Combination of oligonucleotides for modulating RTEL1 and FUBP1

Abstract

The present invention relates to a combination of a telomere extension helicase 1 regulatory factor (RTEL1) and a distal upstream element binding protein 1 (FUBP1) inhibitor, such as an oligonucleotide (oligomer), which are complementary to RTEL1 or FUBP1, respectively, causing modulation of the expression of RTEL1 and FUBP1 or modulation of the activity of RTEL1 and FUBP1. The present invention relates in particular to a combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use in the treatment and / or prophylaxis of a disease, preferably hepatitis B virus (HBV) infection, in particular chronic HBV infection. In particular, the present invention relates to the use of a combination of RTEL1 and FUBP1 inhibitors for destabilizing cccDNA, such as HBV cccDNA. The invention also comprises a pharmaceutical composition, a kit and application thereof in treatment and / or prevention of HBV infection.

Description

Technical Field

[0001] The present invention relates to a combination of the following items: a telomere extension helicase 1 regulatory factor (RTEL1) and a distal upstream element binding protein 1 (FUBP1) inhibitor, such as an oligonucleotide (oligomer), which is complementary to RTEL1 or FUBP1, respectively, causing regulation of the expression of RTEL1 and FUBP1 or regulation of the activity of RTEL1 and FUBP1. The present invention particularly relates to a combination of an inhibitor of RTEL1 and an inhibitor of FUBP1, which is used for use in the treatment and / or prevention of a disease, preferably hepatitis B virus (HBV) infection, in particular chronic HBV infection. The present invention particularly relates to the use of a combination of RTEL1 and FUBP1 inhibitors for destabilizing cccDNA, such as HBV cccDNA. The present invention also includes a pharmaceutical composition, a kit and its use in the treatment and / or prevention of HBV infection. Background Art

[0002] Hepatitis B is an infectious disease caused by the hepatitis B virus (HBV), a small, hepatotropic virus that replicates through reverse transcription. Chronic HBV infection is a key factor in the development of severe liver diseases such as cirrhosis and hepatocellular carcinoma. Current treatments for chronic HBV infection are based on the administration of pegylated type 1 interferons or nucleoside (nucleotide) analogs, such as lamivudine, adefovir, entecavir, tenofovir disoproxil fumarate, and tenofovir alafenamide, which target the viral polymerase (a multifunctional reverse transcriptase). Treatment success is typically measured by the loss of hepatitis B surface antigen (HBsAg). However, since HBV DNA persists in the body after infection, complete elimination of HBsAg is difficult. HBV persistence is mediated by the episomal form of the HBV genome, which is stably present in the cell nucleus. This episomal form is known as "covalently closed circular DNA" (cccDNA). cccDNA serves as a template for all HBV transcripts, including pregenomic RNA (pgRNA, a viral replication intermediate). The presence of a small number of cccDNA copies may be sufficient to trigger a full-blown HBV infection again. Current treatments for HBV do not target cccDNA. However, cure of chronic HBV infection requires elimination of cccDNA (reviewed by Nassal, Gut. 2015 Dec;64(12):1972-84. doi:10.1136 / gutjnl-2015-309809).

[0003] Regulator of telomere elongation helicase 1 (RTEL1) encodes a DNA helicase that plays a role in telomere stability, protection, and extension and interacts with proteins in the shelterin complex, which is known to protect telomeres during DNA replication. Mutations in this gene are associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome (see, for example, Vannier et al., 2014 Trends Cell Biol. Vol. 24, p. 416).

[0004] RTEL1 is located in the nucleus and acts as an ATP-dependent DNA helicase involved in telomere length regulation, DNA repair, and genomic stability maintenance. RTEL1 acts as an anti-recombinase, counteracting toxic recombination and limiting crossovers during meiosis. It also regulates meiotic recombination and crossover homeostasis by physically dissociating strand invasion events, thereby promoting non-crossover repair through meiotic synthesis-dependent strand annealing (SDSA) and decomposing D-loop recombination intermediates. Furthermore, RTEL1 deconstructs T-loops and prevents telomere fragility by counteracting telomeric G4-DNA structures, collectively ensuring telomere dynamics and stability.

[0005] RTEL1 has been identified as a stabilizer of the HPV episome in siRNA screening: (Edwards et al., 2013PLoSOne Vol. 8, e75406). siRNA targeting RTEL1 has also been used to identify interactors with RTEL1 in Hoyer-Heridas syndrome (Schertzer et al., 2015Nucleic Acids Res Vol. 43 p. 1834). In addition, RTEL1 has been identified as an HIV host dependency factor from siRNA screening of essential host proteins to provide a target for inhibiting HIV infection (WO 2007 / 094818).

[0006] WO2020011902A1 relates to an RTEL1 inhibitor for use in the treatment of HBV infection, particularly chronic HBV infection.

[0007] Distal upstream element binding protein 1 (FUBP1 or FBP1) is a single-stranded DNA-binding protein that binds to multiple DNA elements. This protein is also thought to bind RNA and contains 3'-5' helicase activity, with in vitro activity on DNA-DNA and RNA-RNA duplexes. FUBP1 is known to activate transcription of the proto-oncogene c-myc by binding to the distal upstream element (FUSE), located upstream of c-myc in undifferentiated cells. This protein is primarily present in the cell nucleus. Upregulation of FUBP1 has been observed in many types of cancer. Furthermore, FUBP1 can bind to RNA from hepatitis C virus and enterovirus and mediate their replication (Zhang and Chen 2013 Oncogene, Vol. 32, pp. 2907-2916).

[0008] FUBP1 has also been identified in hepatocellular carcinoma (HCC), where it is thought to be involved in HCC tumorigenesis (Ramdzan et al. 2008 Proteomics Vol. 8 pp. 5086-5096), and is required for HCC tumor growth as shown using lentivirally expressed shRNA targeting FUBP1 (Rabenhorst et al. 2009 Hepatology Vol. 50 pp. 1121-1129).

[0009] It has been demonstrated that knockdown of FUBP1 by lentiviral-expressed shRNA can enhance the therapeutic response of ovarian cancer (Zhang et al. 2017 Oncology Letters Vol. 14 pp. 5819-5824).

[0010] WO 2004 / 027061 discloses a screening method comprising the step of analyzing whether a test substance inhibits FBP and a pharmaceutical composition for treating a proliferative disease, which contains a substance that inhibits FBP as an active ingredient.

[0011] Several small molecules that inhibit FUBP1 have been identified, all with the goal of treating cancer (Huth et al. 2004 J Med. Chen vol. 47 pp. 4851-4857; Hauck et al. 2016 Bioorganic & Medicinal Chemistry vol. 24 pp. 5717-5729; Hosseini et al. 2017 Biochemical Pharmacology vol. 146 pp. 53-62; and Xiong et al. 2016 Int J Onc vol. 49 pp. 623). WO 2004 / 017940 describes lipid-based formulations of SN-38 that are claimed to treat viral infections, particularly HIV, but there are no examples to support this.

[0012] Poly(U)-binding splicing factor 60 (PUF60) is a potential regulator of both transcriptional and posttranscriptional steps in HBV pre-genome expression. PUF60 is known to form a complex with FUBP1, which is associated with c-myc repression. However, FUBP1 is not involved in PUF60-dependent regulation of HBV pre-genome expression (Sun et al. 2017 Scientific Reports 7:12874).

[0013] HBV infection remains a major health problem worldwide, affecting an estimated 350 million chronic carriers. Approximately 25% of carriers will die from chronic hepatitis, cirrhosis, or liver cancer. Hepatitis B virus is the second-leading carcinogen after tobacco, causing 60% to 80% of all primary liver cancers. HBV is 100 times more contagious than HIV.

[0014] WO2019 / 193165A1 relates to FUBP1 inhibitors for use in the treatment of HBV infection.

[0015] Purpose of the Invention Summary of the Invention

[0016] The present invention relates to a combination of an inhibitor of RTEL1 and an inhibitor of FUBP1, such as a composition or pharmaceutical composition comprising the inhibitor of RTEL1 and the inhibitor of FUBP1. The inhibitor of RTEL1 is capable of inhibiting the expression and / or activity of RTEL1; and the inhibitor of FUBP1 is capable of inhibiting the expression and / or activity of FUBP1. Suitably, the inhibitor of RTEL1 is capable of inhibiting the expression of RTEL1 nucleic acid. Suitably, the inhibitor of FUBP1 is capable of inhibiting the expression of FUBP1 nucleic acid. The present invention further relates to such a combination, composition or pharmaceutical composition for use in treating or preventing a disease.

[0017] The present invention also relates to a kit comprising an inhibitor of RTEL1 and an inhibitor of FUBP1. The inhibitor of RTEL1 is capable of inhibiting the expression and / or activity of RTEL1; and the inhibitor of FUBP1 is capable of inhibiting the expression and / or activity of FUBP1. Suitably, the inhibitor of RTEL1 is capable of inhibiting the expression of RTEL1 nucleic acid. Suitably, the inhibitor of FUBP1 is capable of inhibiting the expression of FUBP1 nucleic acid. The present invention further relates to such a kit for use in treating or preventing a disease.

[0018] The present invention also relates to a method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of an inhibitor of RTEL1 to a subject suffering from or susceptible to the disease, wherein the method further comprises administering an effective amount of an inhibitor of FUBP1.

[0019] The present invention also relates to a method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of a FUBP1 inhibitor to a subject suffering from or susceptible to the disease, wherein the method further comprises administering an effective amount of an RTEL1 inhibitor.

[0020] The present invention also relates to a method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of a combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 to a subject suffering from or susceptible to the disease.

[0021] The present invention also relates to the use of the FUBP1 inhibitor and the RTEL1 inhibitor for preparing a medicament for treating or preventing hepatitis B virus (HBV) and / or cancer.

[0022] The present invention provides an in vivo or in vitro method for regulating the expression of RTEL1 and FUBP1 in target cells expressing RTEL1 and FUBP1, the method comprising administering an effective amount of an inhibitor of FUBP1 and an inhibitor of RTEL1 to the cells.

[0023] In certain embodiments, the disease is hepatitis B virus (HBV) infection and / or cancer.

[0024] In certain embodiments, the disease is chronic hepatitis B virus (HBV) infection.

[0025] The present inventors have surprisingly demonstrated that the combination of an RTEL1 inhibitor and a FUBP1 inhibitor provides synergistic inhibition of HBV.

[0026] Sequence Listing

[0027] The sequence listing submitted with this application is incorporated herein by reference. If the sequence listing is inconsistent with the present specification or drawings, the information disclosed in the present specification (including the drawings) shall be deemed correct. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Compound 243_1 (SEQ ID NO: 243) is conjugated to a trivalent GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0029] Figure 1A Residue A of compound 243_1 (SEQ ID NO: 243)

[0030] FIG2 Compound 244_1 (SEQ ID NO: 244) is conjugated to a trivalent GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0031] FIG2A Residue A of compound 244_1 (SEQ ID NO: 244)

[0032] Figure 3 Compound 245_1 (SEQ ID NO: 245) is conjugated to a trivalent GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0033] Figure 3A Residue A of compound 245_1 (SEQ ID NO: 245)

[0034] FIG4 Compound 246_1 (SEQ ID NO: 246) is conjugated to a trivalent GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0035] FIG4A Residue A of compound 246_1 (SEQ ID NO: 246)

[0036] Figure 5 shows exemplary GalNAc moieties. The compound in Figure 5L consists of a monomeric GalNAc phosphoramidite added to the oligonucleotide as part of the synthesis while still on the solid support, X is S or O, Y is S or O, and n=1 to 3 (see WO 2017 / 178656). Figures 5B and 5D are also referred to herein as GalNAc2 or GN2, without and with a C6 linker, respectively.

[0037] Figure 6 Figure 6A-L: shows an exemplary antisense oligonucleotide conjugate, wherein the oligonucleotide is represented by the term "A" as described above. The compound in Figure 6A-D includes a dilysine branched molecule, a PEG3 spacer and three terminal GalNAc carbohydrate moieties. In the compounds of Figure 6A (Figure 6A-1 and Figure 6A-2 show two different diastereomers of the same compound) and Figure 6B (Figure 6B-1 and Figure 6B-2 show two different diastereomers of the same compound), the oligonucleotide is directly connected to the asialoglycoprotein receptor targeting conjugate portion in the absence of an alkyl linker. In the compounds of Figure 6C (Figure 6C-1 and Figure 6C-2 show two different diastereomers of the same compound) and Figure 6D (Figure 6D-1 and Figure 6D-2 show two different diastereomers of the same compound), the oligonucleotide is connected to the asialoglycoprotein receptor targeting conjugate portion via a C6 linker. The compounds in Figures 6E-K contain commercially available triply branched molecules and spacers of varying lengths and structures, as well as three terminal GalNAc carbohydrate moieties. The compound in Figure 6L consists of a monomeric GalNAc phosphoramidite added to the oligonucleotide as part of the synthesis while still on the solid support, wherein X = S or O and independently Y = S or O and n = 1 to 3 (see WO 2017 / 178656).

[0038] Figure 7 : Oligonucleotides CMP ID No 243_1, 244_1, 245_1 and 246_1 were tested for their concentration-dependent potency and efficacy in the human cell line MDA-MB-231 in vitro.

