A weel gene molecular marker related to carcass longissimus muscle of pig and application thereof
By screening for T/G polymorphisms at the -616 site of the pig WEE1 gene promoter region, and using PCR amplification and sequencing technologies to identify the pig genotype, the genetic improvement problem of the oblique length trait in pig carcasses was solved, enabling early selection and increased meat production, especially significantly improving the meat production capacity of Longmin Black Pig.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ANIMAL HUSBANDRY RES INST OF HEILONGJIANG ACADEMY OF AGRI SCI
- Filing Date
- 2024-09-30
- Publication Date
- 2026-04-17
AI Technical Summary
Existing technologies make it difficult to effectively increase pig meat yield through traditional methods, especially the genetic improvement of the oblique length trait of pig carcasses, resulting in poor pig breeding results.
By screening for T/G polymorphisms at the -616 site of the pig WEE1 gene promoter region, PCR amplification and sequencing technologies were used to identify the pig genotypes, and this polymorphism was used as a molecular marker to select pig breeds or strains with carcass oblique length traits.
It enables early selection of breeds, increases the meat yield of pigs, and is simple, fast, and unaffected by the environment. It has important breeding significance, especially in improving the meat production capacity of Longmin Black Pig.
Smart Images

Figure CN119082318B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetic marker technology, specifically to an SNP molecular marker associated with the oblique length of a pig carcass and its application. Background Technology
[0002] Meat yield is a complex trait that is difficult to improve through traditional genetic modification methods. Advances in molecular genetics and biotechnology have provided powerful tools for breeding complex traits—molecular breeding. Identifying major genes and quantitative trait loci, and developing molecular markers, are important aspects of molecular breeding.
[0003] Phenotypic data measurement is an important part of pig breeding research. Meat yield refers to the carcass weight of the animal after slaughter, including the meat and bones, after removing the head, hooves, and offal; direct measurement of this is rather cumbersome. Carcass oblique length refers to the length from the anterior edge of the pubic symphysis to the junction of the first rib and the sternum. Carcass oblique length is significantly positively correlated with meat yield and is a commonly used indicator for measuring meat yield.
[0004] WEE1 G2 checkpoint kinase gene (WEE1) is a tyrosine kinase belonging to the Ser / Thr family of protein kinases. This protein catalyzes the inhibitory phosphorylation of CDC2 / cyclin B kinases and coordinates the transition between DNA replication and mitosis by protecting the cell nucleus from cytoplasmic activated CDC2 kinases. WEE1 was first discovered during the G2 phase of cell division. It controls the activity of the Cyclin B-CDK1 complex by phosphorylating serine at position 15 of CDK1, preventing the phosphorylation and activation of mitosis-related proteins in the cell nucleus, thereby controlling the cell's entry into mitosis and inhibiting cell proliferation.
[0005] Recent studies have found that WEE1, in addition to regulating the G2 / M transition point, also plays a regulatory role in the S phase. WEE1 phosphorylation of CDK2 inhibits the activity of the Cyclin E-CDK2 complex, preventing premature termination of S phase and ensuring the completion of DNA replication. Furthermore, Mahajan K et al. discovered that in late S phase, WEE1 kinase can act as an epigenetic modifier of histone H2B, regulating the expression of replication-dependent core histone genes. Nobumoto Watanabe et al. found that the expression level of WEE1 protein in human cells exhibits a cyclical change, increasing from S phase to G2 phase, peaking in G2 phase, then rapidly decreasing, and reaching its lowest point in M phase.
