overexpression enhancing UVB-induced photodamage provided by this invention;

[0075] Figure 27 The result of FUNDC1 overexpression provided by this invention is the indiscriminate clearance of damaged and undamaged mitochondria and mitochondrial depletion caused by ATP depletion.

[0076] Figure 28 The FUNDC1 silencing provided by this invention reduces UVB-induced photodamage.

[0077] Figure 29 This is the result of the FUNDC1 silencing provided by the present invention rescuing mitochondrial damage and exhaustion;

[0078] Figure 30This is the result of Western blot analysis of FUNDC1 silencing provided by the present invention. Detailed Implementation

[0079] The following is a detailed explanation with reference to the accompanying drawings.

[0080] The main reagents used in this invention are: 4% paraformaldehyde (Solepro Corporation, China); glass slides and coverslips (Solepro Corporation, China); wax-removing and clearing agent (Nanchang Yulu, China); hematoxylin stain (Saiwell Corporation, China); neutral resin (Saiwell Corporation, China); enhanced ATP assay kit (Beyotime Biotechnology Co., Ltd., China); COX4 antibody (Santa Clauses, USA); γH2Ax antibody (Immunoway, USA); OCT embedding medium (Lecia, Germany); PBS buffer (Biosharp, USA); Triton X-100 (Solepro Corporation, China); bovine serum albumin (BSA) (Solepro Corporation, China); anti-fluorescence decay mounting medium (Solepro Corporation, China); DAPI (Cell Signaling Technology, USA); goat anti-mouse IgG H&L (Alexa). 488)(Abcam, USA); Goat anti-rabbit IgG H&L (Alexa) 594)(Abcam, USA); Penicillin / Streptomycin Antibiotic Solution (Biological Industries, Israel); DMEM High Glucose Medium (Xiaopeng Biotechnology, China); Trypsin (Biological Industries, Israel); Fetal Bovine Serum (Xiaopeng Biotechnology, China); CCK8 (Yisheng Biotechnology, China); DCFH-DA (Merck, Germany); YO-PRO-1 / PI Cell Apoptosis and Necrosis Detection Kit (Beyotime Biotechnology, China); Mito-Tracker Red CMXRos (Mitochondrial Red Fluorescent Probe, High Purity) (Beyotime Biotechnology, China); MitoSOX Red Mitochondrial Superoxide Indicator (mitochondrial superoxide red fluorescent probe) (China, Yisheng Biotechnology); Mitochondrial membrane potential detection kit (JC-1) (China, Beyotime Biotechnology Co., Ltd.); Immunohistochemical high-sensitivity SP kit (China, Fuzhou Maixin Biotechnology Development Co., Ltd.); FUNDC1 antibody, BNIP3 antibody, PINK1 antibody, Parkin antibody (rabbit polyclonal antibody) (USA, Immunoway); LC3B antibody (rabbit monoclonal antibody) (USA, Abcam); Cytochrome c antibody, Cleaved-Caspase 3 antibody (rabbit monoclonal antibody) (USA, Cell Signaling). Technology Company); Bcl2 antibody, Bax antibody (rabbit monoclonal antibody) (Abmart, China); RIPA strong lysis buffer (Beyotime Biotechnology, China); Cocktail phosphatase inhibitor (Abmole, China); PMSF (Beyotime Biotechnology, China); 3mm grinding beads (Saiwell, China); BCA kit (Beyotime Biotechnology, China); SDS-PAGE loading buffer (Kangwei Century Biotechnology, China); SDS-PAGE gel kit (Biosharp Biotechnology, China); Polyacrylamide Top-layer red dye (China, Savill Corporation); anhydrous ethanol (China, Maclean's Reagent Company); pre-stained color protein marker (China, Platinum Biotech); glycine (China, Solarbio); Tris (China, Solarbio); SDS (China, Solarbio); methanol (China, Maclean's Reagent Company); PVDF membrane (USA, Millipore); skim milk powder (China, Solarbio); ECL chemiluminescence solution (China, Beyotime Biotechnology Co., Ltd.); 10×TBST solution (China, Solarbio); WB-specific primary and secondary antibody dilution buffer (China, Abixin Biotechnology Co., Ltd.);GAPDH antibody (China, Abixin Biotechnology Co., Ltd.); Peroxidase-labeled goat anti-rabbit secondary antibody (China, Proteintech Co., Ltd.); Peroxidase-labeled goat anti-mouse secondary antibody (China, Proteintech Co., Ltd.); Sodium citrate antigen retrieval solution (50×) (China, Solarbio Biotechnology Co., Ltd.); DAB chromogenic kit (China, MXB Biotechnology Co., Ltd.); Ready-to-use histochemistry kit (China, MXB Biotechnology Co., Ltd.);

[0081] The main instruments used in this invention are: -80°C deep cryogenic freezer (Thermo Fisher Scientific, USA); -20°C cryogenic freezer (Siemens AG, Germany); 4°C freezer (Thermo Fisher Scientific, USA); micropipette (Rainin Biotech, USA); dermatoscope (ILLUCO IDS1100, South Korea); embedding machine (Wuhan Junjie Technology Co., Ltd., China); paraffin tissue sectioner (Leica Biotech, Germany); cryostat (Leica Biotech, Germany); optical microscope (Olympus Biotech, Japan); Sorvall ST40R benchtop refrigerated centrifuge (Thermo Fisher Scientific, USA); UV... 801KL (Waldmann, Germany); Vortex shaker (Qilin Bell Instruments, China); Benchtop centrifuge (Thermo Fisher Scientific, USA); Microplate reader (BioTek, USA); Deionized water preparation system (Millipore, USA); Confocal microscope (Olympus, Japan); Thermo Fisher Scientific (Thermo Fisher Scientific, USA); Thermo Fisher Scientific (Thermo Fisher Scientific, USA); Biosafety workbench (Thermo Fisher Scientific, USA); Cell counter (Thermo Fisher Scientific, USA); Cytation 5 live-cell imaging analysis system (BioTek, USA); Chemiluminescence analyzer (PerkinElmer, USA); Protein gel electrophoresis tank, electrophoresis apparatus, and transfer tank (Bio-Rad, USA); Horizontal shaker (Qilin Bell Instruments, China); Chemiluminescence image analysis system (Tianeng, China); Microwave oven (Supor, China).

[0082] Mouse source and modeling: 15 wild-type C57BL / 6 female mice, 6–8 weeks old, 16–18g in weight, were obtained from Shenyang Baoliheng Biotechnology Co., Ltd., Shenyang, China. The dorsal skin of the mice was shaved and irradiated with UVB. The dorsal skin was observed 24 and 72 hours after irradiation to assess the clinical manifestations of photodamage and confirm the successful establishment of the photodamage model. Skin tissue was collected for subsequent experiments. An acute photodamage model of mouse skin was established. The procedure has passed the animal welfare and ethics review of China Medical University (KT2019051).

[0083] Cell source and modeling: Human immortalized epidermal cells (HaCat) (Cell Bank of the Chinese Academy of Sciences, Shanghai, China).

[0084] Human skin tissue source: Subjects were recruited, and skin tissue from exposed and unexposed areas was collected via biopsy. Skin tissue from both exposed and unexposed areas was obtained from the Department of Dermatology, First Affiliated Hospital of China Medical University, with ethical approval from the Medical Research Ethics Committee of the First Affiliated Hospital of China Medical University (2023-308-2). A total of 10 samples were obtained from 10 independent patients; 5 were unexposed skin samples and 5 were exposed skin samples. Skin samples were obtained from patients who underwent lesion resection at the First Affiliated Hospital of China Medical University. Details are shown in Table 1, which records the age, sex, and body location of each sample.

[0085] HaCat cells and primary keratinocytes were irradiated with UVB to establish an acute photodamage model. The cell lines were supplemented with 10% fetal bovine serum (FBS, Biological Industries) and penicillin (100 μml). -1 Streptomycin (100 μg / ml) -1 ) in Dulbecco's Modified Eagle Medium (DMEM) medium from Biological Industries, and cultured in a humidified incubator at 37°C and 5% CO2.

[0086] Following irradiation, subsequent experiments were performed using fresh FBS-free culture medium instead of PBS. Unless otherwise specified, the UVB treatment dose for mice and HaCaT was 200 mJ / cm². 2 and 30mJ / cm 2 .

[0087] This invention uses C57BL / 6 mice, HaCat cells, human primary keratinocytes, and human skin specimens as research subjects. Mice and cells were irradiated with UVB to clarify the following: ① Mitophagy in UVB-irradiated skin tissues and cells; ② Mitochondrial apoptosis in UVB-irradiated skin tissues and cells; ③ The relationship between FUNDC1-mediated mitophagy and mitochondrial apoptosis, and the compensatory role of other types of mitophagy, clarifying the key role of FUNDC1 in photodamage. This invention provides FUNDC1 as a target for screening drugs to prevent and / or treat photodamage. The active ingredients of drugs for preventing and treating photodamage include FUNDC1 inhibitors.

[0088] Statistical methods: The experimental data of this invention were obtained from at least three independent experiments, and the results are expressed as mean ± standard deviation. Image J (National Institutes of Health) was used for quantitative analysis of the images; GraphPad Prism 8.0 was used for one-way analysis of variance (ANOVA) and Tukey's post hoc test; SPSS software was used for multiple comparisons in ANOVA, and P < 0.05 was considered statistically significant. GraphPad Prism 8.0 and Adobe Illustrator were used for plotting.

[0089] Example 1

[0090] This embodiment provides the following method for studying UVB-induced skin photodamage.

[0091] 1. Methods for establishing a UVB-induced photodamage model of dorsal skin in C57BL / 6 mice

[0092] Methods: Fifteen mice were divided into three groups. The back skin of the mice was shaved (exposing 2cm×2cm of back skin) and irradiated with UVB using a UV801kl ultraviolet phototherapy device (emission range 290-315nm; Waldmann, Germany). Mice that were not irradiated with UVB served as a blank control group (also indicated as control, cont, or control in the figure). The back skin of the mice was observed at 24h and 72h after irradiation, and gross images were taken. Photos were taken using a dermatoscope (ILLUCO IDS1100, South Korea) under both flat (unpolarized) and polarized light to observe the clinical manifestations of photodamage to the back skin of the mice, such as erythema, vesicles, erosion, crusting, and telangiectasia.

[0093] 2. HE staining to observe pathological changes in mouse skin tissue

[0094] Human and mouse skin tissues were fixed in formalin, embedded in paraffin, cut into 7μm sections, and mounted; tissue sections were dewaxed and stained with hematoxylin and eosin (HE).