[0039] Figure 8 Compound 325_1 (SEQ ID NO: 325) is conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0040] Figure 8A Residue A of compound 325_1 (SEQ ID NO: 325)

[0041] Figure 9 Compound 325_2 (SEQ ID NO: 325) is conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0042] Figure 9A Residue A of compound 325_2 (SEQ ID NO: 325)

[0043] Figure 10 Compound 326_1 (SEQ ID NO: 326) is conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0044] Figure 10A Residue A of compound 326_1 (SEQ ID NO: 326)

[0045] Figure 11 Compound 326_2 (SEQ ID NO: 326) is conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0046] Figure 11A Residue A of compound 326_2 (SEQ ID NO: 326)

[0047] Figure 12 Compound 326_3 (SEQ ID NO: 326) is conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0048] Figure 12A Residue of compound 326_3 (SEQ ID NO: 326)

[0049] Figure 13 Compound 326_4 (SEQ ID NO: 326) is conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0050] Figure 13A Residue A of compound 326_4 (SEQ ID NO: 326)

[0051] Figure 14 Compound 327_1 (SEQ ID NO: 327) is conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0052] Figure 14A Residue A of compound 327_1 (SEQ ID NO: 327)

[0053] Figure 15 Compound 328_1 (SEQ ID NO: 328) is conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0054] Figure 15A Residue A of compound 328_1 (SEQ ID NO: 328)

[0055] Figure 16 Compound 329_1 (SEQ ID NO: 329) is conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide

[0056] Figure 16A Residue A of compound 329_1 (SEQ ID NO: 329)

[0057] Figure 17 Figure 17 Shown are the results of in vitro efficacy analysis of anti-FUBP1 compounds in Hela cells.FUBP1 mRNA levels were normalized and shown as a percentage relative to control.

[0058] Figure 18Target Engagement: FUBP1 mRNA. As described in Example 2.3, four antisense oligonucleotide compounds have been tested in HBV-infected PHH cells. Each compound was delivered to the cells once a week at a concentration of 10 μM for three weeks. FUBP1 mRNA targeting KD was assessed one week after the last treatment. Total RNA was extracted from cells using the MagNAPure robot and the MagNA Pure 96 Cellular RNA High Capacity Kit according to the manufacturer's protocol, and FUBP1 mRNA was quantified by TaqMan qPCR. The figure shows the residual expression of the target mRNA compared to the negative control (NDC=1), with the oligonucleotides tested at 10 μM. The data were normalized to the human GUSB reference gene and the mean + SD of two biological replicates for each oligonucleotide tested are reported. The 50% and 20% FCs are highlighted in the figure. CMP ID NO:326_3 showed the best FUBP1 mRNA KD, with an 80% reduction in mRNA expression at 10 μM. Compared to the prior art oligos (CMP ID No: 276_1 and 291_1), CMP ID NO: 329_1 showed the strongest effect in reducing FUBP1 mRNA, as did the oligonucleotide with CMP ID NO: 326_3. Compared to NDC, they all reduced target mRNA expression by approximately 80% at 10 μM.

[0059] Figure 19 Southern blot analysis of intrahepatic HBV DNA reveals that cccDNA and total HBV DNA are reduced in the FUBP1 and RTEL1 LNA-treated arms, and further enhanced in the FUBP1 + RTEL1 combination arm. Southern blot analysis of total DNA extracts from PXB mouse livers was performed using an HBV-specific, full-genome-length probe for detection. DNA concentration was adjusted by NanoDrop, and 15 μg of DNA was loaded per lane. Red boxes indicate cccDNA bands.

[0060] Figure 20 Semi-quantification of intrahepatic cccDNA and total HBV DNA levels by qPCR.

[0061] Figure 21 Kinetics of baseline-corrected serum HBV DNA levels.

[0062] Figure 22 Baseline-corrected serum HBsAg kinetics

[0063] Figure 23 Baseline-corrected serum HBeAg kinetics

[0064] Figure 24Intrahepatic target engagement and efficacy of RTEL1 and FUBP1 LNA molecules assessed by RT-qPCR

[0065] Figure 25 In vitro reduction of intrahepatic HBV pRNA in HBV-infected PHH using a single FUBP1 ASO (GalNAc-326_3), a single RTEL1 ASO (GalNAc-245_1), two RTEL1 / FUBP1 dual ASOs (Gal-NAc-350_1 and Gal-NAc-351_1), a combination of FUBP1 ASO (GalNAc-326_3) + RTEL1 ASO (GalNAc-245_1), and a negative control (Ga-NAc-352_1) for reference.

[0066] Figure 26 In vitro reduction of intrahepatic HBV RNA in HBV-infected PHH using a single FUBP1 ASO (GalNAc-326_3), a single RTEL1 ASO (GalNAc-245_1), two RTEL1 / FUBP1 dual ASOs (Gal-NAc-350_1 and Gal-NAc-351_1), a combination of FUBP1 ASO (GalNAc-326_3) + RTEL1 ASO (GalNAc-245_1), and a negative control (Ga-NAc-352_1) for reference.

[0067] Figure 27 Dose response curves for RTEL1 gene expression and associated EC50 values ​​for CMP ID NOs 352_1 (control), 326_3(FUBP1), 245_1(RTEL1), 350_1(double), 351_1(double) and the conjugated version of 326_3(FUBP1)+245_1(RTEL1) administered alone (i.e. added as two separate ASOs).

[0068] Figure 28 Dose response curves for FUBP1 gene expression and associated EC50 values ​​for CMP ID NOs 352_1 (control), 326_3 (FUBP1), 245_1 (RTEL1), 350_1 (double), 351_1 (double) and the conjugated version of 326_3 (FUBP1) + 245_1 (RTEL1) administered alone (i.e. added as two separate ASOs).

[0069] definition

[0070] 2' sugar-modified nucleosides

[0071] A 2' sugar modified nucleoside is a nucleoside that has a substituent other than H or -OH at the 2' position (2' substituted nucleosides) or contains a 2' linked diradical capable of forming a bridge between the 2' carbon and the second carbon atom in the ribose ring, such as an LNA (2'-4' diradical bridged) nucleoside.

[0072] In fact, people have spent a lot of energy to develop 2' sugar substituted nucleosides, and found that many 2' substituted nucleosides have beneficial properties after being incorporated into oligonucleotides. For example, 2' modified sugars can provide enhanced binding affinity and / or increased nuclease resistance to oligonucleotides. Examples of 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3 (2), 293-213 and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are schematic diagrams of some 2' substituted modified nucleosides.

[0073]

[0074] With respect to the present invention, 2'-substituted sugar-modified nucleosides do not include 2'-bridged nucleosides such as LNA.

[0075] Alternating flanking spacers

[0076] The flanking regions may comprise both LNA and DNA nucleosides and are referred to as "alternating flanks" because they comprise an alternating motif of LNA-DNA-LNA nucleosides. A spacer comprising at least one alternating flank is referred to as an "alternating flank spacer." Thus, an "alternating flank spacer" is an LNA spacer oligonucleotide in which at least one flank (F or F') comprises DNA in addition to LNA nucleosides. In some embodiments, at least one or both of regions F or F' comprises both LNA nucleosides and DNA nucleosides. In such embodiments, the flanking regions F or F', or both F and F', comprise at least three nucleosides, wherein the 5' and 3'-most nucleosides of the F and / or F' regions are LNA nucleosides. Alternating flank LNA spacers are disclosed in WO2016 / 127002.

[0077] The alternating flanking regions may comprise up to 3 consecutive DNA nucleosides, such as 1 to 2 or 1 or 2 or 3 consecutive DNA nucleosides.

[0078] The alternating flanking region can be annotated as a series of integers representing a plurality of LNA nucleosides (L) followed by a plurality of DNA nucleosides (D), for example [L]1-3-[D]1-3-[L]1-3 or [L]1-2-[D]1-2-[L]1-2-[D]1-2-[L]1-2. In oligonucleotide design, these will often be represented as numbers such that 2-2-1 represents 5′[L]2-[D]2-[L]3′, and 1-1-1-1-1 represents 5′[L]-[D]-[L]-[D]-[L]3′. The length of the flanking regions (regions F and F′) in oligonucleotides with alternating flanks is as described above for this region, such as 4 to 8, such as 5 to 6 nucleosides, such as 4, 5, 6, or 7 modified nucleosides. It may be advantageous to have at least two LNA nucleosides at the 3' end of the 3' flank (F") to confer additional exonuclease resistance.

[0079] In one embodiment, the gapmer oligonucleotide for use in the present invention can be represented by the following formula:

[0080] F 4-6 -G 7-11 -F' 2-6 ,

[0081] where F has [L] 1-3 -[D] 1-3 -[L] 1-3 design, and F' has [L] 1-2 -[D] 1-2 -[L] 2-4 or [L] 2-6 Design

[0082] A prerequisite is that the total length of the gapmer region FG-F' is at least 16 nucleotides, such as 17 or 18 nucleotides.

[0083] Thus, the gapmer oligonucleotides of the present invention may comprise at least one alternating flank. Typically, at least region F is an alternating flank. In some embodiments, regions F and F' are alternating flanks. In some embodiments, region F is an alternating flank and region F' is a uniform flank (i.e., F' consists of only one type of sugar-modified nucleoside, such as only β-D-oxy LNA).

[0084] In some embodiments, the design of region F is selected from the designs of 3-2-1 (ie, LLLDDL), 3-1-1 (ie, LLLDL), 2-1-2 (LLDLL), 2-1-1 (LLDL), and 1-3-1 (ie, LDDDL).

[0085] In some embodiments, the design of region F' is 1-1-3 (ie, LDLLL) or 1-1-2 (ie, LDLL). In some embodiments, the design of region F is LL, LLL, or LLLL.

[0086] antisense oligonucleotides

[0087] As used herein, the term "antisense oligonucleotide" or "ASO" is defined as an oligonucleotide that can regulate the expression of a target gene by hybridizing to a target nucleic acid, particularly a continuous sequence on the target nucleic acid. Antisense oligonucleotides are not substantially double-stranded herein and are therefore not siRNA or shRNA. Preferably, the antisense oligonucleotides of the present invention are single-stranded. It should be understood that the single-stranded oligonucleotides of the present invention can form a hairpin or intermolecular duplex structure (a duplex between two molecules of the same oligonucleotide) as long as the degree of self-complementarity within or between them is less than 50% of the total length of the oligonucleotide.

[0088] Preferably, single-stranded antisense oligonucleotides do not contain RNA nucleosides, as this would reduce nuclease resistance.

[0089] Preferably, the oligonucleotides of the combination of the present invention comprise one or more modified nucleosides or nucleotides, such as 2' sugar modified nucleosides. Furthermore, it is preferred that the unmodified nucleosides are DNA nucleosides.

[0090] cccDNA (covalently closed circular DNA)

[0091] cccDNA (covalently closed circular DNA) is a special DNA structure produced by some DNA viruses (Polyomaviridae) during their propagation in the cell nucleus. cccDNA is double-stranded DNA that originates in a linear form and is ligated into a covalently closed circle with the help of DNA ligase. In most cases, transcription of viral DNA can only occur from the circular form. Viral cccDNA is also called episomal DNA or sometimes a minichromosome.

[0092] cccDNA is a typical member of the Caulimoviridae and Hepadnaviridae families, including hepatitis B virus (HBV). The HBV genome forms a stable minichromosome (covalently closed circular DNA (cccDNA)) in the nucleus of hepatocytes. cccDNA is formed by the conversion of capsid-associated relaxed circular DNA (rcDNA). HBV cccDNA formation involves a multistep process that requires cellular DNA repair mechanisms and relies on specific interactions with different cellular components that help complete the positive-strand DNA in rcDNA (Alweiss et al. 2017, Viruses, 9(6):156).

[0093] cccDNA is the viral gene template located in the nucleus of infected hepatocytes, where it produces all HBV RNA transcripts required for proliferative infection and plays a major role in viral persistence during the natural course of chronic HBV infection (Locarnini & Zoulim, 2010 Antivir Ther. 15 Suppl 3:3-14. doi:10.3851 / IMP1619). cccDNA serves as a viral reservoir and is the source of viral rebound after treatment cessation, necessitating long-term (usually lifelong) treatment. Due to various side effects, PEG-IFN can only be administered to a small proportion of CHB patients.

[0094] Therefore, most CHB patients urgently need new treatments that can achieve complete cure by degrading or eliminating HBV cccDNA.

[0095] combination

[0096] The term "combination" is understood to mean a combination of at least two different active compounds or prodrugs (pharmaceutical compounds or drugs) for the treatment of a disease. A pharmaceutical combination may involve compounds that are physically, chemically, or otherwise combined (e.g., in the same vial); compounds that are packaged together (e.g., as two separate items in the same package (a multi-component kit) for simultaneous, sequential, or separate administration); or compounds that are provided separately but intended for use together (e.g., the combination is clearly stated on the compound label or package insert). Suitably, the pharmaceutical combination consists of a medicinal compound formulated for oral administration and a medicinal compound formulated for subcutaneous injection. Suitably, the RTEL1 inhibitor and FUBP1 inhibitor of the combination of the present invention may be present in the same or separate compositions. Suitably, the RTEL1 inhibitor and FUBP1 inhibitor of the combination of the present invention may be administered simultaneously, sequentially, or separately. Suitably, the RTEL1 inhibitor and FUBP1 inhibitor of the combination of the present invention are linked together by a physiologically labile linker (such as defined herein). Suitable physiologically unstable linkers can comprise or consist of a DNA dinucleotide having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein a phosphodiester bond is present between the two DNA nucleosides. For example, the linker can be a CA dinucleotide.

[0097] Complementarity

[0098] The term "complementarity" describes the ability of a nucleoside / nucleotide to pair with the Watson Crick bases. The Watson Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). It should be understood that oligonucleotides may include nucleosides with modified nucleobases, such as 5-methylcytosine, which is often used instead of cytosine. Therefore, the term complementarity encompasses Watson Crick base pairing between unmodified and modified nucleobases (see, for example, Hirao et al. (2012) Accounts of Chemical Research, Vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Supplement 37 1.4.1).