[0006] Fu Yanfeng et al., in their paper "Genome-wide Association Analysis of Pig Litter Size" published in the "North China Agricultural Journal," presented the following:
[0007] To screen key SNP molecular markers or candidate genes for total litter size and live piglet number traits in pigs, a genome-wide SNP scan was performed on 186 Canadian Large White breeding sows from the same pig farm using the Illuminaporcine 50K chip. The scan results were then subjected to quality control, Beagle filling, and SNP genotyping. Combined with phenotypic trait determination and population structure analysis results of these experimental pigs, a genome-wide association study (GWAS) was conducted. Population structure analysis showed that no population stratification was observed in the Canadian Large White pig samples used in the experiment; a total of 36,867 valid SNP markers were obtained on 18 pairs (36) of autosomes, which were used for GWAS analysis of the experimental pigs. GWAS results showed that the total number of piglets born in all parities of these Canadian Large White pigs was significantly associated with two SNPs, namely seq-rs323899658 and seq-rs329781338. Among them, the seq-rs329781338 SNP was further annotated with three genes, namely SSBP1, WEE2 and KIAA1147. The number of live offspring was significantly associated with seven SNPs: seq-rs81238474, seq-rs321377412, seq-rs340736313, seq-rs80782154, seq-rs81244816, seq-rs81467772, and seq-rs329781338. Five of these SNPs had gene annotations, resulting in the annotation of 22 genes: E-phA1, TAS2R60, FAM131B, CLCN1, CASP2, and TMEM. GO function and KEGG pathway analysis of candidate genes 139, TRBV21OR9-2, PRSS2, TRBV19, TRBV24-1, U6, SSBP1, WEE2, KI-AA1147, NKX2-8, ALKBH3, HSD17B12, U6, HOMER2, WHAMM, FSD2, and SCARNA15 revealed that the most significant biological process in the GO function of these genes is the regulation of multiple biological processes, the molecular function is the activity of non-transmembrane / transmembrane protein tyrosine kinases, and the KEGG pathway is mismatch repair. Combined with GWAS and gene functional annotation results, WEE2 and EphA1 genes can be considered key candidate genes for increasing the total litter size and live piglet count in Canadian Large White pigs.
[0008] The article reports on the WEE2 gene in Large White pigs, which is associated with total litter size and live piglet count. However, no reports were found on the relationship between the WEE family (especially WEE1) and pork yield and quality, nor were there any reports on the WEE1 family in domestic pigs. Summary of the Invention
[0009] The purpose of this invention is to provide a SNP molecular marker related to the oblique length trait of pig carcasses and its application, and to apply it in genotyping, genetic breeding and other fields, with the aim of screening a molecular marker related to the oblique length trait of pig carcasses.
[0010] The present invention relates to a single nucleotide sequence as shown in SEQ ID NO.1, which is formed by a single nucleotide mutation at the -616th base of the WEE1 gene, which is an SNP molecular marker associated with the oblique length trait of pig carcasses; the polymorphism of the single nucleotide mutation is manifested as T / G polymorphism.
[0011] Furthermore, the T / G polymorphism affects the meat yield of pigs.
[0012] Furthermore, the T / G polymorphism refers to a T-to-G mutation; among them, individuals with the TT genotype have a longer carcass oblique length than individuals with the GG genotype.
[0013] The present invention relates to the application of SNP molecular markers related to the oblique length trait of pig carcasses, wherein the SNP molecular markers are used for the selection / assisted selection of pig breeds or strains related to the oblique length trait of pig carcasses.
[0014] Furthermore, the pigs mentioned are Longmin Black Pigs, Min Pigs, or Large White Pigs.
[0015] Furthermore, the aforementioned selection / assisted selection of pig breeds or strains related to the oblique length of the carcass involves selecting pigs with the genotype TT at the -616 site in the promoter region of the WEE1 gene as target pigs for breeding.
[0016] Furthermore, the selection of pigs with the TT genotype at the -616 site within the WEE1 gene promoter region is performed as follows:
[0017] Step 1: Obtain the genomic DNA of the pig to be tested;
[0018] Step 2: Using genomic DNA as a template, perform PCR amplification using WEE1_F1 primers and WEE1_R1 primers to obtain the promoter region of the WEE1 gene containing SNP sites.
[0019] WEE1_F1 primers: 5′-AGAGCGGTGTGGCAGTTTA-3′;
[0020] WEE1_R1 primers: 5′-GGCGAAGGACCGGAGAAT-3′;
[0021] Step 3: After agarose gel electrophoresis and sequencing analysis of the promoter region of the WEE1 gene containing SNP sites, select pigs with the TT genotype containing the -616 site in the WEE1 gene promoter region.