[0095] The specific procedures are as follows: The embedded mouse paraffin tissue blocks were sectioned using a tissue sectioner to a thickness of 5 μm; the sections were treated with paraffin-insertion dewaxing and clearing agent I for 10 min, paraffin-insertion dewaxing and clearing agent II for 10 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 95% ethanol for 5 min, 85% ethanol for 5 min, and 75% ethanol for 5 min; washed three times with PBST for 5 min each time; the sections were then placed in hematoxylin staining solution for 15 min; rinsed with PBST for 10 min; differentiated with 1% hydrochloric acid ethanol for 5–30 s; rinsed with PBS for 3 min, then blued with a weakly alkaline aqueous solution for 60 s, and rinsed with running water for 10 min; stained with eosin staining solution for 10 min; treated with 75% ethanol for 5 min, 85% ethanol for 5 min, 95% ethanol for 5 min, anhydrous ethanol II for 5 min, and anhydrous ethanol I for 5 min; paraffin-insertion dewaxing and clearing agent II for 10 min, and paraffin-insertion dewaxing and clearing agent I for 10 min; mounted with neutral resin; and the histopathological changes were observed and photographed under a microscope.

[0096] 3. Enhanced ATP kit for measuring ATP levels

[0097] Sample preparation: For tissues, add 100 μl of lysis buffer to every 20 mg of tissue, then homogenize using a glass homogenizer. Thorough homogenization ensures complete tissue lysis. Collect the supernatant for subsequent assays. For cells, aspirate the culture medium and add 200 μl of lysis buffer to each well of a 6-well plate. After lysis, centrifuge at 12000g for 5 min at 4°C, and collect the supernatant for subsequent assays.

[0098] Plot a standard curve based on the ATP standard solution: Melt the reagents to be used on an ice bath, dilute the ATP standard solution with ATP detection lysis buffer to an appropriate concentration gradient, and perform initial detection in subsequent experiments with concentrations of 0.01, 0.03, 0.1, 0.3, 1, 3 and 10 μM. Adjust the concentration range of the standard appropriately according to the concentration of ATP in the sample to establish a standard curve.

[0099] Preparation of ATP detection working solution: 100 μl of ATP detection working solution is required for each sample or standard. Take an appropriate amount of ATP detection reagent and dilute it with ATP detection reagent diluent at a ratio of 1:4.

[0100] ATP concentration determination: a. Add 100 μl of ATP detection working solution to the detection well. Incubate at room temperature for 5 min to allow all background ATP to be consumed; b. Add 20 μl of sample or standard to the detection well, mix quickly with a pipette, and after a 2-second interval, measure the RLU value using a chemiluminescence analyzer (Victor X2, PerkinElmer, USA). Calculate the ATP concentration in the sample based on the standard curve.

[0101] 4. Immunofluorescence of frozen tissue sections

[0102] Label the slides in advance and place the sample holder into a cryostat; cut the tissue into 0.5cm×0.5cm pieces, clean them in PBS, blot dry with paper, and fix with paraformaldehyde for 20 minutes; drop OCT embedding medium into the embedding cassette, place the tissue vertically into the cassette, adjust the tissue orientation, add more OCT embedding medium until completely solidified, and store at -80℃.

[0103] Two hours prior to sample preparation, immerse the sample at -20°C from -80°C to equilibrate its temperature. Glass slides should be kept at room temperature; prolonged exposure to -20°C will prevent tissue adhesion. Sectioning (Leica CM1950 cryostat, Wetzlar, Germany): Section thickness is 6 μm. Place sections directly in room temperature PBS; the OCT embedding agent will automatically dissolve in the PBS. Wash three times with PBS, 5 min each time, wiping away moisture from the edges and back. Draw circles around the tissue using a histochemical pen. Permeabilization: Prepare 0.2% Triton solution and incubate at room temperature for 20 min. Wash three times with PBS, 5 min each time. Blocking: Prepare 5% BSA solution and incubate at room temperature for 1 hour. Follow the instructions to use 1% BSA... The primary antibody was prepared and incubated overnight at 4°C. The specimen was washed three times with PBS for 5 minutes each time. The secondary antibody was prepared using 1% BSA solution according to the manufacturer's instructions and incubated at room temperature for 1 hour. The specimen was then washed three times with PBS for 5 minutes each time. The DAPI dye was prepared using 1% BSA solution according to the manufacturer's instructions and incubated at room temperature for 30 minutes. The specimen was then washed three times with PBS for 5 minutes each time, and the PBS outside the specimen was wiped off with filter paper. The specimen was mounted with anti-fluorescence attenuation mounting medium, placed in a light-proof box, and allowed to dry before imaging with a confocal microscope (Olympus FV1000 IX81, 40×).

[0104] 5. HaCaT cell culture and passage

[0105] Remove cells from the incubator and observe them under a microscope. If the cell density reaches 80-90%, they can be passaged. Discard the supernatant and gently wash the cells twice with PBS. Add an appropriate volume of trypsin to the culture flask or dish and incubate at 37°C for 5 minutes. Observe the digestion under a microscope. If most of the cells have detached or become rounded, quickly return the cells to the worktable and add an equal volume of culture medium containing 10% fetal bovine serum to stop the digestion reaction. Transfer the cell suspension to a 15ml centrifuge tube and centrifuge at 1000rpm for 5 minutes. Discard the supernatant and add 1-2ml of complete culture medium. Gently pipette the cells until resuspended. Re-inoculate the cell suspension into culture flasks or dishes and passage at a 1:3 ratio. Add an appropriate amount of complete culture medium, shake in a crosswise direction, and incubate at 37°C with 5% CO2.

[0106] 6. Establishing a HaCaT cell photodamage model by irradiating cells.

[0107] Cell counting: When cell confluence reaches 80-90%, cells can be plated for subsequent experiments. After cell digestion, resuspend the cells in 1 ml of complete culture medium and count 10 μl using a cell counter. Cell plateding: Select culture dishes or plates of different sizes according to the needs of subsequent experiments. Seed cells according to the required confluence to ensure that the cell density is basically consistent between different groups. Place the seeded culture dishes or plates in an incubator for further culture. Cell illumination: Observe cell adhesion and confluence under a microscope 24 hours after plateding. When the required confluence is reached for different experiments, discard the supernatant, wash the cells twice with PBS buffer, and add PBS buffer pre-cooled to 4°C. The volume of PBS buffer should be adjusted according to the size of the culture substrate, 100 μl per square centimeter. Place the cells under a UV lamp with a distance of 15 cm between the lamp and the cells for UVB (10-50 mJ / cm²) illumination. 2 After irradiation, discard the PBS and add serum-free culture medium to stop cell growth. Place the cells in a 37°C, 5% CO2 incubator until the desired time point for different experiments.

[0108] 7. CCK8 assay for cell viability

[0109] Cell counting; Cell plating: Digest cells, collect cells by centrifugation, resuspend in complete culture medium, and seed in 24-well plates (2–8) × 10⁶ cells / well. 4 / well, set 3 sub-wells per group, shake well in a cross shape, and incubate overnight in an incubator; Cell illumination: when the cell confluence reaches 80-90%, use the same illumination method as above, setting the UVB dose to 10, 20, 30, 40, and 50 mJ / cm² respectively. 2 After irradiation, the cells were returned to the incubator (37℃, 5% CO2). CCK8 cell viability was assessed: after 24 hours of incubation, cell confluence and morphology were observed under a microscope, and photographs were taken under an optical microscope. The culture medium was removed, and the cells were washed twice with PBS buffer. 500 μl of culture medium containing CCK8 (450 μl culture medium + 50 μl CCK8 reagent) was added, and the cells were incubated in a CO2 incubator for 1 hour. The CCK8-containing culture medium was transferred to a 96-well plate, and the absorbance (OD) at 450 nm was measured. Statistical analysis: the blank control group was assumed to have a cell viability of 100%, and the cell viability of the remaining groups was calculated based on the absorbance.

[0110] 8. DCFH-DA assay for intracellular reactive oxygen species (ROS) levels

[0111] Cell counting; Cell plating: Digest, centrifuge, resuspend cells, and seed in 6-well plates at (8–32) × 10⁻⁶.4 / well, shake well in a cross shape, and incubate overnight; Cell illumination: When cell confluence reaches 60-70%, use the same illumination method as above, at 30mJ / cm². 2 Irradiation: After irradiation, cells were returned to the incubator. DCFH-DA staining: After culturing in the incubator for 1 hour, cell confluence and morphology were observed under a microscope. The culture medium was removed, and the cells were washed with PBS buffer. The accumulation of intracellular ROS was measured using the 2,7-dichlorofluorescein diacetate (DCFH-DA) staining method. The cells were placed in 1 μM DCFH-DA, incubated at 37°C in the dark for 20 minutes, washed three times with PBS buffer, and then added with room temperature complete culture medium. Imaging: The Cytation 5 live-cell imaging analysis system (BioTek, USA) was used for observation and photography, and Gen 5 (BioTek, USA) was used for image analysis.

[0112] 9. YO-PRO-1 / PI fluorescent cell double staining assay for detecting apoptosis and necrosis

[0113] Cell counting; Cell plating: Digest, centrifuge, resuspend cells, and seed in 12-well plates at (4–16) × 10⁶ cells / wells. 4 / well, shake well in a cross shape, and incubate overnight; Cell illumination: When cell confluence reaches 60-70%, use the same illumination method as above, at 30mJ / cm². 2 Irradiation: After irradiation, cells were returned to the incubator. YO-PRO-1 / PI staining: After culturing in the incubator for 6 hours, cell confluence and morphology were observed under a microscope. The culture medium was removed, and the cells were washed with PBS buffer. YO-PRO-1 / PI working solution was prepared according to the instructions. Each 1 ml of detection working solution contained 1 μl of YO-PRO-1 (1000×), 1 μl of PI (1000×), and 998 μl of detection buffer. After incubation at 37°C in the dark for 20 min, the cells were washed three times with PBS buffer and then added with complete culture medium at room temperature. Imaging: Cells were observed and photographed using the Cytation 5 live cell imaging analysis system.

[0114] 10. Cellular immunofluorescence

[0115] Cell counting; Cell plating: Place 24-well cell slides into 6cm culture dishes, add digested and centrifuged resuspended cells, shake well in a cross-shaped manner, and incubate overnight; Cell illumination: When cell confluence reaches 60%, use the same illumination method as above, at 30mJ / cm². 2Irradiate the cells, then return them to the incubator. Fixation: After 6 hours, remove the culture dish, take the cell slides out of the dish with the cell side facing up, place them in a 24-well plate, wash once with PBS buffer, fix with paraformaldehyde for 15 minutes (dry for 10 minutes at room temperature), wash three times with PBS for 3 minutes each time. Permeabilization: 0.5% Triton for 15 minutes; block with 5% BSA for 2 hours; prepare primary antibody with 1% BSA according to the instructions, incubate overnight at 4°C; wash three times with PBS buffer for 3 minutes each time; prepare secondary antibody with 1% BSA according to the instructions, incubate at room temperature in the dark for 2 hours; wash three times with PBS for 3 minutes each time; prepare DAPI dye according to the instructions, incubate at room temperature for 30 minutes; wash three times with PBS for 3 minutes each time; prepare a slide, drop anti-fluorescence attenuation mounting medium onto the slide, carefully remove the slide, place it upside down on the slide with the cell side facing down, let it dry, apply nail polish around the slide to seal it, then place it in a black light-proof box, and image and photograph it using a confocal microscope.