[0099] As used herein, the term "complementarity percentage" refers to the ratio of nucleotides (expressed as a percentage) complementary to a reference sequence (such as a target sequence or sequence motif) of a continuous nucleotide sequence in a nucleic acid molecule (such as an oligonucleotide), and the nucleic acid molecule is across a continuous nucleotide sequence. Therefore, by counting the aligned core base numbers of complementarity (forming Watson Crick base pairs) between two sequences (when aligned with the oligonucleotide sequences of target sequence 5'-3' and 3'-5'), dividing it by the total number of nucleotides in the oligonucleotide, then multiplying by 100, the percentage of complementarity is calculated. In this comparison, the core base / nucleotide of misalignment (forming base pairs) is referred to as mismatch. When calculating the complementarity percentage of a continuous nucleotide sequence, insertions and deletions are not allowed. It should be understood that when determining complementarity, as long as the functional ability of the core base forming Watson Crick base pairing is retained, the chemical modification of the core base is not considered (for example, when calculating the complementarity percentage, 5'-methylcytosine is considered to be identical to cytosine).

[0100] The term "fully complementary" refers to 100% complementarity.

[0101] The following is an example of an oligonucleotide motif (SEQ ID NO: 38) that is completely complementary to a target nucleic acid (SEQ ID NO: 12):

[0102] 5'-CTTTGACCAGAGTATGTAAAATTCTC-3'(SEQ ID NO:12)

[0103] 3'-AAACTGGTCTCATACATTTT-5'(SEQ ID NO:38)

[0104] Compound

[0105] As used herein, the term "compound" refers to any molecule capable of inhibiting the expression or activity of RTEL1 or FUBP1. Particular compounds of the combinations of the present invention are nucleic acid molecules, such as RNAi molecules or antisense oligonucleotides according to the present invention, or any conjugates comprising such nucleic acid molecules. For example, herein, the compound can be a nucleic acid molecule, particularly an antisense oligonucleotide or siRNA, that targets RTEL1 or FUBP1.

[0106] Conjugate

[0107] As used herein, the term "conjugate" refers to an oligonucleotide covalently linked to a non-nucleotide moiety (a conjugate moiety or region C or third region).

[0108] The oligonucleotide (or nucleic acid molecules) of the combination of the present invention and one or more non-nucleotide moieties can improve the pharmacology of the oligonucleotide, for example, by affecting the activity, cellular distribution, cellular absorption or stability of the oligonucleotide. In some embodiments, the conjugate moiety is to modify or enhance the pharmacokinetic properties of the oligonucleotide by improving the cellular distribution, bioavailability, metabolism, excretion, permeability and / or cellular uptake of the oligonucleotide. In particular, the conjugate can be used to target the specific organ, tissue or cell type of the oligonucleotide, thereby enhancing the effectiveness of the oligonucleotide in the organ, tissue or cell type. Simultaneously, the conjugate can be used to reduce the activity of the oligonucleotide in non-target cell types, tissues or organs, for example, the activity of de-targeting or the activity in non-target cell types, tissues or organs. For siRNA nucleic acid molecules, the conjugate moiety is most commonly covalently attached to the passenger chain of the siRNA, and for shRNA molecules, the conjugate moiety is most commonly attached to the molecule end farthest from the continuous nucleotide sequence of the shRNA. For antisense oligonucleotides, the conjugate moiety can be covalently linked to either terminus, advantageously using a biocleavable linker such as two to five phosphodiester-linked DNA nucleosides.

[0109] WO 93 / 07883 and WO 2013 / 033230, incorporated herein by reference, provide suitable conjugate moieties. Other suitable conjugate moieties are those that can bind to the conjugate moieties of asialoglycoprotein receptor (ASGPR). In particular, trivalent N-acetylgalactosamine conjugate moieties are suitable for binding to ASGPR, see, for example, US 2009 / 02398, WO 2014 / 076196, WO 2014 / 207232, and WO 2014 / 179620 (incorporated herein by reference). Such conjugates are used to enhance the uptake of oligonucleotides by the liver while reducing the presence of oligonucleotides in the kidneys, thereby increasing the liver / kidney ratio of conjugated oligonucleotides compared to the non-conjugated form of the same oligonucleotides.

[0110] Oligonucleotide conjugates and their synthesis are also reviewed by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, ST Crooke, ed., Chapter 16, Marcel Dekker, Inc., 2001, and in Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of which is herein incorporated by reference in its entirety.

[0111] In one embodiment, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of a carbohydrate, a cell surface receptor ligand, a drug, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0112] In some embodiments, the conjugate is an antibody or antibody fragment having a specific affinity for transferrin receptor, such as disclosed in WO 2012 / 143379, which is incorporated herein by reference. In some embodiments, the non-nucleotide moiety is an antibody or antibody fragment, such as an antibody or antibody fragment that facilitates drug delivery across the cerebrovascular barrier, particularly an antibody or antibody fragment that targets transferrin receptor.

[0113] Continuous nucleotide sequence

[0114] The term "continuous nucleotide sequence" refers to an oligonucleotide region that is complementary to a target nucleic acid. The term is used interchangeably with the term "continuous core base sequence" and the term "oligonucleotide motif sequence" in this article. In some embodiments, all nucleotides of an oligonucleotide constitute a continuous nucleotide sequence. In certain embodiments, a continuous nucleotide sequence is included in the leading strand of an siRNA molecule. In certain embodiments, a continuous nucleotide sequence is part of an shRNA molecule that is 100% complementary to a target nucleic acid. In certain embodiments, an oligonucleotide comprises a continuous nucleotide sequence, such as an FG-F' gap polymer region, and may optionally comprise other nucleotides, such as a nucleotide linker region that can be used to attach a functional group (such as a conjugate group for targeting) to a continuous nucleotide sequence. The nucleotide linker region may be complementary or non-complementary to a target nucleic acid. In certain embodiments, the core base sequence of an antisense oligonucleotide is a continuous nucleotide sequence. In certain embodiments, a continuous nucleotide sequence is at least 80% complementary to a target nucleic acid, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%. In certain embodiments, a continuous nucleotide sequence is 100% complementary to a target nucleic acid.

[0115] spacer

[0116] Antisense oligonucleotides or their consecutive nucleotide sequences can be spacer oligonucleotides, also referred to as spacer oligonucleotides or spacer designs. Antisense spacer oligonucleotides are generally used to inhibit target nucleic acids via RNase H-mediated degradation. In embodiments of the present invention, oligonucleotides are capable of recruiting RNase H. Spacer oligonucleotides comprise at least three different structural regions, namely a 5' flank in the "5->3" direction, a gap, and a 3' flank FG-F'. The "gap" region (G) comprises a stretch of consecutive DNA nucleotides that enable the oligonucleotide to recruit RNase H. The gap region is flanked by a 5' flank region (F) comprising one or more sugar-modified nucleosides (preferably high-affinity sugar-modified nucleosides), and a 3' flank region (F') comprising one or more sugar-modified nucleosides (preferably high-affinity sugar-modified nucleosides). The one or more sugar-modified nucleosides in regions F and F' enhance the affinity of the oligonucleotide for the target nucleic acid (i.e., affinity-enhanced sugar-modified nucleosides). In some embodiments, one or more sugar-modified nucleosides in regions F and F' are 2' sugar-modified nucleosides, such as high affinity 2' sugar modifications, such as independently selected from LNA and 2'-MOE.

[0117] In the gapmer design, the 5'- and 3'-terminal nucleosides of the gap region are DNA nucleosides, positioned adjacent to the sugar-modified nucleoside in the 5' (F) or 3' (F') region, respectively. The wings can be further defined as having at least one sugar-modified nucleoside at the ends furthest from the gap region, i.e., at the 5' end of the 5' wing and at the 3' end of the 3' wing.

[0118] Region FG-F 'forms a continuous nucleotide sequence. The antisense oligonucleotide for use in the present invention or its continuous nucleotide sequence may comprise a spacer region of formula FG-F '. In certain embodiments, all internucleoside bonds between nucleosides in the spacer region of formula FG-F ' are phosphorothioate internucleoside bonds.

[0119] The total length of the gapmer design FGF' can be, for example, 12 to 32 nucleosides, such as 13 to 24 nucleosides, such as 14 to 22 nucleosides, such as 14 to 17 nucleosides, such as 16 to 18 nucleosides. In some embodiments, the total length is 17 nucleosides. In some embodiments, the total length is 17 nucleosides.

[0120] For example, the gapmer oligonucleotide of the present invention can be represented by the following formula:

[0121] F 1-8 -G 5-18 -F' 1-8 , such as

[0122] F 1-8 -G 5-16 -F' 1-8or

[0123] F 1-8 -G 7-16 -F' 2-8 or

[0124] F 4-8 -G 7-12 -F' 2-8 or

[0125] F 4-6 -G 7-11 -F' 2-6

[0126] A prerequisite is that the total length of the gapmer region FG-F' is at least 12, such as at least 14 nucleotides.

[0127] In one aspect of the invention, the antisense oligonucleotide or contiguous nucleotide sequence thereof consists of or comprises a gapmer of the formula 5'-FG-F'-3', wherein regions F and F' independently comprise or consist of 1-8 nucleosides, wherein 1-4 nucleosides are 2' sugar modified and define the 5' and 3' ends of the F and F' regions, and G is a region of between 6 and 18, such as 6 to 16, nucleosides capable of recruiting RNase H. In some embodiments, the G region consists of DNA nucleosides.

[0128] In some embodiments, all modified nucleosides in regions F and F' are β-D-oxy LNA nucleosides. In addition, regions F or F', or F and F', may optionally comprise DNA nucleosides. Optionally, flanking regions F or F', or flanking regions F and F', may comprise one or more DNA nucleosides (alternating flanks, see the definition of alternating flanks for more details).

[0129] Region F, region G, and region F' are further defined below and may be combined into the formula FG-F'.

[0130] Gapmer-region G

[0131] The region G (gap region) of the gapmer is a region that enables the oligonucleotide to recruit nucleosides (typically DNA nucleosides) of RNA enzyme H, such as human RNA enzyme H1. RNA enzyme H is a cellular enzyme that recognizes the duplex between DNA and RNA and enzymatically cleaves RNA molecules. Suitably, the gapmer can have a gap region (G) of at least 5 or 6 consecutive DNA nucleosides in length, such as 5–18 consecutive DNA nucleosides, 5–17 consecutive DNA nucleosides, such as 5–16 consecutive DNA nucleosides, such as 6–15 consecutive DNA nucleosides, such as 7–14 consecutive DNA nucleosides, such as 8–12 consecutive DNA nucleotides, such as 8–12 consecutive DNA nucleotides. In certain embodiments, the gap region G can be composed of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18 consecutive DNA nucleosides. In some cases, cytosine (C) DNA in the gap region may be methylated; these residues are annotated as 5'-methylcytosine ( me C or e instead of c). If a cg dinucleotide is present in the gap to reduce potential toxicity, methylation of the cytosine DNA in the gap is preferred, as this modification has no significant effect on the efficacy of the oligonucleotide. 5' substituted DNA nucleosides, such as 5' methyl DNA nucleosides, have been reported to be useful in the DNA gap region (EP 2 742 136).

[0132] In some embodiments, the gap region G may consist of 12 or fewer (such as 7) consecutive DNA nucleosides, 8, 9, 10 or 11 consecutive DNA nucleosides, such as 9, 10 or 11 consecutive DNA nucleosides.

[0133] In some cases, one or more cytosine (C) residues in the gap region may be methylated (e.g., when a DNA C is followed by a DNA G). Such residues are also annotated as 5-methyl-cytosine ( me C).

[0134] In some embodiments, the gap region G can consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 consecutive phosphorothioate-linked DNA nucleosides. In some embodiments, all internucleoside bonds in the gap are phosphorothioate bonds.

[0135] Although conventional gapmers have a DNA gap region, there are many examples of modified nucleosides that, when used within the gap region, allow for the recruitment of RNase H. Modified nucleosides that have been reported to be able to recruit RNase H when included within the gap region include, for example, α-L-LNA, C4′-alkylated DNA (as described in PCT / EP2009 / 050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296-2300 (both incorporated herein by reference)), arabinose-derivatized nucleosides such as ANA and 2′F-ANA (Mangos et al., 2003 J. AM. CHEM. SOC. 125, 654-661), UNA (unlocked nucleic acid) (as described in Fluiter et al., Mol. Biosyst., 2009, 10, 1039 (incorporated herein by reference)). UNA is a non-locked nucleic acid, typically one in which the bond between C2 and C3 of the ribose has been removed, thereby forming an unlocked "sugar" residue. Modified nucleosides used in such spacers can be nucleosides that adopt a 2' internal (DNA-like) structure when introduced into the gap region, i.e., modifications that allow for RNase H recruitment. In some embodiments, the DNA gap region (G) described herein can optionally include 1 to 3 sugar-modified nucleosides that adopt a 2' internal (DNA-like) structure when introduced into the gap region.

[0136] Spacer-flanking regions, F and F'

[0137] Region F is immediately adjacent to the 5' DNA nucleoside of region G. The 3'-most nucleoside of region F is a sugar-modified nucleoside, such as a high-affinity sugar-modified nucleoside, for example a 2'-substituted nucleoside, such as a MOE nucleoside or an LNA nucleoside.

[0138] Region F' is immediately adjacent to the 3' DNA nucleoside of region G. The 5'-most nucleoside of region F' is a sugar-modified nucleoside, such as a high-affinity sugar-modified nucleoside, for example a 2'-substituted nucleoside, such as a MOE nucleoside or an LNA nucleoside.