[0022] The present invention provides a primer pair for identifying an SNP molecular marker associated with the oblique length trait of a pig carcass, wherein the primer pair is as follows:
[0023] WEE1_F1 primers: 5′-AGAGCGGTGTGGCAGTTTA-3′;
[0024] WEE1_R1 primer: 5′-GGCGAAGGACCGGAGAAT-3′.
[0025] The present invention provides a kit for identifying SNP molecular markers associated with the oblique length trait of pig carcasses, the kit comprising the primer pairs described in the present invention.
[0026] The Minzhu pig is a local breed unique to Northeast my country, possessing excellent characteristics such as delicious meat, disease resistance, and tolerance to roughage, but its growth rate is relatively slow. The Large White pig, on the other hand, is an introduced lean-type breed with a fast growth rate and high lean meat percentage. This invention first uses Minzhu and Large White pigs as experimental materials to analyze the genetic polymorphism of the WEE1 gene. Direct sequencing of PCR products revealed a T-to-G mutation at position -616 in the promoter region of the porcine WEE1 gene. The frequency of this point mutation differed significantly between Minzhu and Large White pigs. In Minzhu, the G allele was dominant, with frequencies of 0.105 and 0.895 for the T and G alleles, respectively; while in Large White pigs, the T allele was dominant, with frequencies of 0.725 and 0.275 for the T and G alleles, respectively.
[0027] This invention further utilizes luciferase reporter gene assays to conduct an in-depth analysis of the genetic effects of the T>G polymorphism at the -616 site. It was found that the T-to-G mutation at the -616 site alters the activity of the WEE1 promoter in vitro. After mutating the WEE1 gene at the -616 site (T to G), the activity of the luciferase reporter gene significantly decreased. This indicates that this mutation has an important function.
[0028] Longmin Black Pig is a new breed developed from Min Pig as parent. Further research in Longmin Black Pig has found that the carcass oblique length of individuals with the TT genotype is significantly higher than that of heterozygotes and homozygotes with the TG genotype (p<0.05).
[0029] The present invention has the following beneficial effects:
[0030] This invention experimentally revealed that the T-to-G mutation at the -616 site of the porcine WEE1 gene promoter significantly reduced WEE1 promoter activity in vitro, with a significant difference (p<0.01). Further correlation analysis confirmed that the carcass oblique length of individuals with the TT genotype was significantly higher than that of heterozygous TG and homozygous GG individuals (p<0.05). This indicates that this point mutation can serve as a molecular marker for meat yield.
[0031] This invention identifies the carcass slant length of pigs by judging the polymorphism of mutation sites in the promoter region of the porcine WEE1 gene, and applies these mutation sites as early selection criteria, thus providing an effective selection method and offering a new approach to improving pig meat production. The method for detecting mutation-associated molecular markers in this invention is not only simple and rapid, but also unaffected by environmental factors, and allows for early selection, which has significant breeding implications for improving the meat production capacity of pigs (especially Longmin Black Pigs). Attached Figure Description
[0032] Figure 1 This is an electrophoresis diagram of PCR amplification of the porcine WEE1 gene promoter; in the diagram, lane M is the DL2000 marker and lane 1 is the target band.
[0033] Figure 2 The sequencing results show the SNP sites in the promoter region of the porcine WEE1 gene; the left image shows TT-type individuals, the middle image shows TG-type individuals, and the right image shows GG-type individuals.
[0034] Figure 3 The results of double enzyme digestion identification of the reporter gene plasmid are shown in the figure. Lane M is the DL2000 marker, and lane 1 is the plasmid double enzyme digestion product.
[0035] Figure 4 The results show the sequencing identification of mutant reporter genes; in the figure, WT represents wild type and MT represents mutant type.
[0036] Figure 5 The effect of the -616 site mutation on promoter activity is shown in the figure; WT represents wild type and MT represents mutant type. Detailed Implementation
[0037] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the spirit of the contents disclosed in the present invention will be described in detail below. After understanding the embodiments of the present invention, any person skilled in the art can make changes and modifications based on the technology taught in the present invention without departing from the spirit and scope of the present invention.
