Molecular Marker Site1888 Closely Linked to the Yellowing Trait of Melon Leaves and Its Application

Abstract

The molecular marker Site1888 closely linked to the yellowing trait of melon leaves and its application belong to the field of plant molecular genetic breeding research. The molecular marker is used to detect the yellowing trait of melon leaves in several natural melon populations. Using the DNA of the material to be selected as a template, the primer of the molecular marker Site1888 is used for PCR amplification. The amplified product is subjected to polyacrylamide gel electrophoresis and combined with field trait analysis. The accuracy rate of the molecular marker for seedling stage identification is 100%. The molecular marker of the present invention has very important value in the production practice and breeding of melons. The operation method is simple, with high stability, fast and accurate, providing a new method for auxiliary selection in melon molecular breeding.

Description

Technical Field

[0001] The present invention belongs to the field of plant molecular genetic breeding research, and provides a molecular marker Site1888 closely linked to the yellowing leaf color trait of melon and its application. Background Art

[0002] Melon (Cucumis melo L.) is one of the important economic crops in the Cucurbitaceae family. It is widely loved by consumers for its unique color, aroma, and taste, and is widely cultivated both at home and abroad. Leaves are the main sites for plants to carry out photosynthesis, and the leaf color largely determines the total photosynthetic productivity of the plant. However, during the cultivation and breeding of melons, various variation phenomena often occur, among which the yellowing leaf color mutant is a relatively common mutation. The chlorophyll content of the yellowing leaf color mutant plant is low, and the photosynthetic rate decreases, causing dwarfing, yield reduction, lethality and other phenomena, which have a serious negative impact on crop growth and the yield of economic products. In melons, the yellowing leaf color mutant shows yellowing at the cotyledon stage, and the yellowing trait persists throughout the growth cycle. In addition, the plants of the yellowing mutant melons are dwarfed, weak, the fruits are small, the commercial quality is poor, the taste is not good, and the seed setting rate is low, which seriously affects the commercial properties of melons and directly leads to a decrease in the yield and economic value of melons for fruit farmers. The fruits of the yellowing leaf color mutant are yellow before maturity, and the young fruits expand slowly, and this appearance characteristic greatly reduces the commercial quality of the fruits. Therefore, timely predicting and eliminating the yellowing leaf color mutant of melons is beneficial to improving the product quality of melons. Analyzing the genetic basis and regulation mechanism of the formation and development of the yellowing leaf color mutant of melons provides a reference value for studying the yellowing leaf color mutant, and has important practical significance for accelerating the research on melon leaf color and the process of molecular breeding. Summary of the Invention

[0003] Based on the research in the background art part, the present invention provides a molecular marker Site1888 closely linked to the yellowing leaf color trait of melon and its application. Using the yellowing leaf color mutant melon variety ZT00091 as the female parent and the normal leaf color melon variety ZT249 as the male parent, a hybrid combination is configured to obtain F 1 , and the obtained F 1 is continuously self-crossed to obtain its F 2 , F 2:3 families, and the F 2 population is used for the preliminary mapping of the yellowing leaf color trait of melons, and the F 2:3 family is used for the fine mapping of candidate genes. According to the BSA (Bulk Segregating Analysis) sequencing results, the obtained 8.49 Mb is further finely mapped and the candidate interval is narrowed through the F 2:3 family, and molecular markers linked to the yellowing leaf color trait of melons with higher selection efficiency are selected, which can be directly used to identify whether the offspring of melon plants will have yellowing leaf color mutants.

[0004] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0005] A molecular marker Site1888 closely linked to the yellowing trait of melon leaf color, and the primer sequences of the molecular marker Site1888 are as follows:

[0006] Site1888F: TCCCATACCACAAACACACAA,

[0007] Site1888R: AACTTGTTCAGCCGGATTCA.

[0008] Application of the above-mentioned molecular marker Site1888 in identifying yellowing mutants in the offspring of melon plants at the seedling stage.

[0009] Furthermore, the application is: early prediction of the molecular marker in several natural populations of melons at the seedling stage, using the DNA of the material to be selected as a template, and performing PCR amplification on it with the primers of the molecular marker Site1888, and performing polyacrylamide gel electrophoresis on the amplification product and combining with field trait analysis.

[0010] Furthermore, the application is:

[0011] (1) Using the DNA of the material to be identified as a template, performing PCR amplification on it with the primers of the molecular marker Site1888; PCR product detection: the reaction product is electrophoresed on a 7% non-denaturing polyacrylamide gel and stained with silver nitrate;

[0012] (2) Marker primer identification: After PCR amplification of the DNA sample to be tested, it can be detected by electrophoresis. The 209bp specific band is the yellowing mutant variety, the 232bp and 209bp heterozygous bands are the intermediate varieties, and the 232bp band is the normal leaf color variety.