[0139] Region F is 1-8 consecutive nucleotides in length, such as 2-6 consecutive nucleotides in length, such as 3-4 consecutive nucleotides in length, or such as 4-6 consecutive nucleotides in length. In some embodiments, region F is 4 consecutive nucleotides in length. In some embodiments, region F is 5 consecutive nucleotides in length. In some embodiments, region F is 6 consecutive nucleotides in length. Preferably, the 5'-terminal nucleoside of region F is a sugar-modified nucleoside. In some embodiments, the two 5'-terminal nucleosides of region F are sugar-modified nucleosides. In some embodiments, the 5'-terminal nucleosides of region F are LNA nucleosides. In some embodiments, the two 5'-terminal nucleosides of region F are LNA nucleosides. In some embodiments, the two 5'-terminal nucleosides of region F are 2'-substituted nucleosides, such as two 3'MOE nucleosides. In some embodiments, the 5'-terminal nucleoside of region F is a 2'-substituted nucleoside, such as a MOE nucleoside.

[0140] The length of region F' is 2-8 consecutive nucleotides, such as 3-6, such as 4-5 consecutive nucleotides. In some embodiments, the length of region F' is 2 consecutive nucleotides. In some embodiments, the length of region F' is 3 consecutive nucleotides. In some embodiments, the length of region F' is 4 consecutive nucleotides. In some embodiments, the length of region F' is 5 consecutive nucleotides. Advantageously, in embodiments, the 3'-terminal nucleoside of region F' is a sugar-modified nucleoside. In some embodiments, the two 3'-terminal nucleosides of region F are sugar-modified nucleosides. In some embodiments, the two 3'-terminal nucleosides of region F are LNA nucleosides. In some embodiments, the 3'-terminal nucleosides of region F are LNA nucleosides. In some embodiments, the two 3'-terminal nucleosides of region F are 2'-substituted nucleosides, such as two 3'MOE nucleosides. In some embodiments, the 3'-terminal nucleoside of region F is a 2'-substituted nucleoside, such as a MOE nucleoside.

[0141] It should be noted that when the length of region F or F' is one, preferably it is an LNA nucleoside.

[0142] In some embodiments, regions F and F' independently consist of or comprise a continuous sequence of sugar-modified nucleosides. In some embodiments, the sugar-modified nucleosides of region F can be independently selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabinose nucleic acid (ANA) units, and 2'-fluoro-ANA units.

[0143] In some embodiments, regions F and F' independently comprise both LNA and 2'-substituted modified nucleosides (hybrid wing design).

[0144] In some embodiments, regions F and F' consist of only one type of sugar-modified nucleoside, such as only MOE or only β-D-oxy LNA or only ScET. Such a design is also referred to as a uniform flank or uniformly spaced polymer design.

[0145] In some embodiments, all nucleosides in region F or F' or both F and F' are LNA nucleosides, such as independently selected from β-D-oxy LNA, ENA, or ScET nucleosides. In some embodiments, region F consists of 1-5, such as 2-4, such as 3-4, such as 1, 2, 3, 4, or 5 contiguous LNA nucleosides. In some embodiments, all nucleosides in regions F and F' are β-D-oxy LNA nucleosides.

[0146] In some embodiments, all nucleosides in region F or F' or F and F' are 2'substituted nucleosides, such as OMe or MOE nucleosides. In some embodiments, region F consists of 1, 2, 3, 4, 5, 6, 7 or 8 adjacent OMe or MOE nucleosides. In some embodiments, only one flanking region may consist of 2'substituted nucleosides, such as OMe or MOE nucleosides. In some embodiments, the 5'(F) flanking region consists of 2'substituted nucleosides such as OMe or MOE nucleosides, and the 3'(F') flanking region comprises at least one LNA nucleoside, such as β-D-oxy LNA nucleosides or cET nucleosides. In some embodiments, the 3'(F') flanking region consists of 2'substituted nucleosides, such as OMe or MOE nucleosides, and the 5'(F) flanking region comprises at least one LNA nucleoside, such as β-D-oxy LNA nucleosides or cET nucleosides.

[0147] In some embodiments, all modified nucleosides of regions F and F' are LNA nucleosides, such as independently selected from β-D-oxy LNA, ENA, or ScET nucleosides, wherein regions F or F' or F and F' may optionally comprise DNA nucleosides (alternating flanks, see these definitions for more details). In some embodiments, all modified nucleosides of regions F and F' are β-D-oxy LNA nucleosides, wherein regions F or F' or F and F' may optionally comprise DNA nucleosides (alternating flanks, see these definitions for more details).

[0148] Other gapmer designs are disclosed in WO2004 / 046160, WO2007 / 146511 and WO2008 / 113832, which are hereby incorporated herein by reference.

[0149] In some embodiments, the 5' and 3'-most nucleosides of regions F and F' are LNA nucleosides, such as β-D-oxy LNA nucleosides or ScET nucleosides.

[0150] In some embodiments, the internucleoside linkage between region F and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between region F' and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between nucleosides of regions F or F', F and F' is a phosphorothioate internucleoside linkage.

[0151] HBV infection

[0152] The term "hepatitis B virus infection" or "HBV infection" is well known in the art and refers to an infectious disease caused by the hepatitis B virus (HBV) and affecting the liver. HBV infection can be an acute or chronic infection.

[0153] Some people who are infected experience no symptoms during the initial infection, while others quickly develop symptoms such as vomiting, yellowing of the skin, fatigue, dark urine, and abdominal pain ("Hepatitis B Fact Sheet N°204." WHO.INT. July 2014. Retrieved November 4, 2014). These symptoms typically last for several weeks and can result in death. It can take 30 to 180 days for symptoms to develop. Of those infected at birth, 90% will develop chronic hepatitis B infection, while less than 10% of those infected after age five will develop chronic hepatitis B infection ("Hepatitis B FAQs for the Public-Transmission," US Centers for Disease Control and Prevention (CDC), retrieved November 29, 2011). Most people with chronic disease experience no symptoms; however, they may eventually develop cirrhosis and liver cancer (Chang, 2007, Semin Fetal Neonatal Med, 12:160-167). These complications contribute to the death of 15% to 25% of those who develop the chronic disease ("Hepatitis B Fact Sheet N°204". who.int. July 2014, retrieved November 4, 2014). Herein, the term "HBV infection" includes both acute and chronic hepatitis B infection. The term "HBV infection" also includes the progressive phase of initial infection, the symptomatic phase, and the progressive chronic phase of HBV infection.

[0154] Chronic hepatitis B virus (CHB) infection is a global health problem, affecting 248 million people worldwide. Approximately 686,000 deaths are attributed annually to HBV-related advanced liver disease and hepatocellular carcinoma (HCC) (GBD 2013; Schweitzer et al., 2015). The World Health Organization (WHO) projects that without increased intervention, the number of CHB-infected individuals will remain at their current high levels for the next 40 to 50 years, with cumulative deaths expected to reach 20 million between 2015 and 2030 (WHO 2016). CHB infection is not a homogeneous disease with a single clinical presentation. Infected individuals progress through several phases of CHB-related liver disease throughout their lives, which form the basis of standard-of-care (SOC) treatment. Current guidelines recommend treatment for selected individuals with CHB based on three criteria: serum ALT level, HBV DNA level, and liver disease severity (EASL, 2017). This recommendation is attributed to the fact that SOCs (i.e., nucleoside (nucleotide) analogs (NAs) and pegylated interferon-α (PEG-IFN)) are not curative and must be administered chronically, increasing their safety risks. NAs can effectively inhibit HBV DNA replication; however, they have very limited or no effect on other viral markers. Two hallmarks of HBV infection, hepatitis B surface antigen (HBsAg) and covalently closed circular DNA (cccDNA), are the primary targets for new drugs aimed at curing HBV. In the plasma of individuals with chronic hepatitis B (CHB), HBsAg subviral (empty) particles outnumber HBV virions by 103 to 105 times (Ganem & Prince, 2014); this excess is believed to contribute to the immunopathogenesis of the disease, including the inability of individuals to produce neutralizing anti-HBs antibodies, a serological marker observed after resolution of acute HBV infection.

[0155] High-affinity modified nucleosides

[0156] High affinity modified nucleosides are modified nucleotides that, when incorporated into an oligonucleotide, enhance the affinity of the oligonucleotide for its complementary target, for example by increasing the melting temperature (T m) measurement. The high affinity modified nucleosides of the present invention preferably increase the melting temperature of each modified nucleoside by between +0.5°C and +12°C, more preferably between +1.5°C and +10°C and most preferably between +3°C and +8°C. Many high affinity modified nucleosides are known in the art and include, for example, many 2' substituted nucleosides, e.g., Ome and MOE, and locked nucleic acids (LNA) (see, e.g., Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0157] hybridization

[0158] As used herein, the term "hybridizing" or "hybridizes" is understood to mean the formation of hydrogen bonds between base pairs on opposite strands of two nucleic acid chains (e.g., oligonucleotides, such as siRNA leader and target nucleic acid), thereby forming a duplex. The affinity of the binding between the two nucleic acid chains is the strength of the hybridization. It is typically measured in terms of the melting temperature (T m ), the melting temperature is defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. Under physiological conditions, T m It is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515–537). The standard state Gibbs free energy ΔG° more accurately represents the binding affinity and is given by ΔG° = -RTln(K d ) and the dissociation constant (K d), where R is the gas constant and T is the absolute temperature. Therefore, the very low ΔG° of the reaction between the oligonucleotide and the target nucleic acid reflects the strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction with a water concentration of 1M, a pH of 7, and a temperature of 37°C. The hybridization of the oligonucleotide and the target nucleic acid is a spontaneous reaction, and the ΔG° of a spontaneous reaction is less than zero. ΔG° can be measured experimentally, for example, using isothermal titration calorimetry (ITC) methods as described in Hansen et al., Chem. Comm. 36–38, 1965, and Holdgate et al., 2005, Drug Discov Today. Technicians will know that commercial equipment can be used for ΔG° measurements. ΔG ° can also be estimated numerically using the nearest neighbor model described in Santa Lucia, 1998, Proc Natl Acad Sci USA.95:1460–1465, appropriately using the derived thermodynamic parameters described in Sugimoto et al., 1995, Biochemistry 34:11211–11216 and McTigue et al., 2004, Biochemistry 43:5388–5405. In order to have the possibility of regulating its intended nucleic acid target by hybridization, for oligonucleotides with a length of 10-30 nucleotides, the oligonucleotides of the present invention hybridize to the target nucleic acid with an estimated ΔG ° of less than -10 kcal. In some embodiments, the degree or intensity of hybridization is measured by the standard state Gibbs free energy ΔG °. For oligonucleotides with a length of 8-30 nucleotides, the oligonucleotide can hybridize to the target nucleic acid with a ΔG ° estimate of less than -10 kcal, such as less than -15 kcal, such as less than -20 kcal, and such as less than -25 kcal. In some embodiments, the oligonucleotide hybridizes to the target nucleic acid with a ΔG° estimate of -10 to -60 kcal, such as -12 to -40, such as -15 to -30 kcal, or -16 to -27 kcal, such as -18 to -25 kcal.

[0159] Identity

[0160] As used herein, the term "identity" refers to the nucleotide ratio (expressed as a percentage) of a continuous nucleotide sequence in a nucleic acid molecule (such as an oligonucleotide) that is identical to a reference sequence (such as a sequence motif), and the nucleic acid molecule spans a continuous nucleotide sequence. Therefore, by counting the number of aligned core bases that are identical (matched) in two sequences (in the continuous nucleotide sequence of the compound used in the present invention and in the reference sequence), the number is divided by the total number of nucleotides of the oligonucleotide and multiplied by 100 to calculate the identity percentage. Therefore, the length of the alignment region (such as, a continuous nucleotide sequence) of the identity percentage=(matching number x 100) / comparison region. When calculating the identity percentage of a continuous nucleotide sequence, insertions and deletions are not allowed. It should be understood that when determining identity, as long as the functional ability of the core base forming Watson Crick base pairing is retained, the chemical modification of the core base is not considered (for example, when calculating the identity percentage, 5-methylcytosine is considered to be identical to cytosine).

[0161] Inhibition of expression

[0162] As used herein, the term "inhibition of expression" is understood to be a general term for the ability of an oligonucleotide to inhibit the amount or activity of a target (i.e., RTEL1 or FUBP1) in a target cell. Inhibition of activity can be determined by measuring the level of target pre-mRNA or target mRNA, or by measuring the level of the target or target activity in the cell. Thus, inhibition of expression can be determined in vitro or in vivo.

[0163] Typically, inhibition of expression is determined by comparing the inhibition of activity resulting from administration of an effective amount of an antisense oligonucleotide to a target cell and comparing that level to a reference level obtained from a target cell to which the antisense oligonucleotide has not been administered (a control experiment) or to a known reference level (e.g., the level of expression prior to administration of an effective amount of an antisense oligonucleotide, or a predetermined or otherwise known level of expression).

[0164] For example, control experiments can be in animals or humans, or target cells treated with a saline composition or a reference oligonucleotide (usually a scrambled control).

[0165] The term inhibit (noun) or inhibit (verb) may also refer to downregulating, decreasing, suppressing, reducing, or decreasing the expression of a target.

[0166] Inhibition of expression may occur, for example, by degradation of pre-mRNA or mRNA (such as using RNase H recruiting oligonucleotides, such as gapmers).

[0167] inhibitors

[0168] The term "inhibitor" is known in the art and relates to a compound / substance or composition that is able to completely or partially prevent or reduce (a) the physiological function (ie activity) of a specific protein (eg, a specific protein of FUBP1 or RTEL1).

[0169] In the context of the present invention, an "inhibitor" of FUBP1 is capable of preventing or reducing the activity / function of FUBP1 by preventing or reducing the expression, respectively, of the FUBP1 gene product.

[0170] Similarly, in the context of the present invention, an "inhibitor" of RTEL1 is capable of preventing or reducing the activity / function of RTEL1 by preventing or reducing the expression, respectively, of the RTEL1 gene product.