[0038] The illustrative embodiments and descriptions of the present invention are used to explain the present invention, but are not intended to limit the present invention.
[0039] Example 1
[0040] Establishment of Polymorphic Site Identification and Genotyping Technology
[0041] 1. Genomic DNA extraction: Genomic DNA was extracted using the conventional phenol-chloroform method.
[0042] 2. Primer Design: Based on the WEE1 gene (Gene ID: 100521487) and its cDNA (XM_003122982.4) sequences published in the GenBaknk database, its promoter region was determined. Primers WEE1_F1 and WEE1_R1 were designed using Primer Premier 5.0 software to amplify the -1387 to -19 region of the porcine WEE1 gene. The primer sequences are as follows:
[0043]
[0044]
[0045] 3. Identification of polymorphic sites: Using mixed genomic DNA from 10 Min pigs and 10 Large White pigs as templates, PCR amplification was performed using primers WEE1_F1 / R1. The PCR amplification system and reaction conditions are as follows:
[0046] Amplification system: 5 μL genomic DNA template, 2 μL each of 10 μM forward and reverse primers, 25 μL 2×Rapid Master Mix enzyme, and ddH2O to a final volume of 50 μL. Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 20 s, 35 cycles; 72℃ final extension for 5 min; store at 4℃.
[0047] After PCR products were detected by agarose gel electrophoresis, they were sent to BGI Genomics Co., Ltd. for sequencing. The sequencing results were compared with known sequences (Gene ID: 100521487) using SnapGene software, and the sequencing peaks were manually checked using Chromas software to identify polymorphic sites. One SNP was detected in this region, which was an SNP (-616T>G) site. The agarose gel electrophoresis results are shown below. Figure 1 .
[0048] The sequence of the WEE1 gene -1387 to -19 region is as follows:
[0049] AGAGCGGTGTGGCAGTTTATATCTTTGACCCAGCAATCCTAAAGAATAAAAACGGCAAAATAAAACACAGGAAAAAAAAAAAAACGCAAGGAGGAAGAATATTCTTTATGGGGTTATTGACAAGTAAAAGATTGTTGGAATCTTCTCTGTGTGACAGTAAGGGATGGAGTAAATCACAATTTAACGTGGTGCTAGAGAAATTTTCTCAAGTCCCTTTGAAGTTTGCAGCGAGCTGAGCCATTCTATTTTGCCAACACTTGCCCATGAGCTGGCAAACAAATATAAACAGCGTGGCCTGGTGGTGGGCGCTCGGTTTTGTGCTTACGGCCGAACTTGGGGCGGCTTTATTTACTGTGGACAATTTGCGGGAGCCGGGACATCTGAGGGGACCACAGCCTGGGGGCGCTCAACTCCCTATGGACACACTGGACCCTATCAGCCACTCTGGGGTGGAAGCTGAGGCTCAGAGGCTGCCCCGCAGCTGGTGACCTCGCCTGGAGAACTCGAGTGTCCGCCTTCCTGCTGACTTTGGTGTCCCCCTAACCAATTTGTTTACAGTTCAGAACTGTCCTGAGAGACCTCGACCCGGGAACGTGACTTCCCACAGCCACGCCCACACTGCCTCAGGGGCCGGCACCAAAGGGACGCGGGGCAGTAGGTTGGTATCCAGGGACAGCGCCCGAGGGCCACTGCAGTCCCCCGCTCGCCCAGACTTGCCGGGACCCAGAGGCGCTCTCTCGCCGCCCGTCCGATTCCAGACTCGCGGAAGCC TTGCGGGCGGCGAACGCGTCCAGGGCCGCGCTGGGATCAGCCTAGCCAAGCCCTCACCCTTGGTCCCACCCAGAGGGCGGCCTCGGCTCCACCTTGGCCCGGTCCGGGCGGCTCCGGACCCGCGGCTCGAGTGATCCCGCTCGCTCATAGGCCCGCGGCGCCACGCCCGCCCAGGCCTGGCTGGGCGCCGAGCAGGGTGGGCGGAGCCAGCGAGTTCGCGCCAAAATCGCGTAGCCGATCCCTCCCCCGCGGGGTACGTCGCGCCCTCCATTTTTTTCAAACCCTGAGCTGGGCGGGGATTGGTGGGCTGGGCACTCACGTGGTTAACGGTCGCGGGAAGCCGCGGAGCCCGAACCTGTGGCTGGACCTGCGGAGACCCCAGCCTCGGCGCCCGGGCCGCCCCTCCGCTGCCGGACAGTTCGCGCCGCTGCCGCCCCCACCATCCGCCGTCCCGAGCGTCCCGGAGCCGCAGGCCGCCGCCGCCGCCGCGCAGGCCCGCCGCCGAAGCCGCTAGGCGCGCCCAGTCGCACGTGGCGGACCCGCCCCCTGGGCCGGCAGTGTCCTGGACTCCGCGGGCCCCGATTCTCCGGTCCTTCGCCCCGGCCCTAGGGGCGCGATG
[0050] Note: The underlined position represents -616. The first base of the start codon is taken as +1.