[0116] 11. Mito-Tracker Red CMXRos cell fluorescence staining to detect the morphology and distribution of mitochondria in cells.

[0117] Cell counting; Cell plating: Digest, centrifuge, resuspend cells, and seed cells in 12-well plates at (4–16) × 10⁶ cells / wells. 4 / well, shake well in a cross shape, and incubate overnight; Cell illumination: When cell confluence reaches 60-70%, use the same illumination method as above, at 30mJ / cm². 2 Irradiation: After irradiation, cells were returned to the incubator. Mito-Tracker Red CMXRos staining: After culturing for 12 hours, cell confluence and morphology were observed under a microscope. The culture medium was removed, and the cells were washed with PBS buffer. Mito-Tracker Red CMXRos working solution was prepared according to the instructions. An appropriate amount of 200 μM Mito-Tracker Red CMXRos stock solution was added to the cell culture medium at a ratio of 1:10000 to make the final concentration 20 nM. The cells were incubated at 37°C in the dark for 30 min, and then washed three times with PBS. DAPI dye was prepared according to the instructions, and staining was performed at room temperature for 30 min. The cells were washed three times with PBS for 5 min each time, and then complete culture medium at room temperature was added. Imaging: The cells were observed and photographed using the Cytation 5 live cell imaging analysis system.

[0118] 12. Detection of ROS levels in mitochondria using the MitoSOX Red Mitochondrial Superoxide Indicator.

[0119] Cell counting; Cell plating: Digested, centrifuged, and resuspended cells were seeded into 12-well plates at (4–16) × 10⁶ cells / well. 4 / well, shake well in a cross shape, and incubate overnight; Cell illumination: When cell confluence reaches 60-70%, use the same illumination method as above, at 30mJ / cm². 2 Irradiation: After irradiation, cells were returned to the incubator. MitoSOX Red mitochondrial superoxide indicator staining: After culturing in the incubator for 3 hours, cell confluence and morphology were observed under a microscope. The culture medium was removed, and the cells were washed with PBS. MitoSOX Red working solution was prepared according to the instructions. MitoSOX Red 5mM stock solution was diluted 1000 times with HBSS solution to a final concentration of 5μM. The cells were incubated with MitoSOX Red mitochondrial superoxide indicator at a final concentration of 5μM at 37°C in the dark for 10 minutes, followed by washing three times with PBS. DAPI dye was prepared according to the instructions and stained at room temperature for 30 minutes. The cells were washed three times with PBS for 5 minutes each time, and then complete culture medium at room temperature was added. Imaging: Observation and photography were performed using the Cytation 5 live cell imaging analysis system.

[0120] 13. Mitochondrial membrane potential detection kit (JC-1) for detecting mitochondrial membrane potential.

[0121] Cell counting; Cell plating: Digested, centrifuged, and resuspended cells were seeded into 12-well plates at (4–16) × 10⁶ cells / well. 4 / well, shake well in a cross shape, and incubate overnight; Cell illumination: When cell confluence reaches 60-70%, use the same illumination method as above, at 30mJ / cm². 2Irradiation: After irradiation, cells were returned to the incubator. JC-1 staining: After culturing in the incubator for 6 hours, cell confluence and morphology were observed under a microscope. The culture medium was removed, and the cells were washed with PBS buffer. JC-1 working solution was prepared according to the instructions. JC-1 was diluted by adding 8 ml of ultrapure water to every 50 μl of JC-1 stock solution (200×). Then, 2 ml of JC-1 staining buffer (5×) was added and mixed well to obtain the JC-1 staining working solution. The solution was incubated at 37°C in the dark for 20 min. During incubation, an appropriate amount of JC-1 staining buffer (1×) was prepared by adding 4 ml of distilled water to every 1 ml of JC-1 staining buffer (5×) and placed in an ice bath. After incubation at 37°C, the supernatant was aspirated, and the cells were washed twice with JC-1 staining buffer (1×). Room temperature complete culture medium was added. Imaging: Cells were observed and photographed using the Cytation 5 live cell imaging analysis system. When the mitochondrial membrane potential (MMP) is high, JC-1 accumulates in the mitochondrial matrix, forming J-aggregates, which produce red fluorescence. When the mitochondrial membrane potential is low, JC-1 cannot accumulate in the mitochondrial matrix; JC-1 exists as a monomer and produces green fluorescence.

[0122] 14. Enrichment of differentially expressed mRNAs using the public database GEO.

[0123] mRNA data were loaded from the public database GEO (https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE138800) and analyzed before and after UVB irradiation (including a blank control group and a UVB concentration of 20 mJ / cm). 2 UVB is 40 mJ / cm 2 The differences in HaCaT cell mRNA sequences (mRNA-seq) between groups were analyzed. The Amigo 2 database (http: / / amigo.geneontology.org / amigo / landing) was used to search for genes related to mitochondrial biogenesis, mitochondrial fission, mitochondrial fusion, and mitophagy. The intersection of the differentially expressed mRNA sequences from the GEO database and the mitochondrial-related genes in the Amigo 2 database was calculated, and statistical analysis was performed using Graphpad Prism 8.0. The selected genes were then enriched using the KEGG function in the R language using the "ggplot2" package.

[0124] The following are the test results.

[0125] 1. Gross photographs and dermoscopy reveal UVB-induced photodamage in mice.

[0126] At 200mJ / cm 2C57BL / 6 mice were irradiated with UVB. The skin on the back of each group of mice was photographed, examined by dermoscopy, and stained with hematoxylin / eosin at 24h and 72h after irradiation.

[0127] Depend on Figure 1 It can be seen that, compared with the blank control group, there were no obvious changes in the skin on the back after 24 hours of irradiation, but obvious erythema, scaling, and even erosion, ulceration, and crusting appeared after 72 hours of irradiation. Figure 1 A, Gross image of the skin on the back of the mouse. In the dermoscopy results under unpolarized light, UVB-induced skin damage showed slight thickening at 24 hours, and obvious erythema, scaling, and crusting at 72 hours. In the results under polarized light, the skin showed obvious telangiectasia at 24 hours, which further worsened at 72 hours, resulting in obvious erythema, scaling, and crusting. Figure 1 B, dermoscopic observations under unpolarized and polarized light.

[0128] Figure 2 The results confirmed the successful establishment of the UVB-induced photodamage model on the back of C57BL / 6 mice. Skin samples from the back of the mice were collected 24 h and 72 h after UVB irradiation and stained with hematoxylin and eosin (HE). Figure 2 A, HE staining results showed that, compared with the blank control group, the epidermal thickness of mouse skin increased significantly after 24 hours of irradiation, and the epidermal thickening was even more significant after 72 hours of irradiation. Figure 2 A and Figure 2 B, the results of epidermal thickening after UVB treatment, along with scaling and crusting, indicate that skin photodamage is time- and dose-dependent on UVB irradiation. Furthermore, a large number of inflammatory cells infiltrated the dermis at 72 hours. Based on the above gross photographs, dermoscopy, and HE staining results, it can be confirmed that a UVB-induced photodamage model of the dorsal skin of C57BL / 6 mice has been successfully established.

[0129] 2. Effect of different doses of UVB on HaCaT cell survival as determined by CCK8 assay

[0130] To clarify whether the damage to HaCaT cells caused by different doses of UVB is dose-dependent, in this embodiment, HaCaT cells in the logarithmic growth phase were seeded in 24-well plates. After the cell density reached 80-90%, the HaCaT cells were exposed to different doses of UVB (10, 20, 30, 40, 50 mJ / cm²). 2 Cells were treated with light, and cell viability was assessed using the CCK8 assay 24 hours later. The results are as follows: Figure 3 As shown.

[0131] Figure 3 A shows the survival results of HaCaT cells after UVB irradiation under a light microscope. Figure 3In A, 'c' represents the unlit group, and 10, 20, 30, 40, and 50 represent 10, 20, 30, 40, and 50 mJ / cm², respectively. 2 Illumination treatment. Figure 3 B is a statistical graph showing the survival rate of HaCaT cells after UVB irradiation. The horizontal axis represents different doses of UVB, and the vertical axis represents cell survival rate. Results are expressed as mean ± standard deviation, N = 3. P < 0.05 indicates statistical significance. Scale bar: 100 μm. Figure 3 In B, when the UVB dose is 10 and 20 mJ / cm 2 At the specified times, cell viability did not change significantly; when the UVB dose was 30, 40, and 50 mJ / cm², cell viability did not change significantly. 2 At these times, the survival rates decreased to 60%, 22%, and 16%, respectively. The decrease in HaCaT cells after UVB irradiation was dose-dependent, and the decrease was further observed when the UVB dose reached 40 and 50 mJ / cm². 2 At that time, almost no surviving cells were observed under the microscope. Based on the results of this embodiment and literature reports, a 30 mJ / cm² solution was selected. 2 Further experiments will be conducted.

[0132] 3. DCFH-DA assay for intracellular ROS levels

[0133] To clarify the effect of UVB irradiation on intracellular ROS levels, DCFH-DA staining was performed on HaCaT cells 1 hour after UVB irradiation. Green fluorescence reflects intracellular ROS levels, such as... Figure 4 As shown. Figure 4 A represents the intracellular ROS level of HaCaT cells after UVB irradiation under a fluorescence microscope; Figure 4 B is a statistical graph of intracellular ROS levels in HaCaT cells after UVB irradiation. The results show that the green fluorescence intensity increased significantly, indicating that UVB irradiation of HaCaT cells increased the intracellular ROS level. Results are expressed as mean ± standard deviation, N = 3. P < 0.05 indicates statistical significance. Scale bar 200 μm.

[0134] 4. YO-PRO-1 / PI fluorescent cell double staining assay for detecting apoptosis and necrosis

[0135] To clarify the levels of apoptosis and necrosis after UVB irradiation, YP-PRO-1 / PI staining was performed on HaCaT cells 12 hours after UVB irradiation. The results are as follows: Figure 5 As shown. Green fluorescence represents YP-PRO-1 / PI positive cells, indicating apoptosis; red fluorescence represents PI positive cells, indicating necrosis. Figure 5 A represents the level of apoptosis and necrosis in HaCaT cells after UVB irradiation under a fluorescence microscope; Figure 5B is a statistical graph showing the levels of apoptosis and necrosis in HaCaT cells after UVB irradiation. Results are expressed as mean ± standard deviation, N = 3. P < 0.05 indicates statistical significance. Scale bar 200 μm. After UVB irradiation, both green and red fluorescence intensities were significantly increased compared to the control group. Figure 5 A) After UVB irradiation, the fluorescence intensity of YP-PRO-1 and PI was significantly increased compared with the control group. Figure 5 B) indicates that apoptosis and necrosis occurred in HaCaT cells after UVB irradiation.