[0013] Furthermore, in step (1), the PCR amplification system is 10 μL: including 1 μL of Site1888F, 1 μL of Site1888R, 3 μL of Taq Master Mix, 1 μL of DNA template, ddH 2 O 4 μL.

[0014] Furthermore, in step (1), the PCR amplification program: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, (denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s repeated 35 cycles), extension at 72°C for 10 min, and preservation at 4°C.

[0015] The beneficial effects of the present invention compared with the prior art are:

[0016] 1. InDel (Insertion - deletion) molecular markers are markers based on sequences on both sides of insertion / deletion sites to design specific primers for PCR amplification. Its essence still belongs to length polymorphism markers and can be typed using polyacrylamide gel electrophoresis. According to the BSA sequencing technology, the present invention compares the melon genome data and designs and develops InDel markers linked to the yellowing leaf color trait of melons. Through the method of InDel molecular marker - assisted breeding, the probability of the appearance of yellowing leaf color mutants in the offspring of melon plants can be identified at the seedling stage of melons. By using this molecular marker, the input of manpower and material resources is greatly reduced, the breeding cost is lowered, and the breeding period is shortened.

[0017] 2. By using the specific primer pair provided by the present invention to detect the genomic DNA of the melon to be tested by PCR method and amplify the InDel molecular marker Site1888, the gene amplification product of the yellowing leaf color mutant material of melons is 209bp, and the gene amplification product of the normal leaf color trait material of melons is 232bp. Through this molecular marker, breeders can more effectively predict and screen melon plants with the genetic characteristics of yellowing leaf color of melons, greatly improving the breeding efficiency of melons.

[0018] 3. The molecular marker of the present invention has important value in the production practice and breeding of melons.

[0019] 4. The operation method of the present invention is simple and has strong stability, providing a new method for melon molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a fine - mapping diagram of the yellowing leaf color trait of melons;

[0021] Figure 2 It is an electrophoresis detection diagram of the melon Site1888 marker in 24 natural populations. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0022] The technical solutions of the present invention will be further described below in conjunction with the drawings and embodiments, but are not limited thereto. Any modification or equivalent replacement of the technical solutions of the present invention without departing from the spirit scope of the technical solutions of the present invention shall be covered within the protection scope of the present invention.

[0023] The present invention studies the genetic mechanism and gene mapping of the yellowing leaf color mutant trait of melons. Using the yellowing leaf color mutant melon variety ZT00091 as the female parent and the normal leaf color melon variety ZT249 as the male parent, a hybrid combination is prepared to construct an F 2 segregating population and an F 2:3 pedigree, and using F 2The segregating population was used to preliminarily map the gene of the melon leaf yellowing mutant, and the F 2:3 family was used for further fine mapping to determine the candidate region controlling the yellow leaf color, and molecular markers tightly linked to the melon leaf yellowing mutation were designed.

[0024] Specific Embodiment 1: A molecular marker Site1888 tightly linked to the melon leaf yellowing mutation described in this embodiment has the following primer sequences:

[0025] Site1888F: AACTTGTTCAGCCGGATTCA,

[0026] Site1888R: GGAATTTTTGACCAAAGGCA.

[0027] The method for obtaining the above molecular marker Site1888 is as follows:

[0028] 1. Construction of the melon genetic population

[0029] Using the melon variety ZT00091 with yellowing mutant leaves as the female parent and the melon variety ZT249 with normal leaf color as the male parent, the hybrid combination "ZT00091×ZT249" was configured to obtain the F 1 population. The F 1 was self-crossed to obtain the F 2 segregating population. The obtained F 2 segregating population was self-crossed to obtain the F 2:3 family. Hybridization of the male and female parents can obtain numerous F 1 individual plants. The genotypes and phenotypes of these individual plants are the same. Random selection of F 1 individual plants is acceptable. Self-crossing obtains F 2 , and F 2 is randomly selected for self-crossing to obtain F 2:3 family;

[0030] In 2022, ZT00091 (20 plants), ZT249 (20 plants), F 1 individual plants (20 plants), and the F 2 segregating population (193 plants) were planted in the space breeding base of Heilongjiang Bayi Agricultural University. In 2023, the F 2:3 family (a total of 320 families, 10 plants per family) was planted in the space breeding base in Datong. The above melon materials were all planted in a greenhouse, and the cultivation method was conventional water and fertilizer management with individual plant pollination.

[0031] 2. Extraction of genomic DNA and construction of gene pools

[0032] The CTAB method was used to extract the genomic DNA of 320 F 2:3 families.