[0171] Thus, inhibitors of FUBP1 or RTEL1 can cause a decrease in the expression level of FUBP1 or RTEL1, respectively (e.g., a decrease in the level of FUBP1 or RTEL1 mRNA, or a decrease in the level of FUBP1 or RTEL protein, respectively), which is reflected in a decrease in the functionality (i.e., activity) of FUBP1 or RTEL1, wherein the function includes poly-A polymerase function. Thus, in the context of the present invention, inhibitors of FUBP1 can also encompass transcriptional repressors of FUBP1 expression that are capable of reducing the level of FUBP1.

[0172] Therefore, in the context of the present invention, inhibitors of RTEL1 may also encompass transcriptional repressors of RTEL1 expression that are capable of reducing the level of RTEL1. The term "inhibitor" also encompasses pharmaceutically acceptable salts thereof. Preferred inhibitors are nucleic acid molecules.

[0173] connector

[0174] A bond or linker is a connection between two atoms that connects one target chemical group or segment to another target chemical group or segment via one or more covalent bonds. The conjugate moiety can be attached to the oligonucleotide directly or through a linking moiety (e.g., a linker or tether). The linker can covalently link a third region, such as the conjugate moiety (region C), to the first region, such as an oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A).

[0175] In some embodiments of the present invention, the combined conjugates or oligonucleotide conjugates of the present invention may optionally include a linker region (second region or region B and / or region Y) located between the oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate portion (region C or third region).

[0176] Region B refers to a biodegradable joint comprising a physiologically unstable key or consisting thereof, which is cleavable under conditions commonly encountered in mammals or under conditions similar thereto. The conditions under which the physiologically unstable joint undergoes chemical transformation (e.g., cracking) include chemical conditions, such as pH, temperature, oxidation or reduction conditions or reagents, and the salt concentration encountered in mammalian cells or similar thereto. Conditions within mammalian cells also include enzymatic activity typically present in mammalian cells, such as the enzymatic activity from proteolytic enzymes or hydrolytic enzymes or nucleases. In one embodiment, the biodegradable joint is sensitive to S1 nuclease cleavage. In a preferred embodiment, the nuclease susceptible joint comprises 1 to 10 nucleosides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides, more preferably 2 to 6 nucleosides, and most preferably 2 to 4 connected nucleosides, which are connected and comprise at least two continuous phosphodiester bonds, such as at least 3 or 4 or 5 continuous phosphodiester bonds. Preferably, the nucleoside is DNA or RNA. In one embodiment, the linker between the oligonucleotide and the conjugate moiety is a physiologically labile linker consisting of 2 to 5 consecutive phosphodiester-linked nucleosides, comprising at least two consecutive phosphodiester bonds at the 5' or 3' end of the consecutive nucleotide sequence of the antisense oligonucleotide.

[0177] In some embodiments, the physiologically labile linker comprises or consists of a DNA dinucleotide having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein a phosphodiester bond exists between the two DNA dinucleotides and at least one phosphodiester at the 5' or 3' end of the dinucleotide connects the oligonucleotide of the nucleic acid molecule to the dinucleotide or connects the conjugate moiety to the dinucleotide. For example, the linker can be a CA dinucleotide. In some embodiments, the physiologically labile linker comprises or consists of a DNA trinucleotide of the sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAC, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, or GGG, wherein there are phosphodiester bonds between the DNA nucleosides and there may be a phosphodiester at the 5' or 3' end of the trinucleotide. Biodegradable linkers comprising phosphodiesters are described in more detail in WO 2014 / 076195 (incorporated herein by reference). When compared to a standard, at least about 50% of the conjugate moieties in a conjugate compound with a biodegradable linker are cleaved from the oligonucleotide, such as at least about 60% cleaved, such as at least about 70% cleaved, such as at least about 80% cleaved, such as at least about 85% cleaved, such as at least about 90% cleaved, such as at least about 95% of the conjugate moieties are cleaved from the cleaved oligonucleotide.

[0178] Region Y refers to a linker that is not necessarily biodegradable but is primarily used to covalently link the conjugate moiety (region C or third region) to the oligonucleotide (region A or first region). The region Y linker can comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units, or aminoalkyl groups. The oligonucleotide conjugates of the present invention can be constructed from the following region elements: AC, ABC, ABYC, AYBC, or AYC. In some embodiments, the linker (region Y) is an aminoalkyl group, such as a C2-C36 aminoalkyl group, including, for example, a C6 to C12 aminoalkyl group. In a preferred embodiment, the linker (region Y) is a C6 aminoalkyl group.

[0179] LNA spacer

[0180] LNA gapmers are gapmers in which one or both of regions F and F' comprise or consist of LNA nucleosides. β-D-oxy gapmers are gapmers in which one or both of regions F and F' comprise or consist of β-D-oxy LNA nucleosides.

[0181] In some embodiments, the LNA spacer has the formula: [LNA] 1-5 -[Region G]-[LNA] 1-5 , wherein region G is as defined in the definition of region G of a gapmer.

[0182] Locked Nucleoside Acids (LNA Nucleosides)

[0183] An "LNA nucleoside" is a 2'-sugar-modified nucleoside containing a double radical connecting the C2' and C4' ribose rings of the nucleoside (also known as a "2'-4' bridge"), which constrains or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). When LNA is incorporated into an oligonucleotide complementary to an RNA or DNA molecule, the locking of the ribose conformation is associated with an increase in hybridization affinity (duplex stabilization). This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.

[0184] Non-limiting exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al. J. Org. Chem. 2010, Vol. 75(5), pp. 1569-81, Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238 and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.

[0185] Specific examples of LNA nucleosides are given in Scheme 1 (wherein B is as defined above).

[0186] Solution 1

[0187]

[0188] Specific LNA nucleosides are β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA such as (S)-6'-methyl-β-D-oxy-LNA (ScET) and ENA. A particularly advantageous LNA is β-D-oxy-LNA.

[0189] Hybrid wing spacer polymer

[0190] Hybrid wing spacers are LNA spacers wherein one or both of regions F and F' comprise 2'-substituted nucleosides, such as 2'-substituted nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, arabinonucleotide (ANA) units, and 2'-fluoro-ANA units such as MOE nucleosides. In some embodiments, wherein at least one of regions F and F' or both regions F and F' comprise at least one LNA nucleoside, the remaining nucleosides of regions F and F' are independently selected from the group consisting of MOE and LNA. In some embodiments, wherein at least one of regions F or F' or both regions F and F' comprise at least two LNA nucleosides, the remaining nucleosides of regions F and F' are independently selected from the group consisting of MOE and LNA. In some hybrid wing embodiments, one or both regions F and F' may further comprise one or more DNA nucleosides.

[0191] Modified internucleoside linkages

[0192] As commonly understood by the skilled artisan, the term "bond between the nucleosides of modification" is defined as a bond other than a phosphodiester (PO) bond, which covalently couples two nucleosides together. The oligonucleotide of the combination of the present invention can therefore comprise a bond between the nucleosides of one or more modifications, such as a bond between one or more phosphorothioate nucleosides, or a bond between one or more phosphorodithioate nucleosides. In some embodiments, compared with a phosphodiester bond, the bond between the modified nucleosides increases the nuclease resistance of the oligonucleotide. For naturally occurring oligonucleotides, the internucleoside linkage is included in a phosphate group that produces a phosphodiester bond between adjacent nucleosides. The internucleoside linkage of the modification can be used for stabilizing the oligonucleotide used in vivo, and can be used for preventing the nuclease cleavage of a DNA nucleoside region or an RNA nucleoside region in the oligonucleotide of the combination of the present invention, for example, in the gap region G of a spacer oligonucleotide and in the nucleoside region of the modification, for example, region F and F'.

[0193] In an embodiment, the oligonucleotide comprises one or more internucleoside bonds modified from natural phosphodiester, such as one or more modified internucleoside bonds, which are, for example, more resistant to nuclease attacks. Nuclease resistance can be determined by incubating the oligonucleotide in serum or by using a nuclease resistance assay (such as snake venom phosphodiesterase (SVPD)), both of which are well known in the art. The internucleoside bonds that can enhance the nuclease resistance of the oligonucleotide are referred to as anti-nuclease internucleoside bonds. In certain embodiments, at least 50% of the internucleoside bonds in an oligonucleotide or its continuous nucleotide sequence are modified, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80% or such as at least 90% of the oligonucleotide or its continuous nucleotide sequence. In certain embodiments, all internucleoside bonds in an oligonucleotide or its continuous nucleotide sequence are modified. It should be recognized that in some embodiments, the nucleosides to which the oligonucleotide of the combination of the present invention is connected to a non-nucleotide functional group such as a conjugate can be a phosphodiester. In some embodiments, all internucleoside linkages of an oligonucleotide or contiguous nucleotide sequence thereof are nuclease-resistant internucleoside linkages.

[0194] For the oligonucleotides of the combinations of the invention, the use of phosphorothioate internucleoside linkages is preferred.

[0195] Phosphorothioate internucleoside linkages are particularly useful due to nuclease resistance, beneficial pharmacokinetics, and ease of manufacture. In some embodiments, at least 50% of the internucleoside linkages in an oligonucleotide or its contiguous nucleotide sequence are phosphorothioates, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80%, or such as at least 90% of the internucleoside linkages in an oligonucleotide or its contiguous nucleotide sequence are phosphorothioates. In some embodiments, all internucleoside linkages in an oligonucleotide or its contiguous nucleotide sequence are phosphorothioates.

[0196] Nuclease-resistant bonds, such as phosphorothioate bonds, are particularly useful in regions of the oligonucleotide that are capable of recruiting nucleases when forming a duplex with a target nucleic acid, such as region G of a gapmer. However, phosphorothioate linkages can also be used in non-nuclease recruiting regions and / or affinity-enhancing regions, such as regions F and F' of a gapmer. In some embodiments, a gapmer oligonucleotide can contain one or more phosphodiester linkages in region F or F', or in both regions F and F', wherein all internucleoside linkages in region G can be phosphorothioates.

[0197] Advantageously, all internucleoside linkages of the contiguous nucleotide sequence of the oligonucleotide are phosphorothioate, or all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

[0198] Phosphorothioate bonds can exist in different tautomeric forms, for example as shown below:

[0199]

[0200] It will be appreciated that, as disclosed in EP 2 742 135, antisense oligonucleotides may comprise other internucleoside linkages (besides phosphodiester and phosphorothioate), such as alkylphosphonate / methylphosphonate internucleoside linkages, which according to EP 2 742 135 may, for example, otherwise be tolerated by gap regions of DNA phosphorothioate.

[0201] Modified nucleosides

[0202] As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside modified by introducing one or more modifications of a sugar moiety or (core) base moiety compared to an equivalent DNA or RNA nucleoside. In a preferred embodiment, the nucleoside modified comprises a modified sugar moiety. The term modified nucleoside can also be used interchangeably with the term "nucleoside analogs" or modified "unit" or modified "monomer" in this article. Nucleosides with unmodified DNA or RNA sugar moieties are referred to as DNA or RNA nucleosides in this article. If Watson Crick (Watson Crick) base pairing is allowed in the base region of a DNA or RNA nucleoside, the nucleoside with modification is still typically referred to as DNA or RNA.

[0203] Modified oligonucleotides

[0204] The term modified oligonucleotide has described a kind of oligonucleotide, and it comprises the internucleoside linkage of one or more sugar-modified nucleosides and / or modification.Term " chimeric " oligonucleotide is the term that has been used to describe the oligonucleotide with nucleoside and DNA nucleoside of modification in the literature.The antisense oligonucleotide of combination of the present invention is preferably chimeric oligonucleotide.

[0205] Regulation of expression

[0206] As used herein, the term "modulation of expression" is understood to be a general term for the ability of an oligonucleotide to alter the amount of a target (i.e., RTEL1 or FUBP1) compared to the amount of the target prior to administration of the oligonucleotide. Alternatively, modulation of expression can be determined by reference to a control experiment. As is generally known, a control is a single or target cell treated with a saline composition or a single or target cell treated with a non-targeting oligonucleotide (mock).

[0207] One type of regulation is the ability of an oligonucleotide to inhibit, downregulate, reduce, inhibit, remove, stop, block, prevent, reduce, reduce, avoid or terminate target (i.e., RTEL1 or FUBP1) expression, for example by degrading mRNA or preventing transcription. Another type of regulation is the ability of an oligonucleotide to restore, increase or enhance target expression, for example, by repairing splice sites or preventing splicing or removing or blocking inhibitory mechanisms such as microRNA inhibition.

[0208] MOE gapmer

[0209] MOE gapmers are gapmers in which regions F and F' are composed of MOE nucleosides. In some embodiments, MOE gapmers are designed as [MOE] 1-8 -[Region G]-[MOE] 1-8 , such as [MOE] 2-7 -[Area G] 5-16 -[MOE] 2-7 , such as [MOE] 3-6 -[Region G]-[MOE] 3-6 , wherein region G is as defined in the definition of gapmers. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) have been widely used in the art.

[0210] Naturally occurring variants

[0211] The term "naturally occurring variant" refers to a variant of a gene or transcript (e.g., RTEL1 or FUBP1) that originates from the same locus as the target nucleic acid but may differ, for example, due to the degeneracy of the genetic code resulting in multiple codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs), and allelic variants. The oligonucleotides of the combinations of the present invention can therefore target the target nucleic acid and its naturally occurring variants based on the presence of a sufficiently complementary sequence to the oligonucleotide.

[0212] In some embodiments, the naturally occurring variants are at least 95%, such as at least 98% or at least 99%, homologous to a mammalian RTEL1 or FUBP1 target nucleic acid, such as SEQ ID NOs: 1 and / or 2 (for RTEL1) or SEQ ID NOs: 247 and / or 251 (for FUBP1). In some embodiments, the naturally occurring variants of RTEL1 are at least 99% homologous to the human RTEL1 target nucleic acid of SEQ ID NO: 1. In some embodiments, the naturally occurring variants of FUBP1 are at least 99% homologous to the human FUBP1 target nucleic acid of SEQ ID NO: 247. In some embodiments, the naturally occurring variants are known polymorphisms.