[0136] 5. γH2Ax assay for UVB-induced nuclear damage

[0137] To clarify the degree of nuclear damage after UVB irradiation, proteins were extracted from HaCaT cells at different time points (1, 3, 6, 12, and 24 h) after UVB irradiation, and the expression level of γH2Ax was detected. The results are as follows: Figure 6 As shown (detection results of nuclear damage in HaCaT cells irradiated by UVB). Figure 6 A represents the expression level of γH2Ax detected by Western blot. Figure 6 B is a statistical graph of γH2Ax expression levels; Figure 6 C represents the fluorescence intensity of γH2Ax in HaCaT cells after UVB irradiation under a fluorescence microscope. Figure 6 D is a statistical graph of the fluorescence intensity of γH2Ax in HaCaT cells after UVB irradiation. Results are expressed as mean ± standard deviation, N = 3. P < 0.05 is considered statistically significant. Scale bar 20 μm. After UVB irradiation, the expression level of γH2Ax was upregulated, reaching a peak at 6 h. Figure 6 A and Figure 6 B) suggests that nuclear damage occurred in HaCaT cells after UVB irradiation.

[0138] Furthermore, immunofluorescence staining of γH2Ax was performed 6 hours after UVB irradiation. Green fluorescence represented the expression level of γH2Ax, and the intensity of green fluorescence was significantly increased compared with the blank control group. Figure 6 C and Figure 6 D), and all of them were expressed in the cell nucleus, suggesting that UVB irradiation of HaCaT cells caused damage to the cell nucleus.

[0139] The above results regarding cell viability, intracellular ROS levels, apoptosis and necrosis levels, and nuclear damage levels demonstrate that at a UVB concentration of 30 mJ / cm², the cell viability is optimal. 2 A photodamage model of HaCaT cells was successfully established under the given conditions.

[0140] 6. UVB induces a reduction in mitochondria in mouse skin and HaCaT cells.

[0141] To determine the level of mitochondrial damage in mouse skin after UVB irradiation, skin tissue was harvested 72 hours after UVB irradiation for OCT embedding and frozen sectioning. Figure 7 and Figure 8 As shown, this embodiment uses tissue immunofluorescence staining to detect the expression level of mitochondrial protein COX4, wherein, Figure 7 The green fluorescence represents the fluorescence intensity of COX4, and the blue fluorescence represents DAPI.

[0142] Figure 7 The results show the COX4 levels in mouse backs and HaCaT cells under confocal microscopy after UVB irradiation. Figure 7 A represents the COX4 level on the back skin of mice irradiated with UVB. Figure 7 B represents the COX4 level in HaCaT cells irradiated by UVB. Figure 8 Statistical results of ATP level measurements in the back skin and HaCaT cells of mice irradiated with UVB using a fluorescence microplate reader. Figure 8 A shows the ATP measurement results of the back skin of mice irradiated with UVB. Figure 8 B represents the ATP measurement results of HaCaT cells irradiated with UVB. Figure 8 A and Figure 8 The x-axis of B represents the group, and the y-axis represents the ATP content (nmol / L). Results are expressed as mean ± standard deviation. For mice, N=5; for cells, N=3. P<0.05 indicates statistical significance. Scale bar: 20 μm.

[0143] Figure 7 and Figure 8 The results showed that, compared with the unexposed group, the expression of COX4 in the dorsal skin and HaCaT cells of mice was significantly downregulated after UVB irradiation, and the ATP level in the dorsal skin and HaCaT cells of mice decreased, indicating a reduction in mitochondria. UVB irradiation of the dorsal skin and HaCaT cells of mice caused mitochondrial damage.

[0144] 7. UVB induced a decrease in ATP levels in mouse skin and HaCaT cells.

[0145] To investigate UVB-induced mitochondrial damage in the skin, this study examined changes in ATP levels in mouse skin and HaCaT cells after UVB irradiation. The results are as follows: Figure 8 As shown (ATP level measurement of mouse back skin and HaCaT cells under UVB irradiation). Figure 8 A shows the ATP level in the back skin of mice irradiated with UVB, as detected by a fluorescence microplate reader. Figure 8 B represents the ATP level in HaCaT cells irradiated with UVB, measured using a fluorescence microplate reader. Results are expressed as mean ± standard deviation. For mice, N=5; for cells, N=3. P<0.05 was considered statistically significant.

[0146] UVB irradiation of mouse skin ( Figure 8 A) and HaCaT cells ( Figure 8 B) The decrease in ATP levels suggests that UVB irradiation of the skin causes damage to mitochondrial function, affecting its energy metabolism.

[0147] 8. UVB causes abnormal mitochondrial distribution in HaCaT cells.

[0148] To clarify the changes in mitochondrial distribution in HaCaT cells after UVB irradiation, mitochondria were stained with Mitotracker Red CMXROS 12 hours after UVB irradiation in this embodiment. Figure 9 In the diagram showing changes in mitochondrial distribution within cells after UVB irradiation, red represents mitochondria, and the intensity of red fluorescence represents changes in mitochondrial membrane potential. Figure 9 The results showed that the intensity of red fluorescence was inversely proportional to the mitochondrial membrane potential. Figure 9 A shows the distribution of mitochondria along the long axis of the cell nucleus at two poles in HaCaT cells after UVB irradiation under a fluorescence microscope. Blue represents DAPI and red represents mitochondria. Figure 9 B is a statistical graph of red fluorescence in HaCaT cells after UVB irradiation. Figure 9 C is a statistical graph showing the length of mitochondria distributed along the cell nucleus after UVB irradiation of HaCaT cells. Results are expressed as mean ± standard deviation, N = 3, P < 0.05 indicates statistical significance, and the scale bar is 200 μm.

[0149] In the blank control group, mitochondria were evenly distributed around the cell nucleus, while after UVB irradiation, mitochondria were distributed at both poles along the long axis of the cell nucleus. Figure 9 A and Figure 9 C), and after UVB irradiation, the intensity of red fluorescence was enhanced compared to the control group. Figure 9 B) indicates that the mitochondrial membrane potential decreases after UVB irradiation.

[0150] 9. UVB leads to an increase in the level of mtROS in HaCaT cells.

[0151] To determine the level of mtROS in HaCaT cells after UVB irradiation, this embodiment used MitoSOX Red to stain mtROS 3 hours after UVB irradiation. Red fluorescence represents mtROS. Figure 10 As shown. Figure 10 A represents the fluorescence intensity of mtROS in HaCaT cells after UVB irradiation under a fluorescence microscope. Blue represents DAPI, and red represents mtROS. Figure 10B is a statistical graph of mtROS levels in HaCaT cells after UVB irradiation. Results are expressed as mean ± standard deviation, N = 3, P < 0.05 indicates statistical significance, and the scale bar is 200 μm. The results show that the intensity of red fluorescence was significantly enhanced after UVB irradiation, indicating a significant increase in mtROS after UVB irradiation.

[0152] 10. UVB causes a decrease in mitochondrial membrane potential in HaCaT cells.

[0153] To clarify the changes in mitochondrial membrane potential in HaCaT cells after UVB irradiation, this example used JC-1 staining 6 hours after UVB irradiation. Figure 11 The results are shown in the figure (the changes in mitochondrial membrane potential after UVB irradiation of HaCaT). Figure 11 A shows the changes in mitochondrial membrane potential detected by JC-1 after UVB irradiation of HaCaT cells under a fluorescence microscope. Red represents polymers and green represents monomers. Figure 11 B is a statistical graph showing the changes in mitochondrial membrane potential detected by JC-1 after UVB irradiation of HaCaT cells. Results are expressed as mean ± standard deviation, N = 3, P < 0.05 is considered statistically significant, scale bar 200 μm.

[0154] The results showed that the intensity of red fluorescence decreased and the intensity of green fluorescence increased after UVB irradiation. Figure 11 A), the ratio of JC-1 monomer / polymer increases ( Figure 11 B) suggests that mitochondrial membrane potential depolarization occurs after UVB irradiation.

[0155] 11. Differentially enriched mRNAs from the public database GEO

[0156] Significant mitochondrial damage was induced in a photodamage model based on UVB irradiation of mouse back skin and HaCaT cells. This embodiment further explores the role of mitochondrial-related biological mechanisms in UVB-induced skin photodamage.

[0157] The Amigo 2 database contains 640 genes related to mitochondrial biogenesis, 52 genes related to mitochondrial division, 38 genes related to mitochondrial fusion, and 37 genes related to mitophagy. To clarify changes in gene expression, differential mRNA (mRNA-seq) in HaCaT cells before and after UVB irradiation was analyzed using the GSE138800 dataset from the public database GEO, including the control group and the UVB 20mJ / cm² irradiation group. 2 Group and UVB 40mJ / cm 2 The obtained data intersects with mitochondrial-related genes in the Amigo 2 database.

[0158] At 20mJ / cm2 Under UVB irradiation, a total of 213 genes related to mitochondrial biogenesis, 17 genes related to mitochondrial fission, 11 genes related to mitochondrial fusion, and 13 genes related to mitophagy were identified. KEGG enriched genes related to biological processes associated with mitophagy, such as... Figure 12 As shown, UVB irradiation before and after GEO (GSE138800) (control group, UVB 20mJ / cm) 2 (Differential expression of HaCaT cell mRNA was cross-analyzed with mitochondrial-related genes in the Amigo 2 database).

[0159] At 40mJ / cm 2 Under UVB irradiation, 420 genes related to mitochondrial biogenesis, 29 genes related to mitochondrial fission, 18 genes related to mitochondrial fusion, and 25 genes related to mitophagy were identified. KEGG enriched genes related to biological processes associated with mitophagy, such as... Figure 13 The image shows UVB irradiation before and after (control group, UVB 40 mJ / cm) in GEO (GSE138800). 2 (Differential expression of HaCaT cell mRNA was cross-analyzed with mitochondrial-related genes in the Amigo 2 database).

[0160] All differentially expressed genes were enriched in the KEGG pathway. Figure 12 and Figure 13 This indicates a significant correlation with mitophagy. These results suggest that mitochondrial damage, particularly mitophagy, plays an important and crucial role in UVB-induced photodamage in HaCaT cells.

[0161] Example 2

[0162] This embodiment provides information on UVB-induced mitochondrial apoptosis and inhibition of FUNDC1-mediated mitophagy; repeated information will not be elaborated upon. The results of Example 1 confirmed mitochondrial damage and apoptosis in a UVB-induced photodamage model of mouse skin and HaCaT cells. Therefore, this embodiment explores the important role of mitochondrial apoptosis in this cell apoptosis process and hypothesizes that mitophagy regulates mitochondrial apoptosis.

[0163] The following is the test method provided in this embodiment.

[0164] 1. Protein extraction and protein concentration detection

[0165] (1) For cells: Discard the culture medium, wash 3 times with pre-cooled PBS buffer, and remove the remaining PBS buffer with a pipette tip; add an appropriate volume of premixed RIPA lysis buffer (RIPA:PMSF:cocktail = 100:1:1), lyse on ice for 10 min, scrape the cells off with a scraper and transfer them to a 1.5 ml EP tube; place the EP tube in a pre-cooled high-speed centrifuge at 4℃, centrifuge at 15000g for 15 min, and store the supernatant at -80℃.

