A SNP marker related to multiple lambing traits of muwang sheep, a detection primer set, a detection method and application thereof

By screening SNP markers through whole-genome resequencing and association analysis, and designing detection primers and kits, the problem of lambing trait differences in Dolan ewes was solved, resulting in a significant increase in the number of lambs born and improved breeding performance.

CN119082320BActive Publication Date: 2025-11-21XINJIANG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411461067.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-18
Publication Date
2025-11-21
Estimated Expiration
2044-10-18

AI Technical Summary

Technical Problem

How to predict lambing traits in Dolan ewes in advance so as to effectively select Dolan ewes for breeding and solve the problem of significant differences in lambing traits among different ewes in existing technologies.

Method used

By using whole-genome resequencing and genome-wide association analysis, a SNP marker located at position 1455095 on sheep chromosome 21 was screened out. Specific primers for SNP marker detection were designed, and their reliability was verified using first-generation sequencing. Finally, the genotype affecting the number of lambs born in Dolan sheep was determined to be AA, and a kit for detection was developed.

Benefits of technology

It significantly increased the number of lambs born in Dolan sheep. By selecting individuals with the AA genotype, it achieved efficient screening and breeding, thereby enhancing the reproductive capacity of Dolan sheep.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application discloses a SNP marker related to lambing traits of Duolang sheep, a detection primer group, a detection method and application thereof, relates to the field of molecular breeding, and the SNP marker of the application is located on the upstream of an OPRK1 gene, the SNP marker is located at the 1455095th position of the 21st chromosome of sheep, the original base is C, and the variation base is A; the nucleotide sequence of the SNP marker is SEQ, and the number of lambs of an AA genotype individual at the SNP site is significantly higher than that of a CC genotype individual. The nucleotide sequences of the primers are SEQ1 and SEQ2. The above SNP marker and primer are applied to detection of the number of lambs of Duolang sheep, and how the lambing traits of Duolang sheep are determined by detecting the genotypes of the SNP marker. The above SNP, primer and detection method can be used for breeding of reproductive traits of Duolang sheep.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular breeding technology, and in particular to a method for detecting specific SNP markers and the lambing number trait in Dolan sheep, and its application. Background Technology

[0002] The Dolan sheep is a superior dual-purpose (meat and fat) sheep breed from Xinjiang Uygur Autonomous Region. It belongs to the genus *Ovis* of the family Clavaceae in the order Artiodactyla. Because its central production area is in Maigati County, it is also known as the Maigati sheep. Dolan sheep are large, produce a lot of meat, and have tender meat. Their wool contains a lot of down and is of good quality. They have a high reproductive rate and are precocious, making them an ideal breed for lamb production.

[0003] Dolan sheep have a high reproductive capacity and reach sexual maturity early. Male lambs generally reach sexual maturity at 6-7 months of age, while female lambs are first mated at 6-8 months of age. Most ewes have already given birth by one year old. The estrous cycle of ewes is generally 15-18 days, with the average duration of estrus being 24-48 hours. The gestation period is 150 days. They typically produce three litters every two years, but those in good condition can produce two litters per year. The twinning rate is high, reaching up to 33%, and some ewes even produce triplets or quadruplets in a single litter. A single ewe can produce up to 15 lambs in its lifetime.

[0004] However, there are significant differences in lambing traits among different Dolan ewes. Therefore, how to predict the lambing traits of Dolan ewes in advance and effectively select Dolan ewes for breeding remains a technical problem that herders urgently need to solve. Summary of the Invention

[0005] In view of this, embodiments of the present invention provide an SNP marker related to lambing traits in Dolan sheep, a set of detection primers, a detection method, and applications.

[0006] To achieve the above objectives, the present invention mainly provides the following technical solutions:

[0007] On one hand, embodiments of the present invention provide an SNP marker related to lambing traits in Dolan sheep, along with its detection primer set, detection method, and application. The SNP marker is located at position 1455095 on sheep chromosome 21, with the original base being C and the variant base being A. The nucleotide sequence containing the SNP marker is SEQ.

[0008] Preferably, the number of lambs born to individuals with the AA genotype at the SNP locus is significantly higher than that of individuals with the CC genotype.

[0009] On the other hand, embodiments of the present invention provide a primer for detecting the above-mentioned SNP marker, wherein the nucleotide sequence of the primer is SEQ.

[0010] In another aspect, embodiments of the present invention provide a kit for detecting the above-mentioned SNP markers, the kit containing the above-mentioned primers.

[0011] On another front, embodiments of the present invention provide the application of the above-mentioned SNP markers, primers, or kits in the breeding of Dolan sheep.

[0012] In another aspect, embodiments of the present invention provide a method for detecting the lambing number trait in Dolan sheep, the method comprising: determining the lambing number trait of the sheep by detecting the above-mentioned SNP markers in the genes of the sheep to be tested.