[0051] 4. Genotype and Gene Frequency Analysis: Population genetic analysis was performed on SNP-616T>G to compare its genotype and gene frequency in Min pigs and Large White pigs. The WEE1 promoter region sequence was amplified using WEE1_F1 / R1 primers, and the base composition of the SNP-616T>G site was detected by direct sequencing of the PCR products. Homozygotes and heterozygotes were identified by visually examining the Chromas sequencing peaks, and gene frequencies and genotype frequencies were calculated. As shown in Table 1, among 19 Min pig individuals, 16 individuals had the GG genotype (frequency 0.842), 1 individual had the TT genotype (frequency 0.052), and 2 individuals had the GT genotype (frequency 0.105). The T allele frequency was 0.105, and the G allele frequency was 0.895. Among 20 Large White pig individuals, 2 individuals had the GG genotype (frequency 0.1), 11 individuals had the TT genotype (frequency 0.55), and 7 individuals had the GT genotype (frequency 0.35). The T allele frequency was 0.725, and the G allele frequency was 0.275. The distribution of the two alleles in Min pigs and Large White pigs was diametrically opposed. Sequencing identification results for the three genotypes are shown in Table 1. Figure 2 .
[0052] Table 1 Genotype and gene frequencies of the porcine WEE1 gene SNP-616T>G in Minzhu and Longmin Black Pig populations.
[0053]
[0054] Note: The number in parentheses is the number of samples.
[0055] Example 2
[0056] Construction and site-directed mutagenesis of the wild-type reporter gene vector for the WEE1 gene
[0057] 1. Genome extraction: See Example 1.
[0058] 2. Primer Design: Based on the requirements of subsequent vector construction, KpnI and HindIII restriction sites were introduced at the 5' ends of primers WEE1_F1 and WEE1_R1, respectively. The -1387 to -19 fragment of the Minzhu WEE1 promoter was amplified using PCR. The primer sequences with restriction sites are as follows:
[0059]
[0060] Note: The underscores represent KpnI and HindIII restriction sites, respectively.
[0061] 3. PCR amplification: The -1387 to -19 fragment of the WEE1 gene promoter region of the Min pig was amplified by PCR (the nucleotide sequence of this fragment is shown in SEQ ID No. 1). The PCR amplification system and reaction conditions were the same as in Example 1.
[0062] 4. PCR Product Detection and Gel Recovery and Purification of the Target Fragment: After the PCR reaction, a 1.2% agarose gel was prepared for the detection of the PCR amplification products. The conditions were set as follows: 100V, electrophoresis for 30 min. After electrophoresis, the PCR amplification results were observed using a gel imaging system. Once a single, bright target fragment with the correct band length was observed, the target fragment region was gel-cut. Gel recovery was performed according to the instructions of the BioTeke Corporation gel recovery kit. The recovered gel products were stored at -20℃ after agarose gel electrophoresis.
[0063] 5. Enzyme digestion and ligation: The gel-recovered product and the pGL3-Basic empty vector were double-digested using restriction endonucleases HindIII and KpnI, respectively.