[0166] For the tissue: Separate the subcutaneous tissue from the collected skin tissue, retaining only the epidermis and dermis. Wash thoroughly with pre-chilled PBS buffer. Cut a 50mg tissue block and place it in a 1.5ml EP tube. Add 250μl of premixed RIPA lysis buffer (RIPA:PMSF:cocktail = 100:1:1), add grinding beads, and place in a pre-chilled tissue homogenizer. Homogenize thoroughly until a tissue homogenate is formed. Remove the EP tube and centrifuge at 15000g for 15min in a pre-chilled 4℃ high-speed centrifuge. Store the supernatant at -80℃.

[0167] (2) Protein concentration was measured by BCA method. Preparation of working solution: Based on the quantity of standards and samples, prepare BCA working solution by adding 1 volume of Cu reagent to 50 volumes of BCA reagent (50:1), and mix thoroughly until no flocculent precipitate forms. Serially dilute BSA with RIPA standard according to the instructions. Take 25 mg / ml protein standard and dilute to a concentration of 0.5 mg / ml. Store at -40℃ for long-term storage. Add 0, 1, 2, 4, 8, 12, 16, and 20 μl of the standard to a 96-well plate, and add RIPA to bring the total to 20 μl, corresponding to concentrations of 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / ml. Dilute the sample 10-fold and add it to a 96-well plate. Add 200 μl of BCA working solution to each well and incubate at 37℃ for 30 min. Measure protein concentration using a microplate reader: Measure the absorbance at a wavelength of 562 nm and determine the protein concentration according to the standard curve.

[0168] 2. Western blot method

[0169] (1) Cleaning the glass plate: Use a small amount of dish soap to clean both sides of the glass plate, then rinse thoroughly with tap water, and finally rinse clean with distilled water. Stand it vertically in a basket to dry. After cleaning the comb, wipe it with anhydrous ethanol and let it dry.

[0170] (2) Gel pouring: Clamp the aligned glass plates into the fixture and place them vertically on the shelf; before pouring the gel, pour water between the glass plates and check for leaks, select a separating gel that is appropriate for the size of the protein molecules, pour the gel quickly, and control the gelation speed according to the concentration of APS and TEMED; after pouring the separating gel, add another layer of anhydrous ethanol on top; after the gel solidifies, remove the top layer of anhydrous ethanol, and then use absorbent paper to dry the anhydrous ethanol on the glass plates; prepare the stacking gel according to the instructions, pour the gel quickly, and then insert the comb; after the gel solidifies, soak it in water and store it in a refrigerator at 4°C for later use.

[0171] (3) Electrophoresis: Install the gel onto the electrophoresis tank and check the fit between the gel plate and the electrode holder; fill the inner cell with electrophoresis buffer. If the liquid level does not change within 5 minutes, it indicates that the gel plate and electrode holder are tightly fitted and there is no leakage, and the experiment can be carried out. Add electrophoresis buffer to the outer cell, submerging the lower edge of the gel plate by 2-3 cm; use a pipette to pick up the sample against the wall and slowly add the sample and protein pre-stained label; after turning on the power, start electrophoresis as soon as possible. Set the first stage to 80V until a straight line is formed; set the second stage to 120V until electrophoresis is completed. The presence of bubbles after turning on the power indicates successful connection.

[0172] (4) Transfer and blocking: After electrophoresis, remove the gel plate and prepare the materials required for electrotransfer, including 6 sheets of filter paper, a pre-cooled electrotransfer tank and electrotransfer buffer. Wear gloves when cutting the filter paper and PVDF membrane. Soak the PVDF membrane in pure methanol. Place the gel plate in the electrotransfer tank, scrape off the stacking gel, cut it according to molecular weight and transfer it directly to the filter paper. Make a sandwich structure, insert the jacket into the electrotransfer tank, add 4°C pre-cooled transfer buffer, maintain the current at 200mA, and determine the transfer time according to the molecular weight. After electrotransfer, disconnect the power supply and block the PVDF membrane by soaking it in 5% milk.

[0173] (5) Enzyme immunoassay localization and development: Primary antibody incubation: Dilute the primary antibody according to the instructions and incubate overnight on a horizontal shaker at 4°C; wash the membrane three times with TBST on a horizontal shaker at room temperature for 5 min each time; Secondary antibody incubation: Dilute the secondary antibody according to the instructions and incubate on a horizontal shaker at room temperature for 1 h; wash the membrane three times with TBST on a horizontal shaker at room temperature for 10 min each time; Development: Prepare the required volume of chemiluminescence solution and perform chemiluminescence imaging under a developing instrument. Images were captured using a Tanon 5200Multi, and the bands were quantified using ImageJ open-source software to normalize the protein expression level to GAPDH.

[0174] 3. Immunohistochemical staining of paraffin sections

[0175] (1) Baking: Place the paraffin sections on an iron slide holder and bake in a 60℃ oven for 4 hours. After baking, remove and place at room temperature. (2) Dewaxing: Treat with wax-impregnated dewaxing clearing agent I for 10 minutes, ring-impregnated dewaxing clearing agent I for 10 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, 95% ethanol for 5 minutes, 85% ethanol for 5 minutes, and 75% ethanol for 5 minutes. (3) Wash with PBST 3 times, 5 minutes each time. (4) Microwave antigen retrieval: Pour the prepared antigen retrieval solution into a high-temperature resistant plastic slide box and place it in a microwave oven. (3) Microwave on high until boiling, insert the slide into the slide box, microwave on medium-low for 20 minutes (stop immediately if the liquid boils), remove the slide box and cool to room temperature; (4) Wash with PBST 3 times, 5 minutes each time, wipe the edges and back of the slide clean, and draw circles around the tissue with an immunohistochemistry pen; (5) Block endogenous peroxidase: put a small amount of water in a light-proof humidified box, place the slide in the humidified box, add the "endogenous peroxidase blocker (reagent 1)" from the immunohistochemistry kit, and incubate at room temperature in the dark for 10 minutes; (6) Wash with PBST 3 times, 5 minutes each time; (7) Seal (9) Wipe the edges and back of the tissue clean, add the "serum blocking solution (reagent 2)" from the immunohistochemistry kit, and incubate at room temperature for 20 min; (10) Prepare the primary antibody with 1% BSA solution according to the instructions, wipe the edges and back of the tissue clean, add the primary antibody according to the tissue size, cover and incubate in the humidified chamber overnight at 4°C; (11) Warm up: Take the humidified chamber out of the refrigerator, open it to check if the primary antibody has dried, cover it and place it in a 37°C water bath for 40 min; (12) Wash with PBST 3 times, 5 min each time; (13) Add the secondary antibody and incubate at room temperature for 25 min; (14) PB (14) Add enzyme-labeled streptomycin (reagent 4) and incubate at room temperature for 10 minutes. At the same time, prepare DAB solution (solution A:solution B:solution C = 20:1:1) according to the required amount in the dark. (15) Wash with PBST 3 times, 5 minutes each time. (16) DAB staining: Under the microscope, add an appropriate volume of DAB, observe and time under the microscope. When brown appears, immediately put it into the staining jar and rinse it gently. Place it on the slide rack in the same direction. Stain other slides with the same index according to the same DAB staining time. After all slides have been stained, rinse the back with tap water for 7 minutes. (17) Hematoxylin counterstaining: Take out the slide and wipe it dry. Add hematoxylin for counterstaining for 30 seconds (adjust the time according to the depth of hematoxylin staining). Immediately put it into the staining vat and rinse it lightly. Place the slides on the slide rack in the same direction. After all the slides have been stained, rinse the back with tap water until the specimen color turns blue. (18) Dehydration and clearing: Treat with 75% ethanol for 5 minutes, 85% ethanol for 5 minutes, 95% ethanol for 5 minutes, anhydrous ethanol II for 5 minutes, anhydrous ethanol I for 5 minutes, wax dewaxing clearing agent II for 10 minutes, wax dewaxing clearing agent I for 10 minutes. (19) Mounting with neutral resin.(20) Observe the histopathological changes under a microscope and take photographs.

[0176] 4. Verification of FUNDC1 expression levels in human skin tissue from unexposed and exposed areas.

[0177] The collected human skin tissue was paraffin-embedded and sectioned using the same method as before. Immunohistochemistry was used to detect the expression level of FUNDC1. Basic information of the specimens is shown in Table 1.

[0178] Table 1 Demographic data

[0179]

[0180] Apoptosis is a major form of regulated cell death, encompassing both extrinsic (or death receptor) and endogenous (or mitochondrial) pathways. Mitochondrial apoptosis is a crucial pathway of cell death. The mitochondrial apoptosis process involves stimuli such as DNA damage recruiting and activating Bcl2-associated X apoptosis regulator (Bax) / Bcl-2 gene family pro-apoptotic proteins (Bcl2-antagonist / killer, Bak) and Bcl-2 homology 3-only (BH3-only), leading to changes in mitochondrial outer membrane permeability (MOMP). MOMP induces the release of cytochrome C (C or Cyto C) from the mitochondrial intermembrane lumen. Cytochrome C then forms an apoptotic complex with apoptotic protease activating factor 1 (APAF1). This complex subsequently binds to and activates cysteine-aspartic proteases (caspase) 9. Caspase 9 then cleaves and activates caspase 3, leading to apoptosis. Mitochondria are crucial regulators of endogenous apoptosis signaling. Effector pro-apoptotic members of the B-cell lymphoma 2 (Bcl2) family (primarily Bax and Bak) initiate a signaling cascade, ultimately resulting in cell death. Studies have shown that UVB irradiation of skin keratinocytes or fibroblasts decreases the Bcl2 / Bax ratio, increases cytochrome C release, and activates downstream caspases, triggering mitochondrial apoptosis.

[0181] The following are the test results of this embodiment.

[0182] 1. Western blot detection of UVB-induced mitochondrial apoptosis activation in mouse dorsal skin

[0183] Example 1 has demonstrated the crucial role of the mitochondrial pathway in regulating apoptosis. In this example, proteins were extracted from mouse dorsal skin 24 h and 72 h after UVB irradiation, and Western blot analysis was used to detect molecular patterns in mitochondrial apoptosis-related pathways.

[0184] Cytochrome C (also represented as cyto c), Bcl2, Bax, and cleaved caspase 3 were detected, and the results were as follows: Figure 14 As shown. Figure 14 A represents the results of the Western blot. Figure 14 B represents the statistical results of the expression levels of cytochrome C, Bcl2, Bax, and cleaved caspase 3. Results are expressed as mean ± standard deviation, N = 5, and P < 0.05 indicates statistical significance.

[0185] Cytochrome C expression was significantly upregulated after 72 hours of UVB irradiation; Bcl2 expression was significantly downregulated after 72 hours of UVB irradiation; Bax expression was significantly upregulated after both 24 and 72 hours of UVB irradiation; and cleaved caspase 3 expression was significantly upregulated after 72 hours of UVB irradiation. These results indicate that UVB irradiation of mouse dorsal skin activates the mitochondrial apoptosis pathway.

[0186] 2. Immunohistochemical detection of UVB-induced mitochondrial apoptosis activation in mouse dorsal skin

[0187] Furthermore, this embodiment utilizes paraffin-embedded sections of mouse dorsal skin after UVB irradiation and immunohistochemical assays to detect changes in cytochrome C, Bcl2, Bax, and cleaved caspase 3, thereby verifying the changes in mitochondrial apoptosis-related molecules after UVB irradiation of mouse dorsal skin. The results are as follows: Figure 15 As shown in the figure. The control group represents the blank control group that was not exposed to light.