[0013] Compared with the prior art, the beneficial effects of the present invention are:

[0014] This invention uses genome-wide association analysis (GWIA) based on whole-genome resequencing to screen for the aforementioned specific SNP loci. The reliability of these loci is verified through first-generation sequencing. Further, association analysis with litter size is used to determine the genotype of individuals with high litter size. Significance testing is then performed to determine whether the SNP locus significantly affects the litter size of Dolan sheep. Finally, SNP markers affecting the litter size of Dolan sheep are identified and screened. The genotypes identified in this invention are CC, CA, and AA. Individuals with the AA genotype are selected for selective breeding to increase the litter size of Dolan sheep. Attached Figure Description

[0015] Figure 1 The Manhattan diagrams calculated by two software programs in the embodiments of this invention are as follows: PLINK software for autosomes (A) and X chromosome (B); GCTA software for autosomes (C) and X chromosome (D); and SAIGE software for autosomes (E) and X chromosome (F). G shows information on 18 significant or suggestive loci, with different colors representing the proportion of different genotypes within the group. The gene annotation is above each locus, and the right side, from top to bottom, shows the physical location, the P-value of GWAS, the P-value of the additive effect at a single locus, and the P-value of the heterozygous effect at a single locus.

[0016] Figure 2 The Manhattan diagrams for the overdominant effect in the method of this invention are as follows: A, Manhattan diagram calculated by Plink software; B, Manhattan diagram calculated by GCTA software; C, Manhattan diagram calculated by SAIGE software; D, information on 27 significant or suggestive loci, with different colors representing the proportion of different genotypes within the group. The gene annotation is above each locus, and the physical location, GWAS p-value, and p-value of heterozygote effect at a single locus are displayed from top to bottom on the right.

[0017] Figure 3 This is a diagram of genomic DNA extraction in the method of this embodiment of the invention;

[0018] Figure 4 This is a PCR amplification diagram from the method described in this embodiment of the invention;

[0019] Figure 5 This is the genotype map of this locus determined by first-generation sequencing of 120 sheep in the method of this embodiment of the invention. Detailed Implementation

[0020] To further illustrate the technical means and effects adopted by the present invention to achieve the intended purpose, the following preferred embodiments are provided to describe in detail the specific implementation methods, technical solutions, features, and effects according to the present invention. Specific features, structures, or characteristics in the various embodiments described below can be combined in any suitable form.

[0021] Example 1

[0022] (1) Genome-wide association analysis of reproductive traits in Dolan sheep

[0023] Based on the whole genome sequence (10X) variation data of 151 twin-lambing sheep and 151 single-lambing sheep, and using the first five principal components as fixed effects, additive effect GWAS analysis of case-control was performed using Plink, SAIGE, and GCTA software. Significant or suggestive signals were found at 18 gene loci (P < 1 × 10⁻⁶). Figure 1 AF). Further single-locus chi-square tests revealed significant differences in these 18 gene loci between the odd-to-twin groups (P<0.05). We further used the chi-square test to examine the differences between heterozygotes and homozygotes in the odd-to-twin groups, and found significant differences at 16 loci (P<0.05). Figure 1 G).

[0024] Based on the additive effect GWAS analysis, significant differences were found between groups in the presence of heterozygotes at significant or suggestive loci. We further performed a GWAS analysis for the heterozygous effect (i.e., overdominance effect), finding significant or suggestive signals at 27 gene loci (P < 1 × 10⁻⁶). Figure 2 AC). Further chi-square test revealed that the effects of these 27 gene loci were significant (P<0.001). Figure 2 D). Association analysis revealed a strong association between the SNP at position 1455095 on chromosome 21 of sheep and the number of lambs born. To further verify whether this locus has false positives and whether the mutation affects the number of lambs born, this study selected an additional 120 sheep for a verification experiment.

[0025] (2) Extraction and detection of genomic DNA

[0026] DNA was extracted from blood samples of 120 sheep using the phenol-chloroform extraction method. The quality of the DNA was assessed by 1% agarose gel electrophoresis. Samples meeting the requirements were stored at -20°C for later use. Genomic DNA was detected by 1% agarose gel electrophoresis, and the results showed that the genomic DNA bands were clear and bright. Figure 3 This indicates that the extracted genomic DNA has high purity and good quality, and can be used for subsequent experiments.

[0027] (3) Primer design and synthesis

[0028] Primers were designed using Prime 5 software and synthesized by Shanghai Sangon Biotech Co., Ltd. The primer sequences are as follows: The nucleotide sequence containing the SNP marker is SEQ:

[0029] TTGGAGTTCCAGCTTCAGCATCAGTCCTTCCAATGAATATTCAGGCCTCACTAAACAGTCCATGGAATTCTCTAGGCCAGAATACTGGAGTGGGTAGCCTTTTCCTTCCAGGGGATCTTCCGAACCCAGGAATCGAACCCAGGTCTCCCACATTGCAGG[C / A]AGATTCTTT ACCACATGAGCCACAAGGGAAGCCCAGGAGCCAGTTTTAGGCTCTATGTCACCTATGAAAACATTTACAGTCTGCACAACCGGATTCTATTTTGTCTTTGGTCAGCCTTTTCTATTCTGATTTAAAGCTCCTTGGTCCTGTTTTATCATGCTTATTTGTGCCCTGTCACGATACTG

[0030] The above ([C / A]) in the SEQ sequence are mutant bases.