[0064] Enzyme digestion system: HindIII, 1 μL; KpnI, 1 μL; 10×Buffer, 2.0 μL; Plasmid, 2 μg; ddH2O to bring the total to 20 μL; Reaction conditions: 37℃ water bath, 1 hour.
[0065] After the enzyme digestion products were purified by gel recovery, they were ligated using T4 DNA ligase from Dalian Takara Bio Co., Ltd. The ligation system and reaction conditions were performed according to the instructions.
[0066] 6. Cloning, Transformation, and Sequencing Identification: DH5α competent cells from Qingke Biotechnology Co., Ltd. were used for transformation. Colonies on agar plates were identified by PCR and double enzyme digestion of the plasmid, and then sent to Beijing BGI Genomics Co., Ltd. for sequencing identification. The base at position -616 is T. The results of the double enzyme digestion of the plasmid are shown below. Figure 3 .
[0067] 7. Using the constructed wild-type reporter gene as a template, a site-directed mutagenesis was performed at the -616 site using overlap extension PCR to construct a mutant reporter gene with base A at this site. The primer sequences for the site-directed mutagenesis are as follows:
[0068]
[0069] Note: Underlined bases indicate mutated bases.
[0070] 8. The site-directed mutagenesis method is overlap extension PCR, which includes two rounds of reactions. In the first round, the wild-type reporter gene plasmid is used as a template, and amplification is performed using primer pairs WEE1_F2 / WEE1_R3 and WEE1_F3 / WEE1_R2, respectively, to obtain two overlapping fragments with point mutations at their ends. In the second round, the PCR products from the above two reactions are used as templates, and WEE1_F2 / WEE1_R2 is used as primers for PCR amplification. The two fragments are spliced together by the overlap extension method. This process introduces the point mutation into the interior of the PCR product.
[0071] Both rounds of PCR reactions were performed using the high-fidelity enzyme 2×PrimeSTAR Max Premix. The reaction system and conditions are as follows:
[0072] Reaction system: 100 ng template DNA, 25 μL 2×PrimeSTAR Max Premix, 20 μM each of forward and reverse primers, and ddH2O to a final volume of 50 μL. Reaction conditions: 98℃ denaturation for 10 s, 62℃ annealing for 15 s, 72℃ extension for 1 min, 30 cycles.
[0073] The product obtained from the second round of PCR was purified by gel extraction and ligated into the pGL3-Basic vector. Sequencing confirmed that the G mutation at site -616 of the WEE1 gene was changed to A. The experimental methods involved, including electrophoresis, purification, ligation, transformation, colony identification, and sequencing, were the same as described above. The results of the point mutation sequencing identification are shown below. Figure 4 .
[0074] Example 3
[0075] Dual-luciferase reporter gene analysis: the effect of T>G mutation on promoter activity
[0076] 1. Endotoxin-free plasmid extraction: The plasmid-free DNA was extracted using the endotoxin-free plasmid extraction kit from Tiangen Pharmaceuticals. The specific operation was strictly performed in accordance with the instructions, and the plasmid concentration was measured using a UV spectrophotometer.
[0077] 2. Cell Culture and Transfection: PK-15 was stored in our laboratory. PK-15 was seeded in 24-well cell culture plates and incubated at 37°C with 5% CO2. Transfection was performed transiently when confluence reached 70-90%. Wild-type, mutant, and empty vectors were co-transfected with the Renaissance luciferase reporter gene pRL-TK, with three replicates for each group. The transfection reagent was Lipofectamine 8000 from Beyotime Biotechnology Co., Ltd., and the procedure was strictly followed according to the instructions. Three independent experiments were conducted.
[0078] 3. Luciferase Activity Assay: 48 hours after transfection, cells were collected, and dual luciferase activity was measured using the Beyotime Dual Luciferase Reporter Gene Assay Kit, strictly following the instructions. The luciferase activities of the firefly and sea urchin reporter genes were measured, and the ratio of the two was the relative luciferase activity.