[0188] Figure 15 The results show the changes in the expression of mitochondrial apoptosis-related molecules after UVB irradiation of mouse back skin. Figure 15 A shows the staining results of immunohistochemical detection of cytochrome C, Bcl2, Bax, and cleaved-caspase 3. Figure 15B represents the statistical results of Western blot analysis of protein expression levels of cytochrome C, Bcl2, Bax, and cleaved-caspase 3. Results are expressed as mean ± standard deviation, N = 5, p < 0.05 indicates statistical significance. Scale bar: 200 μm.

[0189] Consistent with the trends observed in Western blot analysis, compared to the control group, UVB irradiation significantly upregulated cytochrome C at both 24 and 72 hours, significantly downregulated Bcl2 at both 24 and 72 hours, significantly upregulated Bax at both 24 and 72 hours, and significantly upregulated cleaved caspase 3 at both 24 and 72 hours. Furthermore, the upregulation of cytochrome C and Bax, and the downregulation of Bcl2, were time-dependent, with cleaved caspase 3 peaking at 24 hours post-irradiation. The combined results of Western blot and immunohistochemical analysis demonstrate that UVB irradiation of mouse dorsal skin induced activation of the mitochondrial apoptosis pathway.

[0190] 3. UVB induces mitochondrial apoptosis activation in HaCaT cells

[0191] In this embodiment, HaCaT cells were irradiated with UVB, and proteins were extracted and the expression levels of cytochrome C, Bcl2, Bax, and cleaved-caspase 3 were detected at different time points (1, 3, 6, 12, and 24 hours) to further verify that mitochondrial apoptosis pathways were also activated in the photodamage model established by UVB irradiation of HaCaT cells. The results are as follows: Figure 16 As shown. Figure 16 A represents the detection of protein expression levels of cytochrome C, Bcl2, Bax, and cleaved-caspase 3 using Western blot. Figure 16 B represents the statistical results of cytochrome C, Bcl2 / Bax, and cleaved-caspase 3 expression levels. Results are expressed as mean ± standard deviation, N = 3, and P < 0.05 indicates statistical significance.

[0192] Following UVB irradiation, cytochrome C began to upregulate at 6 hours and peaked at 12 hours. Figure 16 A and Figure 16 B), the Bcl2 / Bax ratio showed a significant downward adjustment at 3h. Figure 16 B) Cleaved caspase 3 was significantly upregulated and reached its peak at 6 h. The results indicate that UVB irradiation of HaCaT cells activates the mitochondrial apoptosis pathway, a finding consistent with that in C57BL / 6 mice.

[0193] 4. Western blot detection of UVB-induced inhibition of mitochondrial autophagy in mouse dorsal skin

[0194] Autophagy is generally considered a non-selective, bulk degradation process that transports cytoplasmic components such as nucleic acids, proteins, and organelles to lysosomes. Mitophagy is one of the autophagic pathways that maintains the cellular structure and function of specific organelles. Mitophagy targets damaged mitochondria within the cell, delivering them to lysosomes for degradation; this process helps maintain the control of mitochondrial quality and quantity. Disruption of mitochondrial membrane potential is a powerful trigger for mitophagy. In mammals, mitophagy includes ubiquitin-mediated (PINK1 / Parkin) mitophagy and receptor-mediated (Bcl2-interacting protein 3, BNIP3; Nip3-like protein X / BNIP3-like protein, NIX / BNIP3L; and protein 1 containing the FUN14 domain, FUNDC1) mitophagy. PINK1 phosphorylates ubiquitin, thereby recruiting and activating Parkin in the cytoplasm, which catalyzes ubiquitination, resulting in the generation of more ubiquitin chains.

[0195] Previous studies have shown that decreased levels of PINK1 and parkin indicate impaired mitophagy. Following UVB irradiation, BNIP3 plays a role in the degradation of dysfunctional mitochondria. Its mediated autophagy occurs through the activation of ROS-induced extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), playing a crucial role in the skin's defense against UVB damage.

[0196] The results of Example 1 demonstrate that UVB irradiation-induced mitochondrial damage is associated with mitophagy. In this example, proteins were extracted from the back skin of mice irradiated with UVB at 24 and 72 hours. Western blot was used to detect changes in the expression of receptor-dependent and ubiquitin-dependent mitophagy-related molecules to explore the molecules involved in regulating mitophagy after UVB irradiation. The results are as follows: Figure 17 As shown. Figure 17 A represents the detection of protein expression levels of FUNDC1, BNIP3, PINK1, and Parkin using Western blot. Figure 17 B represents the statistical results of protein expression levels of FUNDC1, BNIP3, PINK1, and Parkin. Results are expressed as mean ± standard deviation, N = 5, and P < 0.05 indicates statistical significance.

[0197] Western blot results showed that PINK1 and Parkin, involved in the ubiquitin-dependent mitophagy pathway, remained unchanged before and after photoexposure. BNIP3, involved in the receptor-dependent mitophagy pathway, also showed no significant changes before and after photoexposure, while FUNDC1 was significantly downregulated 24 h and 72 h after irradiation. Therefore, it is speculated that FUNDC1-mediated mitophagy plays an important role in UVB-induced photodamage to the skin.

[0198] 5. Immunofluorescence detection of UVB-induced downregulation of FUNDC1 in mouse dorsal skin

[0199] To further verify the role of the FUNDC1-mediated mitophagy pathway in UVB-induced photodamage, this study performed OCT embedding and frozen sectioning of skin before and 24 and 72 hours after UVB exposure. Immunofluorescence was used to detect the co-localization expression of FUNDC1 and the mitochondrial protein COX4. The results are as follows: Figure 18 As shown.

[0200] Figure 18 A represents the fluorescence intensity of FUNDC1 after UVB irradiation, as detected by tissue immunofluorescence. Green fluorescence represents COX4, red fluorescence represents FUNDC1, and blue fluorescence represents DAPI. Figure 18 B represents the statistical results of the fluorescence intensity of FUNDC1 after UVB irradiation. Results are expressed as mean ± standard deviation, N = 5, P < 0.05 indicates statistical significance, and the scale bar is 20 μm.

[0201] Immunofluorescence co-localization confirmed the interaction between FUNDC1 and COX4, indicating that FUNDC1 and COX4 are co-localized in mitochondria. After 24 h and 72 h of UVB irradiation, FUNDC1 in mouse epidermis was significantly downregulated in a dose-dependent manner, and the fluorescence intensity of FUNDC1 and COX4 co-localization was significantly downregulated at 24 h and 72 h, respectively.

[0202] 6. Immunofluorescence detection of UVB-induced downregulation of LC3B in mouse dorsal skin

[0203] This embodiment uses immunofluorescence to detect the expression level of LC3B to further verify that UVB irradiation-induced decrease in FUNDC1 in mouse dorsal skin inhibits receptor-mediated mitophagy. The results are as follows: Figure 19 As shown.

[0204] Figure 19 A represents the fluorescence intensity of LC3B after UVB irradiation, as detected by tissue immunofluorescence. Green fluorescence represents COX4, red fluorescence represents LC3B, and blue fluorescence represents DAPI. Figure 19B represents the statistical results of the fluorescence intensity of LC3B after UVB irradiation. Results are expressed as mean ± standard deviation, N = 5, P < 0.05 indicates statistical significance, and the scale bar is 20 μm.

[0205] After 72 hours of UVB irradiation, LC3B was downregulated, and co-localization with COX4 was reduced, consistent with the aforementioned downregulation of FUNDC1 and reduced co-localization of FUNDC1 and COX4. Based on this, this embodiment infers that UVB irradiation of mouse dorsal skin inhibits FUNDC1-mediated mitophagy, leading to photodamage to the skin.

[0206] 7. Western blot analysis of the inhibition of mitophagy in HaCaT cells induced by different doses of UVB.

[0207] In this embodiment, HaCaT cells were exposed to different doses of UVB (10, 20, 30 mJ / cm²). 2 Proteins were extracted from cells 24 hours after irradiation. Western blot analysis was used to detect molecules associated with receptor-dependent and ubiquitin-dependent mitophagy pathways to further verify that UVB irradiation of the skin inhibited mitophagy. The results are as follows: Figure 20 As shown.

[0208] Figure 20 A represents the detection of protein expression levels of FUNDC1, BNIP3, PINK1, and Parkin using Western blot. Figure 20 B represents the statistical results of protein expression levels of FUNDC1, BNIP3, PINK1, and Parkin. Results are expressed as mean ± standard deviation, N = 3, and P < 0.05 indicates statistical significance.

[0209] FUNDC1 at UVB values ​​of 10 and 20 mJ / cm 2 No significant changes were observed after irradiation at 30 mJ / cm². 2 A significant downregulation was observed after irradiation. BNIP3 was observed at UVB levels of 10 and 20 mJ / cm². 2 No significant changes were observed after irradiation; 30 mJ / cm 2 A significant upregulation was observed after irradiation. PINK1 and Parkin showed no difference after different doses of UVB irradiation.

[0210] In the survival assay of HaCaT cells after irradiation with different doses of UVB in Example 1, the UVB dose was 30 mJ / cm². 2At this point, cell viability began to decline significantly, reaching approximately 60%, and marked mitochondrial damage was observed. Simultaneously, a photodamage model of HaCaT cells was successfully established. Based on this, a UVB concentration of 30 mJ / cm² was selected. 2 Further experiments will be conducted.

[0211] 8. Western blot analysis of UVB-induced inhibition of mitophagy in HaCaT cells at different time points

[0212] In this embodiment, HaCaT cells were exposed to UVB at 30 mJ / cm². 2 Cell proteins were extracted at different time points (1, 3, 6, 12, and 24 h) after irradiation. Western blot analysis was used to detect molecules related to receptor-dependent and ubiquitin-dependent mitophagy pathways, further investigating changes in mitophagy-related molecules after UVB irradiation at different time points. Results are as follows: Figure 21 As shown.

[0213] Figure 21 A represents the detection of protein expression levels of FUNDC1, BNIP3, PINK1, and Parkin using Western blot. Figure 21 B represents the statistical results of protein expression levels of FUNDC1, BNIP3, PINK1, and Parkin. Results are expressed as mean ± standard deviation, N = 3, and P < 0.05 indicates statistical significance.

[0214] FUNDC1 showed no significant changes at 1, 3, 6, and 12 hours after UVB irradiation of HaCaT cells, but exhibited significant downregulation at 24 hours. BNIP3 showed no significant changes at 1, 3, and 6 hours after UVB irradiation, but showed significant upregulation at 12 and 24 hours. PINK1 and Parkin showed no significant differences at different time points after UVB irradiation. Combining the results of the mouse experiments, PINK1 / Parkin showed no significant changes at different UVB doses and time points; in cells, BNIP3 showed a significant upregulation after UVB irradiation, but this was not significant in mice, and the upregulation of BNIP3 did not correlate with the trend of LC3B. FUNDC1 showed a significant downregulation in both mice and cells after UVB irradiation, and the downregulation of FUNDC1 was consistent with the downregulation of LC3B.