[0033] 3. InDel Molecular Marker Screening

[0034] By performing high-throughput sequencing on the yellow-leaf mutant melon variety ZT00091 and the normal-leaf melon variety ZT249 as the male parent, the genomic sequence information of the two parents was obtained. The differential sites between the two parents were analyzed and compared. Using the BSA method, molecular markers closely linked to the yellow-leaf mutant of melon were obtained. A total of 30 pairs of molecular markers were designed and developed. PCR amplification and polymorphism screening were carried out between the gene pool of the yellow-leaf mutant melon and the gene pool of the normal-leaf melon variety. A total of 8 pairs of primers were screened. As Figure 1 shown, according to the molecular markers linked to the traits of the yellow-leaf mutant of melon, it was found that Site1888 was closely linked to the traits of the yellow-leaf mutant of melon.

[0035] Specific Embodiment 2: This embodiment provides a method for the molecular marker Site1888 linked to the traits of the yellow-leaf mutant of melon. The specific steps are as follows:

[0036] (1) Extract the DNA of the sample to be tested and perform PCR amplification using the molecular marker Site1888. The 10 μL PCR reaction system is as follows: 1 μL of 50 - 100 ng / μL DNA, 1 μL each of the upstream and downstream primers of Site1888, 3 μL of Taq enzyme Mix, and 4 μL of ddH 2 O. The PCR amplification conditions are as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s. Steps 2 to 4 are repeated for 35 cycles, extension at 72°C for 10 min, and storage at 4°C.

[0037] (2) After the DNA sample to be tested undergoes PCR amplification, if an electrophoretic method can detect a 209 bp fragment, it is a yellow-leaf mutant melon material, while if the fragment size is 232 bp, it is a normal-leaf melon material. As Figure 2 shown, M is the DNA2000Maker, 1 band represents the female parent, the yellow-leaf mutant melon ZT00091; 2 bands represent the male parent, the normal-leaf melon ZT249; 3 bands are the F 1 hybrid band, and the phenotype is normal leaf color; 4 - 11 are varieties with the same band as ZT00091, yellow-leaf type; 12 - 19 are varieties with the same band as ZT249, normal-leaf varieties; 20 - 27 are intermediate-band varieties, and the yellow-leaf phenotype can be separated in the offspring. The accuracy rate of identifying the yellow-leaf trait of melon is 100%. Therefore, by amplifying the closely linked markers, different genotypes of the trait locus of the yellow-leaf mutant of melon can be accurately distinguished, achieving the purpose of assisting breeding.

Claims

1. The application of primers of molecular marker Site1888 in identifying the yellowing trait of leaf color of melon plants at the seedling stage is characterized by: The primer sequence of the molecular marker Site1888 is: Site1888F:AACTTGTTCAGCCGGATTCA; Site1888R: GGAATTTTTGACCAAAGGCA.

2. The use of the primers of the molecular marker Site1888 according to claim 1 in identifying the yellowing trait of leaf color of melon plants at the seedling stage, characterized in that: The application is: using the molecular marker Site1888 for early prediction in the seedling stage of several natural melon populations, using the DNA of the selected material as a template and the primers of the molecular marker Site1888 for PCR amplification, subjecting the amplified product to polyacrylamide gel electrophoresis and combining it with field trait analysis.

3. The use of the primers of the molecular marker Site1888 according to claim 2 in identifying the yellowing trait of leaf color of melon plants at the seedling stage, characterized in that: The application is: (1) Using the DNA of the material to be identified as a template, PCR amplification is performed using the primers of the molecular marker Site1888; PCR product detection: The reaction products were electrophoresed on 7% non-denaturing polyacrylamide gel and stained with silver nitrate; (2) Identification of labeled primers: After PCR amplification, the DNA sample can be detected by electrophoresis. The 209bp specific band is a mutant variety with yellow leaf color, the 232bp and 209bp hybrid bands are intermediate varieties, and the 232bp band is a variety with normal leaf color.

4. The use of the primers of the molecular marker Site1888 according to claim 3 in identifying the yellowing trait of leaf color of melon plants at the seedling stage, characterized in that: In step (1), the PCR amplification system is 10 μL: Site1888F 1 μL, Site1888R 1 μL, TaqMaster Mix 3 μL, DNA template 1 μL, ddH2O 4 μL.

5. The use of the primers of the molecular marker Site1888 according to claim 3 in identifying the yellowing trait of leaf color of melon plants at the seedling stage, characterized in that: In step (1), the PCR amplification program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, steps 2 to 4 were repeated for 35 cycles, extension at 72°C for 10 min, and storage at 4°C.

Images