[0213] Nuclease-mediated degradation

[0214] Nuclease-mediated degradation means that an oligonucleotide is able to mediate the degradation of a complementary nucleotide sequence when forming a duplex with said sequence.

[0215] In some embodiments, the oligonucleotides can function via nuclease-mediated degradation of the target nucleic acid, wherein the oligonucleotides of the combinations of the invention are capable of recruiting nucleases, particularly endonucleases, preferably ribonucleases (RNases) that recognize RNA / DNA hybrids and effect cleavage of RNA nucleic acids, such as RNase H. Examples of oligonucleotide designs that function via a nuclease-mediated mechanism are oligonucleotides that typically comprise a region of at least 5 or 6 contiguous DNA nucleosides in length and are flanked on one or both sides by affinity-enhancing nucleosides, e.g., spacers, headmers, and tailmers.

[0216] Nucleic acid molecules (or "oligonucleotides")

[0217] As used herein, the term "nucleic acid molecule" or "therapeutic nucleic acid molecule" or "oligonucleotide" is defined as a molecule (i.e., a nucleotide sequence) comprising two or more covalently linked nucleosides as generally understood by those skilled in the art. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers.

[0218] The nucleic acid molecules referred to in the combination of the present invention are generally therapeutic oligonucleotides with a length of less than 50 nucleotides. The nucleic acid molecule can be or can include a single-stranded antisense oligonucleotide, or can be another oligomeric nucleic acid molecule, such as CRISPR RNA, siRNA, shRNA, aptamer or ribozyme. Therapeutic nucleic acid molecules are usually prepared in the laboratory by solid phase chemical synthesis followed by purification and separation. However, shRNA is usually delivered to cells using a lentiviral vector and then transcribed from the lentiviral vector to produce single-stranded RNA, which will form a stem-loop (hairpin) RNA structure that can interact with RNA interference mechanisms, including RNA-induced silencing complexes (RISC). When referring to the sequence of a nucleic acid molecule, reference is made to the covalently linked nucleotides or nucleoside core base portions or their modified sequences or orders. The nucleic acid molecules of the combination of the present invention are artificial and chemically synthesized and are usually purified or isolated. In certain embodiments, the nucleic acid molecules of the combination of the present invention are not shRNA transcribed from a vector after entering the target cell. The nucleic acid molecules of the combination of the present invention may include one or more modified nucleosides or nucleotides.

[0219] In some embodiments, the nucleic acid molecules of the combination of the present invention comprise a length of 12 to 60 nucleotides, such as a length of 13 to 50, such as 14 to 40, such as 15 to 30, such as 16 to 22, such as 16 to 18 or 15 to 17 consecutive nucleotides or consist of them. Therefore, in some embodiments, the oligonucleotides of the present invention can be 12-25 nucleotides in length. Alternatively, in some embodiments, the oligonucleotides of the present invention can be 15-22 nucleotides in length.

[0220] In some embodiments, the nucleic acid molecule or its contiguous nucleotide sequence comprises or consists of 24 or fewer nucleotides, such as 22, such as 20 or fewer, such as 18 or fewer, such as 14, 15, 16 or 17 nucleotides. It should be understood that any range given herein includes the endpoints of the range. Thus, if a nucleic acid molecule is said to comprise 12 to 30 nucleotides, then both 12 and 30 nucleotides are included.

[0221] In some embodiments, the contiguous nucleotide sequence comprises or consists of at least 10, such as 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides in length.

[0222] Nucleic acid molecules are used to regulate the expression of a target nucleic acid in a mammal. In some embodiments, nucleic acid molecules, such as siRNA, shRNA, and antisense oligonucleotides, are generally used to inhibit the expression of a target nucleic acid.

[0223] In one embodiment of the present invention, the nucleic acid molecule is selected from RNAi agents, such as siRNA or shRNA. In another embodiment, the nucleic acid molecule is a single-stranded antisense oligonucleotide, such as a high-affinity modified antisense oligonucleotide that interacts with RNase H.

[0224] In some embodiments, the nucleic acid molecules of the compositions of the invention may comprise one or more modified nucleosides or nucleotides, such as 2' sugar modified nucleosides.

[0225] In some embodiments, the nucleic acid molecule comprises phosphorothioate internucleoside linkages.

[0226] In some embodiments, a nucleic acid molecule can be conjugated to a non-nucleoside moiety (conjugate moiety).

[0227] Nucleic acid molecule library should be understood as the collection of variant nucleic acid molecules.The purpose of nucleic acid molecule library can change.In certain embodiments, nucleic acid molecule library is made up of oligonucleotides with overlapping core base sequences, and this sequence targets one or more mammalian target nucleic acids (that is, RTEL1 or FUBP1), and purpose is to identify the most effective sequence in this nucleic acid molecule library.In certain embodiments, nucleic acid molecule library is the nucleic acid molecule design variant (daughter nucleic acid molecule) library of parental or ancestral generation nucleic acid molecule, and wherein nucleic acid molecule design variant retains the core core base sequence of parental generation nucleic acid molecule.

[0228] Nucleobases

[0229] The term "nucleobase" includes purines (e.g., adenine and guanine) and pyrimidines (e.g., uracil, thymine, and cytosine) present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term "nucleobase" also includes modified nucleobases, which may be different from naturally occurring nucleobases, but are functional during nucleic acid hybridization. In this context, "nucleobase" refers to naturally occurring nucleobases, such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012), Accounts of Chemical Research, Vol. 45, p. 2055, and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Supplement 37 1.4.1.

[0230] In some embodiments, the nucleobase moiety is modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolecytosine, 5-propynylcytosine, 5-propynyluracil, 5-bromouracil, 5-thiazoleuracil, 2-thiouracil, 2'thiothymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0231] The nucleobase moiety can be represented by the letter code for each corresponding nucleobase, such as A, T, G, C, or U, wherein each letter can optionally include functionally equivalent modified nucleobases. For example, in an exemplary oligonucleotide, the nucleobase moiety is selected from A, T, G, C, and 5-methylcytosine. Optionally, for LNA spacers, 5-methylcytosine LNA nucleosides can be used.

[0232] Nucleotides and nucleosides

[0233] Nucleotide and nucleoside are the components of oligonucleotide and polynucleotide, and for the purposes of the present invention, comprise naturally occurring and non-naturally occurring nucleotide and nucleoside.In nature, nucleotide, such as DNA and RNA nucleotide comprises ribose sugar moiety, core base moiety and one or more phosphate groups (which are not present in nucleoside).Nucleoside and nucleotide also can be referred to as " unit " or " monomer " interchangeably.

[0234] patient

[0235] For the purposes of the present invention, a "subject" (or "patient") can be a vertebrate. In the context of the present invention, the term "subject" includes humans and other animals, particularly mammals and other organisms. Therefore, the means and methods provided herein are suitable for human treatment and veterinary applications. Therefore, the subject herein can be an animal, such as a mouse, rat, hamster, rabbit, guinea pig, ferret, cat, dog, chicken, sheep, bovine, horse, camel or primate. Preferably, the subject is a mammal. More preferably, the subject is a human. In some embodiments, the patient suffers from a disease as referred to herein, such as HBV infection. In some embodiments, the patient is susceptible to the disease.

[0236] Pharmaceutical composition

[0237] In another aspect, the present invention provides a pharmaceutical composition comprising an oligonucleotide for use in the present invention and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. Pharmaceutically acceptable diluents include phosphate buffered saline (PBS), and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0238] The present invention provides a pharmaceutical composition according to the present invention, wherein the pharmaceutical composition comprises an oligonucleotide useful in the present invention and an aqueous diluent or solvent.

[0239] The present invention provides solutions of the oligonucleotides of the combination of the invention, such as phosphate buffered saline solutions. Suitably, the solutions of the invention, such as phosphate buffered saline solutions, are sterile solutions.

[0240] WO 2007 / 031091 (incorporated herein by reference) provides suitable and preferred examples of pharmaceutical diluents, carriers and adjuvants. Suitable dosages, formulations, routes of administration, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations are also provided in WO 2007 / 031091.

[0241] The oligonucleotides used in the present invention can be mixed with pharmaceutically active or inert substances to prepare pharmaceutical compositions or formulations. The composition and formulation of the pharmaceutical composition depend on many criteria, including but not limited to the route of administration, the extent of the disease or the dosage administered.

[0242] In some embodiments, the oligonucleotides or oligonucleotide conjugates useful in the present invention are prodrugs. In particular, for oligonucleotide conjugates, once the prodrug is delivered to the site of action, such as a target cell, the conjugate portion of the oligonucleotide is cleaved.

[0243] medicinal salts

[0244] The term "pharmaceutical salts" refers to salts that retain the biological effectiveness and characteristics of free alkali or free acid, which are not biologically or otherwise undesirable. These salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid (particularly hydrochloric acid) and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, N-acetylcysteine. In addition, these salts can be prepared by adding inorganic bases or organic bases to the free acid. Salts derived from inorganic bases include but are not limited to sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, including substituted amines of naturally occurring substituted amines, cyclic amines, and basic ion exchange resins such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, and polyamine resins. The compounds of formula (I) may also exist in the form of zwitterions. Particularly preferred pharmaceutically acceptable salts of the compounds of formula (I) are salts of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and methanesulfonic acid.

[0245] prevention

[0246] The terms "prevent", "prevent" or "prevent" as used herein refer to preventative treatment, i.e., measures or procedures whose purpose is to prevent rather than cure a disease. Prevention refers to obtaining a desired pharmacological and / or physiological effect that has a preventative effect in completely or partially preventing a disease or symptom. Thus, "preventing HBV infection" as used herein includes preventing the occurrence of HBV infection in a subject, as well as preventing the occurrence of symptoms of HBV infection. In the present invention, prevention of HBV infection in children from HBV-infected mothers is particularly contemplated. Prevention of the transition from acute HBV infection to chronic HBV infection is also contemplated.

[0247] Region D' or D" in the oligonucleotide

[0248] In some embodiments, the oligonucleotides of the combinations of the present invention may comprise or consist of a contiguous nucleotide sequence of an oligonucleotide complementary to a target nucleic acid, such as the spacer FG-F', and additional 5' and / or 3' nucleosides. The additional 5' and / or 3' nucleosides may or may not be fully complementary to the target nucleic acid. Such additional 5' and / or 3' nucleosides may be referred to herein as regions D' and D".

[0249] For the purpose of joining a contiguous nucleotide sequence (such as a spacer) to a conjugate moiety or another functional group, an additional region D' or D" can be used. When used to join a contiguous nucleotide sequence to a conjugate moiety, it can serve as a biocleavable linker. Alternatively, it can be used to provide exonuclease protection or facilitate synthesis or manufacturing.

[0250] Regions D' and D'' can be attached to the 5' end of region F or the 3' end of region F', respectively, to generate the following formulas: D'-FG-F', FG-F'-D'' or

[0251] In this case, FG-F' is the spacer portion of the oligonucleotide, while the regions D' or D'' constitute separate parts of the oligonucleotide.

[0252] Region D' or D" may independently comprise or consist of 1, 2, 3, 4 or 5 additional nucleotides, which may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides, such as DNA or RNA or base-modified forms of these. The D' or D" region may be used as a nuclease-sensitive biocleavable linker (see definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked with a phosphodiester bond and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as region D' or D" are disclosed in WO2014 / 076195, including, for example, phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in poly-oligonucleotide constructs is disclosed in WO2015 / 113922, wherein they are used to link multiple antisense constructs (e.g., gapmer regions) within a single oligonucleotide.

[0253] In one embodiment, the oligonucleotide of the combination of the present invention further comprises a region D' and / or D" in addition to the continuous nucleotide sequence constituting the gapmer.

[0254] In some embodiments, the oligonucleotides of the present invention can be represented by the following formula:

[0255] FG-F'; especially F 1-8 -G 5-16 -F' 2-8

[0256] D'-FG-F', especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8

[0257] FG-F'-D", especially F 1-8 -G 5-16 -F' 2-8 -D" 1-3

[0258] D'-FG-F'-D", especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8 -D" 1-3

[0259] In some embodiments, the internucleoside linkage between region D' and region F is a phosphodiester linkage. In some embodiments, the internucleoside linkage between region F' and region D' is a phosphodiester linkage.

[0260] RNAi molecules

[0261] As used herein, the term "RNA interference (RNAi) molecule" refers to an oligonucleotide based on short double-stranded RNA that can induce RNA-dependent gene silencing via the RNA-induced silencing complex (RISC) in the cytoplasm, wherein they interact with the catalytic RISC component AGO (argonaute). RNAi molecules regulate. For example, the expression of a target nucleic acid in a cell is suppressed. For example, cells in a subject's body. For example, mammals. One type of RNAi molecule is small interfering RNA (siRNA), which is a double-stranded RNA molecule consisting of two complementary oligonucleotides, in which the binding of one chain to the complementary mRNA after transcription leads to its degradation and translation loss. Small hairpin RNA (shRNA) is an oligonucleotide based on single-stranded RNA that can form a stem-loop (hairpin) structure that can reduce mRNA via DICER and RNA-reducing silencing complex (RISC). RNAi molecules can be designed based on the sequence of the target gene (target nucleic acid). The corresponding RNAi can then be chemically synthesized or synthesized by in vitro transcription, or expressed from a vector or PCR product.