[0215] Therefore, subsequent experiments further explored the role of FUNDC1-mediated mitophagy in UVB-induced skin photodamage.

[0216] 9. Immunofluorescence detection of FUNDC1 downregulation in HaCaT cells after UVB irradiation

[0217] In this embodiment, cell immunofluorescence was used to further validate FUNDC1 to confirm the downregulation of FUNDC1 after UVB irradiation of HaCaT cells. The results are as follows: Figure 22 As shown.

[0218] Figure 22 A represents the fluorescence intensity of FUNDC1 after UVB irradiation, as detected by cell immunofluorescence. Green fluorescence represents COX4, red fluorescence represents FUNDC1, and blue fluorescence represents DAPI. Figure 22 B represents the statistical results of fluorescence intensity of FUNDC1 after UVB irradiation. Results are expressed as mean ± standard deviation, N = 3, P < 0.05 indicates statistical significance, and the scale bar is 20 μm.

[0219] At a UVB concentration of 30 mJ / cm 2 Immunofluorescence co-localization of FUNDC1 and COX4 was performed on HaCaT cells 24 h after irradiation. Following UVB irradiation of HaCaT cells, FUNDC1 showed a significant downregulation. Figure 22 B), co-localization with COX4 is also reduced ( Figure 22 A).

[0220] 10. Immunofluorescence detection of UVB-induced decrease in LC3B in HaCaT cells

[0221] Immunofluorescence was used to further validate LC3B to confirm the inhibition of FUNDC1-mediated mitophagy in HaCaT cells after UVB irradiation. The results are as follows: Figure 23 As shown.

[0222] Figure 23 A represents the fluorescence intensity of LC3B after UVB irradiation, as detected by cell immunofluorescence. Green fluorescence represents COX4, red fluorescence represents LC3B, and blue fluorescence represents DAPI. Figure 23 B represents the statistical results of LC3B fluorescence intensity after UVB irradiation. Results are expressed as mean ± standard deviation, N = 3, P < 0.05 indicates statistical significance, and the scale bar is 20 μm.

[0223] Following UVB irradiation of HaCaT cells, LC3B expression was significantly downregulated, and co-localization with COX4 was reduced, consistent with the aforementioned downregulation of FUNDC1 and reduced co-localization of FUNDC1 with COX4. This embodiment also validated in HaCaT cells that UVB irradiation inhibited FUNDC1-mediated mitophagy-induced photodamage to the skin.

[0224] 11. Expression levels of FUNDC1 in human skin in the unexposed and exposed groups

[0225] This embodiment uses immunohistochemistry to detect the expression of FUNDC1 in human skin tissue to verify the expression level of FUNDC1 in photodamage to the skin. The results are as follows: Figure 24 As shown.

[0226] Figure 24 A represents the immunohistochemical results of FUNDC1 in the skin of the unexposed and exposed groups. Figure 24 B represents the immunohistochemical statistical results of FUNDC1. Results are expressed as mean ± standard deviation, N = 5, and P < 0.05 indicates statistical significance. Scale bar: 200 μm.

[0227] The significant decrease in FUNDC1 in the exposed areas suggests the inhibition of FUNDC1-mediated mitophagy in photodamaged human skin tissue, consistent with the results of UVB irradiation-induced photodamage in C57BL / 6 mice and HaCaT cells.

[0228] Example 3

[0229] The aforementioned results demonstrate that UVB irradiation causes mitochondrial damage in mouse skin and HaCaT cells, leading to apoptosis and photodamage. Specifically, the experimental results, obtained by Western blot analysis of the expression of mitophagy-related molecules in mouse back skin after UVB irradiation, showed that FUNDC1 decreased at 24 and 72 h after UVB irradiation, while BNIP3, PINK1, and Parkin remained unchanged. This indicates that FUNDC1 receptor-mediated mitophagy plays a crucial role in UVB-induced photodamage, while ubiquitin-mediated (PINK1 / Parkin) mitophagy is not directly activated after UVB irradiation. Similarly, exposure to 30 mJ / cm²... 2 In HaCaT cells exposed to UVB, FUNDC1 levels decreased while BNIP3 expression increased, indicating receptor-mediated changes in mitophagy following UVB irradiation. Furthermore, the aforementioned experiments validated FUNDC1 expression in human specimens, finding reduced FUNDC1 expression in sun-exposed skin, consistent with downregulation observed in both mice and cells.

[0230] In this embodiment, an overexpression experiment of FUNDC1 was conducted to analyze whether it can enhance mitophagy, thereby clearing damaged mitochondria and achieving the goal of reversing photodamage.

[0231] The following methods were used for verification.

[0232] 1. Lentiviral Infection and Stable Cell Line Construction: Hu6-mcs-cmv-puromycin lentivirus (shRNA1: 5'-GATTAAGAAACGAGCGAACAA-3' (SEQ ID NO: 1), shRNA2: 5'-GAAAGTGATGACGACTCTTAT-3' (SEQ ID NO: 2), or shRNA3: 5'-GCAAACTAGTATCTGCTGTAA-3' (SEQ ID NO: 3) encoding short hairpin RNA of FUNDC1, and Ubi-MCS-SV40-puromycin lentivirus (Shanghai Jikai Gene Medical Technology Co., Ltd.) encoding full-length FUNDC1 cDNA were constructed for FUNDC1 silencing and overexpression, respectively. The restriction enzyme sites at both ends of the inserted shRNA fragments were AgeⅠ and EcoRI (e.g., α-AgeⅠ and EcoRI). Figure 25 (As shown). The forward and reverse complementary sequences of shRNA were synthesized, as shown in Table 2, where CCGG and TTTTTG are the portions linked to the vector. Lentiviral virus (2 × 10⁻⁶) was used according to the instructions. 8 TU ml -1 Infected with HaCaT, in a solution containing 200 ng / ml -1 Stable clonal cell lines were obtained by culturing cells in complete DMEM containing puromycin for 2 weeks. Infected cell samples were named F1 sh (representing the FUNDC1 silencing group) or F1 OE (representing the FUNDC1 overexpression group). A blank control was used to verify FUNDC1 expression before further experiments.

[0233] Table 2

[0234]

[0235] 2. Quantitative RT-PCR: Total RNA was extracted from HaCaT cells using the SteadyPure Universal RNA Extraction Kit (Accurate Biology, China) according to the manufacturer's instructions. RNA concentration was measured using a micro-ultraviolet spectrophotometer. The RNA was used to synthesize first-strand cDNA using a cDNA synthesis kit (Accurate Biology, China). Real-time quantitative PCR analysis was performed using the SYBR Green Real-time PCR Master Mix (Accurate Biology, China) on an Applied Biosystems QuantStudio 1 (Applied Biosystems, USA) via melting curve analysis. Gene expression was analyzed using the 2-ΔCT method, with GAPDH mRNA used as an internal control to relatively quantify the target mRNA level. The following primers were used in this invention: Gene GAPDH, F: 5'-TGTAGGCTCATTTGCAGGGG-3' (SEQ ID NO: 10); R: 5'-TCCCATTCCCCAGCTCTCAT-3' (SEQ ID NO: 11), gene size 317 bp. The gene FUNDC1 has the following structures: F: 5'-ACAGTTCGGGACCTATGGTAGA-3' (SEQ ID NO: 12); R: 5'-CAGAAATCCTGCACACCAGCC-3' (SEQ ID NO: 13), with a gene size of 86 bp. F stands for Forward primer; R stands for Reverse primer.

[0236] 3. Western blot, the method is the same as above, and will not be repeated here.

[0237] The following are the experimental results.

[0238] 1. FUNDC1 overexpression enhances UVB-induced photodamage

[0239] Under normal conditions, the cell survival rate of HaCaT cells after UVB irradiation is approximately 60%. The results of overexpression of FUNDC1 are as follows... Figure 26 (FUNDC1 overexpression enhances UVB-induced photodamage) As shown, when FUNDC1 was overexpressed in HaCaT cells, cell survival was significantly reduced to approximately 30%.

[0240] Figure 26 A represents the result of detecting the expression level of FUNDC1 overexpression. Figure 26B represents the statistical results of cell viability assay using CCK8, ROS level assay using DCFH-DA, and apoptosis and necrosis assays using YP1 (also represented as YO-PRO-1 in the figure) and PI. Green fluorescence represents YP1, and red represents PI. Scale bar: 200 μm. Figure 26 C represents the expression result of γH2Ax detected by cellular immunofluorescence. Figure 26 D represents the statistical results of cell viability (cell viability) detected by CCK8. Figure 26 E represents the statistical results of ROS level detection by DCFH-DA. Figure 26 F represents the statistical results of the fluorescence intensity of YP1. Figure 26 G represents the statistical result of the fluorescence intensity of PI. Figure 26 F represents the statistical results of γH2Ax fluorescence intensity. Blue represents DAPI, and green represents γH2Ax. Scale bar: 20 μm. p-value < 0.05 indicates statistical significance.

[0241] Figure 26 The results showed that FUNDC1 overexpression significantly reduced cell viability in HaCaT cells; ROS levels in HaCaT cells were significantly increased in the F1 OE-UVB group; YP1 and PI increased after UVB irradiation in the F1 OE-UVB group, indicating enhanced apoptosis and necrosis; γH2Ax expression was significantly increased in the F1 OE-UVB group, which is consistent with the initial assumption that FUNDC1 overexpression can enhance mitophagy and clearance of damaged mitochondria to protect cells from UVB-induced photodamage.

[0242] Surprisingly, overexpression of FUNDC1 actually exacerbated UVB-induced photodamage.

[0243] Furthermore, FUNDC1 overexpression was performed to assess mitochondrial morphology, mtROS, MMP, and ATP levels after UVB irradiation, and the results are shown in Figure 27.

[0244] Figure 27 A represents the fluorescence intensity detection results of MitoTracker Red CMXRos (also represented as MitoTracker in the figure). Figure 27 B represents the fluorescence intensity detection result of MitoSOX Red Mitochondrial Superoxide Indicator (also represented as mtROS in the figure). Figure 27 C represents the fluorescence intensity detection result of JC-1. For MitoTracker, red represents mitochondria, and blue represents DAPI. For MitoSOX, red represents mtROS, and blue represents DAPI. For JC-1, red represents J aggregates, and green represents monomers. Scale bar: 200 μm. Figure 27D represents the co-localization results of LC3B and COX4 by cellular immunofluorescence. Scale bar: 20 μm. Figure 27 E represents the statistical results of the fluorescence intensity of MitoTracker Red CMXRos (also represented as MitoTracker in the figure). Figure 27 F represents the length of the long axis of the cell nucleus. Figure 27 G represents the statistical results of the fluorescence intensity of mtROS. Figure 27 H represents the statistical results of the fluorescence intensity of JC-1 monomers / aggregates. Figure 27 I represents the statistical results of the co-localization fluorescence intensity of LC3B and COX4 by cellular immunofluorescence. Figure 27 J represents ATP levels. A p-value < 0.05 indicates a statistically significant difference.