[0031] SEQ1, upstream primer: 5'-TTGGAGTTCCAGCTTCAGCATCAGTCCT-3'

[0032] SEQ2, downstream primer: 5'-CAGTATCGTGACAGGGCACAAATAAGCATG-3'

[0033] The annealing temperature is 55℃.

[0034] (4) PCR amplification reaction

[0035] The PCR amplification reaction system and reaction procedure are shown in Table 1 and Table 2.

[0036] Table 1. PCR reaction system (total volume: 20 μL)

[0037]

[0038] Table 2 PCR amplification reaction procedure

[0039]

[0040] (5) Detection of PCR amplification products

[0041] Agarose gel electrophoresis can be used to detect whether the label has specific bands. PCR amplification products were detected using 1.5% agarose gel electrophoresis. The results showed that the bands were clear and bright, indicating good quality and meeting the requirements. Figure 4 ).

[0042] (6) Sequencing of PCR products

[0043] The PCR amplification products were sent to Shanghai Sangon Biotech for first-generation sequencing. The sequencing results revealed a mutation at site C to site A (results are shown below). Figure 5 (As shown).

[0044] (7) Association analysis and application

[0045] Based on the number of lambs born in 120 sheep, SPSS 23.0 software was used to perform a significance test on the genotypes (CC, CA, AA) generated by the detected SNP sites and the number of lambs born in Dolan sheep. The results are shown in Table 3.

[0046] Table 3 Comparison of litter size among individuals with different genotypes

[0047]

[0048] Note: Mean±SD represents the mean ± standard deviation: data in the same column with different capital letters on the superscript indicate extremely significant differences (P<0.01).

[0049] As shown in Table 3, this SNP locus is closely related to the number of lambs born in Dolan sheep, with the average number of lambs born to individuals with the AA genotype being significantly higher than that of individuals with the CC genotype. In practical production applications, the number of lambs born in Dolan sheep can be increased by selecting individuals with the AA genotype, thus accelerating the breeding of multi-lambing sheep breeds in Xinjiang Uygur Autonomous Region.

[0050] The present invention identified the above-mentioned SNP molecular marker by means of the method in Example 1. The specific location is C>A (base C is mutated to base A) at Chr21:g.1455095. Among them, the number of lambs born to individuals with genotype AA is significantly higher than that of individuals with genotype CC. The present invention found that the above-mentioned SNP molecular marker can be used to identify and screen sheep breeds with relatively high lambing numbers.

[0051] This invention uses the aforementioned SNP markers to identify the lambing number trait, and also develops primers for detecting the aforementioned SNP markers, including a forward primer (SEQ1) and a reverse primer (SEQ2):

[0052] Upstream primer: 5'-TTGGAGTTCCAGCTTCAGCATCAGTCCT-3'

[0053] Downstream primer: 5'-CAGTATCGTGACAGGGCACAAATAAGCATG-3'

[0054] The present invention can prepare a kit for detecting lambing number traits based on the above SNP markers.

[0055] The SNP markers, primers, and kits described above in this invention can all be applied to the detection of lambing count traits or to the breeding of Dolan sheep.

[0056] The present invention can use the above-mentioned SNP markers, primers or kits to detect lambing traits in Dolan sheep, and screen out individuals with genotype AA as multi-product breeds, which can then be applied to Dolan sheep breeding.

[0057] Any aspects not covered in the embodiments of this invention can be selected from the prior art by those skilled in the art.

[0058] The above descriptions are merely specific embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the above claims.

Claims

1. The application of a SNP marker associated with lambing traits in Dolan sheep in the breeding of Dolan sheep, wherein the nucleotide sequence of the SNP marker is shown in SEQ ID No. 3, the original base at position 162 of SEQ ID No. 3 is C, the variant base is A, and individuals with genotype AA in the SNP marker are selected to breed a Dolan sheep breed with a high number of lambs.

2. A method for detecting the lambing count trait in Dolan sheep, characterized in that, The method includes: determining the genotype of the sheep by detecting SNP markers in the genes of the sheep to be tested; wherein the SNP marker is the SNP marker described in claim 1.

3. The method for detecting the lambing number trait in Dolan sheep as described in claim 2, characterized in that, Among the SNP marker genotypes, the number of lambs born to individuals with the AA genotype was significantly higher than that of individuals with the CC genotype.

Citation Information

Patent Citations

  • COIL gene specific SNP (single nucleotide polymorphism) marker, method for detecting prolificacy of Hetian Qiaoda red sheep and application of COIL gene specific SNP marker

    CN109811061A

  • SNP marker for increasing lambing number of sheep, detection method and application thereof

    CN113025723A