[0262] RNase H activity and recruitment

[0263] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when forming a duplex with a complementary RNA molecule. WO 01 / 23613 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. If an oligonucleotide, when providing a complementary target nucleic acid sequence, has an initial rate (in pmol / l / min) measured using the methods provided in Examples 91 to 95 of WO 01 / 23613 (incorporated herein by reference), of at least 5%, such as at least 10% or more than 20%, of the initial rate measured when using an oligonucleotide having the same base sequence as the modified oligonucleotide being tested but containing only DNA monomers having phosphorothioate bonds between all monomers in the oligonucleotide, then it is generally considered to be able to recruit RNase H. For use in determining RNase H activity, a sample obtained from Creative (Recombinant human RNase HI fused to a His tag expressed in E. coli) Recombinant human RNase HI was obtained.

[0264] shRNA

[0265] Short hairpin RNA or shRNA molecules are typically between 40 and 70 nucleotides in length, such as between 45 and 65 nucleotides, such as between 50 and 60 nucleotides, and form a stem-loop (hairpin) RNA structure that can interact with an endonuclease called Dicer. It is believed that Dicer processes dsRNA into short interfering RNAs of 19-23 base pairs with characteristic two-base 3' overhangs, which are then incorporated into the RNA-induced silencing complex (RISC). After binding to the appropriate target mRNA, one or more endonucleases within RISC cleave the target to induce silencing. RNAi oligonucleotides can be chemically modified using modified internucleotide linkages and 2' sugar modified nucleosides, such as 2'-4' bicyclic ribose modified nucleosides (including LNA and cET) or 2' substituted modifications, such as 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA.

[0266] In certain embodiments, the shRNA nucleic acid molecule comprises one or more phosphorothioate nucleoside bonds. In RNAi molecules, the phosphorothioate nucleoside bonds can be reduced or subjected to nuclease cleavage in RICS, so it is preferred that not all nucleoside bonds in the shRNA molecule stem loop are modified. The phosphorothioate nucleoside bonds can preferably be located at the 3' and / or 5' ends of the shRNA molecule stem loop, particularly at a portion of a molecule that is not complementary to the target nucleic acid (e.g., a sense strand or a passenger strand in the siRNA molecule). However, the region of the shRNA molecule that is complementary to the target nucleic acid can also be modified in the first 2 to 3 nucleoside bonds that are expected to become 3' and / or 5' terminal portions after Dicer cutting.

[0267] siRNA

[0268] The term siRNA refers to a small interfering RNA (RNAi) molecule. It is a type of double-stranded RNA molecule, also known in the art as short interfering RNA or silencing RNA. siRNA typically comprises a sense strand (also known as a passenger strand) and an antisense strand (also known as a leader strand), each strand being 17–30 nucleotides in length, typically 19–25 nucleosides, wherein the antisense strand is complementary (such as at least 95% complementary, such as fully complementary) to the target nucleic acid (suitably a mature mRNA sequence), and the sense strand is complementary to the antisense strand, such that the sense and antisense strands form a duplex or duplex region. The siRNA strands may form blunt-ended duplexes, or preferably, the 3' ends of the sense and antisense strands may form 3' overhangs, such as 1, 2, or 3 nucleosides, similar to products produced by Dicer, which may form RISC substrates in vivo. Effective extended forms of Dicer substrates have been described in US Pat. No. 8,349,809 and US Pat. No. 8,513,207, which are incorporated herein by reference. In some embodiments, both the sense and antisense strands have 2 nt 3' overhangs.Thus, the duplex region can be, for example, 17-25 nucleotides in length, such as 21-23 nucleotides in length.

[0269] Once inside the cell, the antisense strand is incorporated into the RISC complex, which mediates target degradation or target inhibition of the target nucleic acid. siRNA, in addition to RNA nucleosides, generally also includes modified nucleosides. In one embodiment, siRNA molecules can be chemically modified using modified internucleotide bonds and 2' sugar-modified nucleosides, such as 2'-4' bicyclic ribose-modified nucleosides (including LNA and cET) or 2' substituted modifications, such as 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-DNA, arabinose nucleic acid (ANA), 2'-fluoro-ANA. In particular, 2' fluoro, 2'-O-methyl or 2'-O-methoxyethyl can be incorporated into siRNA.

[0270] In certain embodiments, all nucleotides of siRNA sense (passenger) chain can be modified with 2' sugar-modified nucleosides such as LNA (for example, see WO2004 / 083430, WO2007 / 085485). In certain embodiments, the passenger chain of siRNA can be discontinuous (for example, see WO2007 / 107162). It has been reported that the incorporation of heat-destabilized nucleotides occurring in the seed region of the antisense strand of siRNA can be used to reduce the off-target activity of siRNA (for example, see WO2018 / 098328). Suitably, siRNA includes 5' phosphate groups or 5'-phosphate mimics at the 5' end of the antisense strand. In certain embodiments, the 5' end of the antisense strand is RNA nucleoside.

[0271] In one embodiment, the siRNA molecule further comprises at least one phosphorothioate or methylphosphonate internucleoside bond. The internucleoside bond of phosphorothioate or methylphosphonate can be on the 3'-end of one or two chains (e.g., antisense strand; or sense strand); or the internucleoside bond of phosphorothioate or methylphosphonate can be on the 5'-end of one or two chains (e.g., antisense strand; or sense strand); or the internucleoside bond of phosphorothioate or methylphosphonate can be on the 5'- and 3'-end of one or two chains (e.g., antisense strand; or sense strand). In certain embodiments, the remaining internucleoside bond is a phosphodiester bond. In certain embodiments, the siRNA molecule comprises one or more phosphorothioate internucleoside bonds. In the siRNA molecule, the phosphorothioate internucleoside bond may be reduced or subjected to nuclease cleavage in RICS, so it is preferred that not all internucleoside bonds in the antisense strand are modified.

[0272] The siRNA molecule may further comprise a ligand. In some embodiments, the ligand is conjugated to the 3' end of the sense strand.

[0273] For biodistribution, for example, siRNA can be conjugated to targeting ligands and / or formulated into lipid nanoparticles.

[0274] Other aspects of the invention relate to pharmaceutical compositions comprising these dsRNAs, such as siRNA molecules suitable for therapeutic use, and methods of reducing target gene expression by administering dsRNA molecules (such as the combined siRNAs of the invention), e.g., for treating various diseases as disclosed herein.

[0275] Sugar modification

[0276] The oligomers of the combinations of the invention may comprise one or more nucleosides having modified sugar moieties, ie, modifications of the sugar moieties compared to the ribose moieties found in DNA and RNA.

[0277] A number of modified nucleosides having a ribose sugar moiety have been prepared, primarily with the goal of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0278] In some embodiments, the present invention relates to a ribose ring structure that is modified by a hexose ring (HNA) or a dicyclo (LNA) with a diradical bridge between the C2 and C4 carbon on the ribose ring or a non-connected ribose ring (such as UNA) that lacks a key between the C2 and C3 carbon. Other sugar-modified nucleosides include, for example, dicyclohexose nucleic acids (WO2011 / 017521) or tricyclic nucleic acids (WO2013 / 154798). The nucleosides of modification also include nucleosides in which sugar moieties are replaced by non-sugar moieties, such as in the case of peptide nucleic acids (PNA) or morpholino nucleic acids.

[0279] Sugar modifications also include modifications by changing the substituents on the ribose ring to groups other than hydrogen or the 2'-OH groups naturally present in DNA and RNA nucleosides. For example, a substituent can be introduced at the 2', 3', 4' or 5' position.

[0280] target cells

[0281] As used herein, the term "target cell" refers to a cell expressing a target nucleic acid. For therapeutic uses of the present invention, it is preferred if the target cell is infected with HBV. In some embodiments, the target cell can be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell such as a rodent cell, such as a mouse cell or a rat cell or a woodchuck cell, or a primate cell, such as a monkey cell (e.g., a cynomolgus monkey cell) or a human cell.

[0282] In preferred embodiments, the target cells express RTEL1 and / or FUBP1 mRNA, such as precursor mRNA or mature mRNA. Preferably, the target cells express both RTEL1 and FUBP1 mRNA, such as precursor mRNA or mature mRNA. For antisense oligonucleotide targeting, the polyadenosine (poly A) tail of RTEL1 and / or FUBP1 mRNA is generally not considered.

[0283] Typically, the target cell expresses RTEL1 mRNA, such as RTEL1 precursor mRNA or RTEL1 mature mRNA. For experimental evaluation, target cells expressing a nucleic acid comprising a target sequence (such as human RTEL1 precursor mRNA, e.g., SEQ ID NO: 1) can be used. For antisense oligonucleotide targeting, the polyadenosine (poly A) tail of RTEL1 mRNA is generally not considered.

[0284] The combinations of the present invention are generally capable of inhibiting expression of a RTEL1 target nucleic acid in a cell expressing the RTEL1 target nucleic acid (target cell), for example in vivo or in vitro.

[0285] Typically, the target cell also expresses FUBP1 mRNA, such as FUBP1 precursor mRNA or FUBP1 mature mRNA. For example, the target cell expresses human FUBP1 precursor mRNA (e.g., SEQ ID NO 247), or human FUBP1 mature mRNA comprising exon 14 (such as SEQ ID NO: 249 or 250) or exon 20 of SEQ ID NO 247. For experimental evaluation, target cells expressing nucleic acids comprising the target sequence can be used. Antisense oligonucleotides are generally not thought to target the polyadenosine tail of FUBP1 mRNA. The combinations of the present invention are generally capable of inhibiting expression of a FUBP1 target nucleic acid in a target cell expressing the FUBP1 target nucleic acid, e.g., in vivo or in vitro.

[0286] In addition, the target cell can be a hepatocyte.In one embodiment, the target cell is a primary human hepatocyte infected with HBV, which is derived from an HBV infected person or an HBV infected mouse with a humanized liver (PhoenixBio, PXB-mouse).

[0287] According to the present invention, the target cells may be infected with HBV. In addition, the target cells may contain HBV cccDNA. Therefore, the target cells preferably contain RTEL1 and / or FUBP1 mRNA, such as precursor mRNA or mature mRNA, and HBV cccDNA. More preferably, the target cells contain both RTEL1 and FUBP1 mRNA, such as precursor mRNA or mature mRNA, and HBV cccDNA.

[0288] RTEL1 target nucleic acid

[0289] According to the present invention, the target nucleic acid is a nucleic acid encoding mammalian RTEL1 and can be, for example, a gene, RNA, mRNA and pre-mRNA, mature mRNA or cDNA sequence. The target can therefore be referred to as an RTEL1 target nucleic acid.

[0290] Oligonucleotides for use in the present invention can, for example, target the exon region of mammalian RTEL1 (particularly siRNA and shRNA target exon region, but also antisense oligonucleotides), or can, for example, target the intron region in RTEL1 pre-mRNA (particularly antisense oligonucleotide target intron region). The human RTEL1 gene encodes 15 transcripts, 7 of which are protein-coding and are therefore potential nucleic acid targets.

[0291] Table 1 lists the predicted exon and intron regions of seven transcripts located on the human RTEL1 pre-mRNA of SEQ ID NO: 1. It should be understood that the oligonucleotides for use in the present invention may target the mature mRNA sequence of one or more transcripts listed in Table 1.

[0292] Table 1. Transcribed regions, exon regions, and intron regions in human RTEL1 pre-mRNA (SEQ ID NO: 1) encoding different proteins in RTEL1 mRNA transcripts

[0293]

[0294]

[0295]

[0296]

[0297] Suitably, the target nucleic acid encodes a RTEL1 protein, in particular a mammalian RTEL1, such as a human RTEL1 (see for example Table 2 and Table 3), which provides the pre-mRNA sequence of human and monkey RTEL1.

[0298] In some embodiments, the target nucleic acid is selected from SEQ ID NO: 1 and / or SEQ ID NO: 2 or naturally occurring variants thereof (eg, sequences encoding mammalian RTEL1 proteins in Table 1).

[0299] If the combination of the invention is employed in research or diagnostics, the target nucleic acid may be cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0300] For in vivo or in vitro applications, the combination of the present invention is generally capable of inhibiting the expression of the RTEL1 target nucleic acid in cells expressing the RTEL1 target nucleic acid. The contiguous sequence of nucleobases of the oligonucleotides of the combination of the present invention is generally complementary to the RTEL1 target nucleic acid, as measured over the length of the entire oligonucleotide, optionally except for one or two mismatches, and optionally excluding nucleotide-based linkers that can connect the oligonucleotide to optional functional groups, such as conjugates or other non-complementary terminal nucleotides (e.g., region D' or D"). In some embodiments, the target nucleic acid can be RNA or DNA, such as messenger RNA, such as mature mRNA (e.g., exon regions of the transcripts listed in Table 1), or pre-mRNA.

[0301] In some embodiments, the target nucleic acid is RNA or DNA encoding a mammalian RTEL1 protein, such as human RTEL1, for example, a human RTEL1 mRNA sequence, such as the target nucleic acid disclosed as SEQ ID NO 1. Tables 2 and 3 provide more information on exemplary target nucleic acids.

[0302] Table 2. Genomic and assembly information of RTEL1 from multiple species.

[0303]

[0304] Fwd = forward strand. Genomic coordinates provide the pre-mRNA sequence (genomic sequence). NCBI reference provides the mRNA sequence (cDNA sequence).

[0305] Table 3. Sequence details of RTEL1 across species.

[0306] species RNA type Length (nt) SEQ ID NO people pre-mRNA 38444 1 monkey pre-mRNA 37214 2

[0307] Note that SEQ ID NO 2 contains multiple NNNN regions where sequencing could not accurately refine the sequence and therefore contains a degenerate sequence. For the avoidance of doubt, the compounds for use in the present invention are complementary to the actual target sequence and therefore are not degenerate compounds.

[0308] In some embodiments, the target nucleic acid is SEQ ID NO 1.

[0309] In some embodiments, the target nucleic acid is SEQ ID NO 2.

[0310] FUBP1 target nucleic acid

[0311] According to the present invention, the target nucleic acid is a nucleic acid encoding mammalian FUBP1 and can be, for example, a gene, RNA, mRNA and pre-mRNA, mature mRNA or cDNA sequence. The target can therefore be referred to as a FUBP1 target nucleic acid.