[0245] MitoTracker Red CMXRos-labeled mitochondria showed more pronounced aggregation along the long axis of the nucleus in the F1 OE-UVB group; the increased red fluorescence intensity in the F1 OE-UVB group suggested more severe mitochondrial depolarization; MitoSOX Red mitochondrial superoxide indicator, representing mtROS, showed greater aggregation in the mitochondria of the F1 OE-UVB group; for JC-1 staining, the red fluorescence representing J-aggregates decreased more significantly, while the green fluorescence representing monomers increased more significantly, and the reduction in MMPs was more pronounced compared to the UVB group. Figure 27 C and Figure 27 H). LC3B expression decreased after UVB irradiation but was restored by overexpression of FUNDC1. Figure 27 I); COX4 expression decreased after UVB irradiation. Surprisingly, COX4 was not expressed in the F1 OE-UVB group under FUNDC1 overexpression conditions after UVB irradiation. Figure 27 I), demonstrating mitochondrial loss. ATP levels decreased after UVB irradiation, with a more pronounced decrease in the F1 OE-UVB group, manifesting as ATP depletion. Figure 27 J).

[0246] Based on the above results, FUNDC1 overexpression leads to more significant mitochondrial and photodamage after UVB irradiation due to ATP depletion. Therefore, a subsequent FUNDC1 silencing experiment was conducted to analyze whether it could salvage mitochondrial and photodamage after UVB irradiation.

[0247] 2. FUNDC1 silencing reduces UVB-induced photodamage.

[0248] Jikai Gene (Shanghai, China) constructed an adeno-associated virus vector expressing a short guide RNA (sgRNA) targeting the FUNDC1 gene sequence. The sgRNA sequences specifically include (all in the 5' to 3' orientation): AAVDJ-Fundc1-RNAi (129269-1): GAAAGCGATGACGAATCATAC (SEQ ID NO: 14); AAVDJ-Fundc1-RNAi (129270-2): GAAGACACCACTGGTGGAATC (SEQ ID NO: 15); AAVDJ-Fundc1-RNAi (129271-11): GTAGCTACTCAGATTGTAATG (SEQ ID NO: 16), and a negative control (SEQ ID NO: 17). The forward and reverse complementary sequences of the sgRNA were synthesized, as shown in Table 3, where ACCGG and TTTTT are the portions linked to the vector. The aforementioned sgRNA was synthesized and cloned into the GV757(U6-MCS) vector, and the recombinant vector was detected by DNA sequencing. The viral suspension was injected intradermally into the skin of mice using a 1 ml syringe and a 30-gauge needle; each mouse received 5 to 7 injections, each approximately 20 μl (equivalent to approximately 10...) 11 (1 viral particle). Mice in each experimental group were sacrificed 21 days after injection to assess infection efficiency, and the group with the best knockdown effect was selected by Western blot.

[0249] Table 3

[0250]

[0251] Figure 28 The results were obtained by detecting cell viability using CCK8, ROS levels using DCFH-DA, and apoptosis and necrosis using YP1 and PI. Figure 28 A shows the mRNA expression results of different groups that silenced FUNDC1. These results were used to screen treatment groups with better knockdown results. Figure 28 Based on the results of A, the F1 Sh2 treatment group was selected for subsequent experiments. Figure 28 B shows the results of CCK8 assay for cell viability, DCFH-DA assay for ROS levels, and YP1 and PI assays for apoptosis and necrosis. Green fluorescence represents YP1, and red represents PI. Scale bar: 200 μm. Figure 28 C represents the expression result of γH2Ax as detected by cellular immunofluorescence. Blue represents DAPI, and green represents γH2Ax. Scale bar: 20 μm. Figure 28 D represents the statistical results of cell viability (cell viability) detected by CCK8. Figure 28 E represents the statistical result of the ROS level. Figure 28 F represents the statistical results of YP1 fluorescence intensity. Figure 28 G represents the statistical results of γH2Ax fluorescence intensity. Figure 28 H represents the statistical results of PI fluorescence intensity. A p-value < 0.05 indicates that the difference is statistically significant.

[0252] In terms of cell viability, the F1 Sh2-UVB group showed an increase to 80% compared to 60% in the UVB group. Figure 28 D); As green fluorescence decreased, the intracellular ROS level in the F1 Sh2-UVB group decreased ( Figure 28 E); Apoptosis and necrosis levels, represented by YP1 and PI, showed a decrease in both green and red fluorescence in the F1 Sh2-UVB group. Compared to the UVB group, nuclear damage, represented by γH2Ax expression, was significantly reduced in the F1 Sh2-UVB group. Figure 28 G). That is, FUNDC1 silencing cannot completely reverse UVB-induced photodamage, but it can alleviate some of the photodamage.

[0253] Further evaluation of the effects of FUNDC1 silencing on mitochondrial morphology, mtROS, MMP, and ATP levels after UVB irradiation yielded the following results: Figure 29 As shown. Figure 29 A represents the fluorescence intensity of MitoTracker Red CMXRos. Figure 29 B represents the fluorescence intensity of the MitoSOX RedMitochondrial Superoxide Indicator (mtROS). Figure 29 C represents the fluorescence intensity of JC-1. For MitoTracker, red represents mitochondria and blue represents DAPI; for MitoSOX, red represents mtROS and blue represents DAPI; for JC-1, red represents J-aggregates and green represents monomers. Scale bar: 200 μm. Figure 29 D represents the co-localization of LC3B and COX4 by immunofluorescence. Scale bar: 20 μm. Figure 29 E represents the statistical results of the fluorescence intensity of MitoTracker Red CMXRos. Figure 29 F represents the length of the long axis of the cell nucleus. Figure 29 G represents the statistical results of the fluorescence intensity of mtROS. Figure 29 H represents the statistical results of the fluorescence intensity of JC-1 monomers / aggregates. Figure 29 I represents the statistical results of the co-localization fluorescence intensity of LC3B and COX4 cells using immunofluorescence. A p-value < 0.05 indicates a statistically significant difference.

[0254] Following UVB irradiation, mitochondrial damage was rescued under FUNDC1 silencing conditions. In the F1 Sh2-UVB group, mitochondria labeled with MitoTracker Red CMXRos regained uniform distribution. Figure 29 A) Compared with the blank control group, there was no significant change in mitochondrial distribution in the UVB group; the recovery of red fluorescence intensity was consistent with that of the control group, indicating the recovery of mitochondrial membrane potential (MMP) in the F1 Sh2-UVB group. Figure 29 C); compared with the UVB group, mtROS in the F1 Sh2-UVB group was alleviated ( Figure 29 B and Figure 29 G); For JC-1 staining, red fluorescence increased while green fluorescence decreased, and compared with the UVB group, the F1 Sh2-UVB group showed partial mitochondrial repolarization. Figure 29 C and Figure 29 H). Compared with the UVB group, there was no significant change in LC3B expression in the F1 Sh2-UVB group ( Figure 29 D and Figure 29 This indicates that FUNDC1 silencing has no effect on LC3B. Surprisingly, compared to the UVB group, COX4 expression in the F1 Sh2-UVB group was not decreased, but rather increased. Figure 29 I).

[0255] In summary, FUNDC1 silencing alleviates UVB-induced mitochondrial and photodamage.

[0256] 3. FUNDC1 silencing protects mitochondria from apoptosis by supplementing PINK1-Parkin-mediated mitophagy.

[0257] Previous studies have shown that, in the context of sublethal MOMP (mitochondrial outer membrane perforation), PINK1-Parkin-mediated mitophagy promotes the restoration of cellular homeostasis by catalyzing the ubiquitination-dependent inactivation of BAK1 / Bax.

[0258] Figure 30 A represents the protein expression levels of FUNDC1, BNIP3, PINK1, Parkin, Bcl2, and Bax. Figure 30 B represents the statistical results of FUNDC1 protein expression levels. Figure 30 C represents the statistical results of BNIP3 protein expression levels. Figure 30 D represents the statistical results of PINK1 protein expression levels. Figure 30 E represents the statistical results of Parkin protein expression level. 30F represents the statistical results of Bcl2 protein expression level. 30G represents the statistical results of Bax protein expression level. A p-value < 0.05 indicates a statistically significant difference.

[0259] Figure 30 Western blot results showed that the anti-apoptotic protein Bcl2 was decreased in the UVB group, but upregulated in the F1 Sh2-UVB group. Figure 30 A and Figure 30 F). Compared to the UVB group, the pro-apoptotic protein Bax was decreased in the F1 Sh2-UVB group ( Figure 30 A and Figure 30 G). Downregulation of Bax and upregulation of Bcl2 alleviated mitochondrial apoptosis, thereby protecting against UVB-induced photodamage. Following FUNDC1 silencing, BNIP3 expression levels did not change significantly in the F1 Sh2-UVB group compared to the UVB group. Figure 30 A and Figure 30 C), therefore, receptor-mediated mitophagy was not provided. Furthermore, PINK1 expression was upregulated in the F1 Sh2-UVB group ( Figure 30 A and Figure 30 D), while Parkin's expression did not change significantly. Figure 30 A and Figure 30 E). The upregulation of PINK1 is associated with ubiquitin-mediated mitophagy, which complements protective mitophagy and helps promote the restoration of cellular homeostasis.

[0260] It should be noted that the specific embodiments described above are exemplary. Those skilled in the art can devise various solutions inspired by the disclosure of this invention, and these solutions all fall within the scope of this invention and its protection. Those skilled in the art should understand that this specification and its accompanying drawings are illustrative and do not constitute a limitation on the claims. The scope of protection of this invention is defined by the claims and their equivalents. This specification contains multiple inventive concepts; for example, "according to a preferred embodiment" indicates that a corresponding paragraph discloses an independent concept. The applicant reserves the right to file divisional applications based on each inventive concept. Throughout the text, features introduced by "according to a preferred embodiment" are merely optional and should not be construed as mandatory. Therefore, the applicant reserves the right to abandon or delete relevant preferred features at any time.

Claims

1. The application of FUNDC1 inhibitors in the preparation of drugs for preventing and treating photodamage to the skin, characterized in that, The sequence of the FUNDC1 inhibitor is shown in SEQ ID NO: 6 or SEQ ID NO:

7.

2. A shRNA sequence that specifically inhibits or reduces the expression of FUNDC1, characterized in that, Its sequence is shown in SEQ ID NO: 6 or SEQ ID NO:

7.

3. A carrier, characterized in that, It contains the shRNA sequence as described in claim 2.

4. A kit for knocking down the FUNDC1 gene, characterized in that, It comprises the shRNA sequence of claim 2 or the vector of claim 3.

5. A pharmaceutical composition for preventing and treating photodamage to the skin, characterized in that, The invention includes a FUNDC1 inhibitor and a pharmaceutically acceptable carrier or excipient, wherein the sequence of the FUNDC1 inhibitor is shown in SEQ ID NO: 6 or SEQ ID NO: 7.

Images