[0079] The results of the dual-luciferase activity assay are as follows: Figure 5 As shown, the T-to-G mutation resulted in a significant decrease in relative luciferase activity (p<0.01), meaning that the promoter activity was significantly reduced after the mutation at this site (p<0.01). This indicates that the point mutation affects WEE1 expression.
[0080] Example 4
[0081] Application of the Molecular Markers of the Invention in the Correlation Analysis of Carcass Oblique Length of Longmin Black Pigs The experimental group used in this embodiment was Longmin Black Pigs from Yichun Baoyu Agricultural Technology Co., Ltd. in Heilongjiang Province, which were slaughtered in the same period in the autumn of 2024. A total of 191 pigs were slaughtered when they reached 210 days of age, and the oblique length of the carcasses was measured.
[0082] The inventors used the direct sequencing and genotyping technology of PCR products established in Example 1 to analyze gene frequencies and genotype frequencies in the experimental population. One-way ANOVA was performed using SAS statistical software (SAS Institute Inc, Version 8.0) GLM program to explore the correlation between molecular markers and carcass oblique length. The model used was:
[0083] Y ij =μ+G i +ε ij
[0084] Where Y ij G is the measured value of the carcass oblique length; μ is the population mean; G i The effect of genotype; ε ij This is a random residual effect.
[0085] Statistical analysis showed that genotype had a significant effect on carcass oblique length (p<0.05) (Table 2).
[0086] Table 2 Association analysis between different SNP genotypes of the WEE1 gene and carcass oblique length
[0087]
[0088] Note: Different superscripts indicate significant differences (p<0.05).
Claims
1. A WEE1 gene molecular marker associated with loin eye area in swine carcass, characterized in that, The WEE1 The genetic molecular marker is WEE1 The nucleotide sequence shown as SEQ ID NO. 1 is formed by a single nucleotide mutation at the 616th base of the gene; the single nucleotide mutation polymorphism is T / G polymorphism.
2. The WEE1 gene molecular marker according to claim 1, characterized in that, The T / G polymorphism mentioned above affects the meat yield of pigs.
3. The WEE1 gene molecular marker according to claim 1 or 2, characterized in that, The T / G polymorphism refers to the T to G mutation; among them, individuals with the TT genotype have a longer carcass oblique length than individuals with the GG genotype.
4. The use of the WEE1 gene molecular marker according to claim 1, characterized in that, The WEE1 The genetic molecular markers are used for selecting / assisting in selecting pig breeds or lines related to the loins oblique length trait of Longmin black pig, Min pig or Large White pig.
5. The use of the WEE1 gene molecular marker according to claim 4, characterized in that, The pig breed or line selected / assisted selected for the lean carcass traits is selected by selecting for the genotype of the -616 site in the promoter region of the gene as TT WEE1 Pigs having the genotype of TT at the -616 site in the promoter region of the gene are targeted for breeding as Longmin Black pigs, Min pigs or Large White pigs.
6. The use of the WEE1 gene molecular marker according to claim 5, characterized in that, The selection WEE1 Pigs with the genotype TT at position -616 in the promoter region of the gene were selected in the following manner: Step 1: Obtain the genomic DNA of the pig to be tested; Step 2: Using genomic DNA as a template, perform PCR amplification using WEE1_F1 and WEE1_R1 primers to obtain samples containing SNP sites. WEE1 The promoter region of a gene; WEE1_F1 primers: 5′-AGAGCGGTGTGGCAGTTTA-3′; WEE1_R1 primers: 5′-GGCGAAGGACCGGAGAAT-3′; Step 3: For those containing SNP sites WEE1 After agarose gel electrophoresis and sequencing analysis of the promoter region of the gene, pigs with the TT genotype containing the -616 site in the WEE1 gene promoter region were selected.
7. A primer pair for identifying the WEE1 gene molecular marker of claim 1, wherein the primer pair comprises: a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO:
2. The primer pair described above: WEE1_F1 primers: 5′-AGAGCGGTGTGGCAGTTTA-3′; WEE1_R1 primer: 5′-GGCGAAGGACCGGAGAAT-3′.
8. A kit for identifying the WEE1 gene molecular marker of claim 1, characterized in that, The kit comprises the primer pair as described in claim 7.