[0312] Suitably, the target nucleic acid encodes a FUBP1 protein, particularly a mammalian FUBP1, such as a pre-mRNA encoded by the human FUBP1 gene or the mRNA sequences provided herein as SEQ ID NO: 247, 249 and / or 250. SEQ ID NO: 247 is the sequence of human FUBP1 pre-mRNA. SEQ ID NO: 249 and 250 are the sequences of human FUBP1 mRNA.

[0313] The nucleic acid molecules of the combination of the present invention can, for example, target the exon region of mammalian FUBP1 (particularly siRNA and shRNA, but also antisense oligonucleotides), or can, for example, target any intron region in the FUBP1 pre-mRNA (particularly antisense oligonucleotides). Table 4 lists the predicted exon and intron regions of SEQ ID NO: 247.

[0314] Table 4. Exonic and intronic regions in human FUBP1 pre-mRNA.

[0315]

[0316]

[0317] Suitably, the target nucleic acid encodes a FUBP1 protein, in particular a mammalian FUBP1, such as human FUBP1 (see, for example, Tables 5 and 6), which provide the genomic sequence, mature mRNA and pre-mRNA sequences of human, monkey and mouse FUBP1.

[0318] In some embodiments, the target nucleic acid can be a cynomolgus monkey FUBP1 nucleic acid, such as an mRNA or pre-mRNA.

[0319] In some embodiments, the target nucleic acid can be a mouse FUBP1 nucleic acid, such as mRNA or pre-mRNA.

[0320] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265 and / or 266, or naturally occurring variants thereof (e.g., a sequence encoding mammalian FUBP1).

[0321] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 247, 251 and / or 255, or naturally occurring variants thereof (eg, a sequence encoding mammalian FUBP1).

[0322] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 247 and 251 or naturally occurring variants thereof (eg, a sequence encoding mammalian FUBP1).

[0323] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 247-254 or naturally occurring variants thereof (eg, a sequence encoding mammalian FUBP1).

[0324] In some embodiments, the target nucleic acid is RNA or DNA encoding a mammalian FUBP1 protein (such as human FUBP1), for example, a human FUBP1 mRNA sequence, such as disclosed in SEQ ID NO 247. Tables 5 and 6 provide more information on exemplary target nucleic acids.

[0325] Table 5. Genomic and assembly information of FUBP1 from multiple species.

[0326]

[0327] Fwd = forward strand. Rv = reverse strand. Genomic coordinates provide the pre-mRNA sequence (genomic sequence).

[0328] If the nucleic acid molecules for use in the present invention are employed in research or diagnostics, the target nucleic acid may be cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0329] For in vivo or in vitro applications, the therapeutic nucleic acid molecule is generally capable of inhibiting the expression of a FUBP1 target nucleic acid in a cell expressing the FUBP1 target nucleic acid. The contiguous sequence of nucleobases of the nucleic acid molecule is generally complementary to a conserved region of the FUBP1 target nucleic acid, as measured over the entire nucleotide length, optionally with the exception of one or two mismatches, and optionally excluding a nucleotide-based linker region that can connect the oligonucleotide to an optional functional group (such as a conjugate) or other non-complementary terminal nucleotides.

[0330] The target nucleic acid can be a messenger RNA, such as a pre-mRNA encoding a mammalian FUBP1 protein, such as human FUBP1, such as a human FUBP1 pre-mRNA sequence, such as the sequence disclosed as SEQ ID NO: 247, a cynomolgus monkey FUBP1 pre-mRNA sequence, such as the sequence disclosed as SEQ ID NO: 251, or a mouse FUBP1 pre-mRNA sequence, such as the sequence disclosed as SEQ ID NO: 255, or a mature FUBP1 mRNA, such as the human mature mRNA disclosed as SEQ ID NOs: 248, 249, and 250. SEQ ID NOs: 247-266 are DNA sequences—it will be understood that the target RNA sequences have uracil (U) bases instead of thymidine bases (T).

[0331] Table 6 provides additional information about exemplary target nucleic acids.

[0332] Table 6. Sequence details of FUBP1 across species.

[0333] species RNA type Length (nt) SEQ ID NO people pre-mRNA 305056 247 people mature mRNA 696 248 people mature mRNA 1968 249 people mature mRNA 1935 250 cynomolgus macaque pre-mRNA 39750 251 cynomolgus macaque mature mRNA 1968 252 cynomolgus macaque mature mRNA 6825 253 cynomolgus macaque mature mRNA 1959 254 mice pre-mRNA 26405 255 mice mature mRNA 4525 256 mice mature mRNA 800 257 mice mature mRNA 2526 258 mice mature mRNA 809 259 mice mature mRNA 1040 260 mice mature mRNA 796 261 mice mature mRNA 585 262 mice mature mRNA 2374 263 mice mature mRNA 3163 264 mice mature mRNA 6523 265 mice mature mRNA 2552 266

[0334] Note that SEQ ID NO 251 contains multiple NNNN regions where sequencing could not accurately refine the sequence and therefore contains a degenerate sequence. For the avoidance of doubt, the compounds of the combinations of the present invention are complementary to the actual target sequence and therefore are not degenerate compounds.

[0335] Target sequence

[0336] Term used herein " target sequence " refers to the sequence of the nucleotide present in the target nucleic acid, and it comprises and is complementary core base sequence with the oligonucleotide for using in the present invention.In certain embodiments, target sequence is made up of the region with the core base sequence complementary with the continuous nucleotide sequence of the oligonucleotide for using in the present invention on the target nucleic acid.This region of target nucleic acid can be referred to as target nucleotide sequence, target sequence or target region interchangeably.In certain embodiments, target sequence is longer than the complementary sequence of single oligonucleotide, and can for example represent the preferred region of target nucleic acid, and it can be targeted by several oligonucleotides.

[0337] RTEL1 target sequence

[0338] In some embodiments, the target sequence is a sequence selected from the group consisting of human RTEL1 mRNA exons, such as selected from the human RTEL1 mRNA exons listed in Table 1 above.

[0339] In some embodiments, the target sequence is a sequence selected from the group consisting of human RTEL1 mRNA introns, such as selected from the human RTEL1 mRNA introns listed in Table 1 above.

[0340] Oligonucleotides for use in the present invention comprise a contiguous nucleotide sequence that is complementary to or hybridizes to a target nucleic acid, such as a target sequence described herein.

[0341] The target sequence complementary to or hybridizing with the oligonucleotide generally comprises a continuous nucleobase sequence of at least 10 nucleotides. The continuous nucleotide sequence is between 10 and 35 nucleotides, such as 12 to 30, such as 14 to 20, such as 16 to 20 continuous nucleotides. In one embodiment of the present invention, the target sequence is selected from the group consisting of SEQ ID NO: 3-26, as shown in Table 7.

[0342] Table 7: Target sequence on human RTEL1 pre-mRNA (SEQ ID NO: 1)

[0343]

[0344]

[0345] In some embodiments, the target sequence is SEQ ID NO:5.

[0346] In some embodiments, the target sequence is SEQ ID NO:13.

[0347] In some embodiments, the target sequence is SEQ ID NO:14.

[0348] In some embodiments, the target sequence is SEQ ID NO:15.

[0349] In some embodiments, the target sequence is SEQ ID NO:16.

[0350] SEQ ID NO:5:GAGATTCAAGTTATAATAAAAG

[0351] SEQ ID NO 13:TTTGACCAGAGTAGTAAAATT

[0352] SEQ ID NO:14:TTTGACCAGAGTATGTAA

[0353] SEQ ID NO:15:GACCAGAGTATGTAAAATT

[0354] SEQ ID NO 16:ACCAGAGTATGTAAAATT

[0355] SEQ ID NOs: 3 to 26 are DNA sequences - it will be understood that the target RNA sequences have uracil (U) bases instead of thymidine bases (T).

[0356] The target sequences shown in SEQ ID NOs: 13 to 16 can be found in intron 8 of human RTEL1. The target sequence shown in SEQ ID No: 5 can be found in intron 7 of human RTEL1.

[0357] In some embodiments, the target sequence is the region from nucleotides 11753 to 11774 of SEQ ID NO:1.

[0358] In some embodiments, the target sequence is the region from nucleotides 11757 to 11774 of SEQ ID NO:1.

[0359] In some embodiments, the target sequence is the region of nucleotides 11756 to 11774 of SEQ ID NO:1.

[0360] In some embodiments, the target sequence is the region from nucleotides 11753 to 11770 of SEQ ID NO:1.

[0361] In some embodiments, the target sequence is the region of nucleotides 8681 to 8701 of SEQ ID NO:1.

[0362] In some embodiments, the target sequence is selected from the region shown in Table 8A or Table 8B.

[0363] Table 8A: Regions of SEQ ID NO 1 that can be targeted using oligonucleotides for use in the present invention

[0364]

[0365]

[0366]

[0367]

[0368]

[0369]

[0370]

[0371]

[0372] Table 8B: Regions of SEQ ID NO 1 that can be targeted using oligonucleotides for use in the present invention

[0373]

[0374] FUBP1 target sequence

[0375] In some embodiments, the target sequence is a sequence selected from the group consisting of human FUBP1 mRNA exons, such as a FUBP1 human mRNA exon selected from the group consisting of e1, e2, e3, e4, e5, e6, e7, e8, e9, e10, e11, e12, 13, e14, e15, e16, e17, e18, e19, and e20 (see, e.g., Table 4 above).

[0376] In one embodiment, the target sequence is a sequence selected from the group consisting of: one or more of human FUBP1 mRNA exons selected from the group consisting of exons 9, 10, 12, 14, and 20.

[0377] In some embodiments, the target sequence is a sequence selected from the group consisting of human FUBP1 mRNA introns, such as a FUBP1 human mRNA intron selected from the group consisting of i1, i2, i3, i4, i5, i6, i7, i9, i10, i11, i12, i3, i14, i15, i16, i17, i18, and i19 (see, e.g., Table 4 above).

[0378] The nucleic acid molecules of the compositions of the present invention comprise a contiguous nucleotide sequence that is complementary to or hybridizes to a region on a target nucleic acid, such as a target sequence described herein.

[0379] In one embodiment, the target sequence is exon 14 of human FUBP1 mRNA (see Table 4 above).

[0380] In another embodiment, the target sequence is exon 20 of human FUBP1 mRNA (see Table 4 above).

[0381] The combined antisense oligonucleotides of the invention comprise a contiguous nucleotide sequence that is complementary to or hybridizes to a region on a target nucleic acid, such as a target sequence described herein.

[0382] Provided herein below are target sequence regions as defined by regions of the human FUBP1 pre-mRNA (using SEQ ID NO 247 as a reference) that can be targeted by the combined oligonucleotides of the present invention.

[0383] The oligonucleotides of the combinations of the invention comprise a contiguous nucleotide sequence that is complementary to or hybridizes to a target nucleic acid, such as a subsequence of a target nucleic acid, such as a target sequence described herein.

[0384] The target nucleic acid sequence that is complementary or hybridizes to the therapeutic nucleic acid molecule typically comprises a continuous nucleobase of at least 10 nucleotides. The continuous nucleotide sequence (and therefore the target sequence) comprises at least 12 continuous nucleotides, such as 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 nucleotides, such as 14 to 20 continuous nucleotides, such as 14 to 18 continuous nucleotides.

[0385] The inventors have identified particularly efficient sequences of FUBP1 target nucleic acids that can be targeted by the combined oligonucleotides of the present invention.

[0386] In some embodiments, the target sequence is SEQ ID NO:267.

[0387] In some embodiments, the target sequence is SEQ ID NO:268.

[0388] In some embodiments, the target sequence is SEQ ID NO:269.

[0389] In some embodiments, the target sequence is SEQ ID NO:270.

[0390] In some embodiments, the target sequence is SEQ ID NO:347.

[0391] SEQ ID NO:267:gtgaaaccataaaaagcataag

[0392] SEQ ID NO:268:AACCATAAAAAGCATAAG

[0393] SEQ ID No:269:gtgaaaccataaaaagcata

[0394] SEQ ID NO:270:GTAGAAATGAAAATTGGT

[0395] SEQ ID NO:347:GACTATGGTTATGGGG

[0396] SEQ ID NOs: 267, 268, 269, 270 and 347 are DNA sequences - it will be understood that the target RNA sequences have uracil (U) bases in place of thymidine bases (T).

[0397] The present invention provides an antisense oligonucleotide comprising a continuous nucleotide sequence that is complementary (such as completely complementary) to the region from nucleotides 16184 to 16205 of human FUBP1 pre-mRNA (as shown in SEQ ID NO: 247).

[0398] The present invention provides an antisense oligonucleotide comprising a continuous nucleotide sequence that is complementary (such as completely complementary) to the region from nucleotides 16188 to 16205 of human FUBP1 pre-mRNA (as shown in SEQ ID NO: 247).

[0399] The present invention provides an antisense oligonucleotide comprising a continuous nucleotide sequence that is complementary (such as completely complementary) to the region from nucleotides 16184 to 16203 of human FUBP1 pre-mRNA (as shown in SEQ ID NO: 247).

[0400] The present invention also provides an antisense oligonucleotide comprising a continuous nucleotide sequence that is complementary (such as completely complementary) to the region from nucleotides 30536 to 30553 of human FUBP1 pre-mRNA (as shown in SEQ ID NO: 247).

[0401] The present invention also provides an antisense oligonucleotide comprising a continuous nucleotide sequence that is complementary (such as completely complementary) to the region from nucleotides 9141 to 9156 of human FUBP1 pre-mRNA (as shown in SEQ ID NO: 247).

[0402] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is complementary, such as fully complementary, to a region of nucleotides 16184 to 16200 of SEQ ID NO: 247.

[0403] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is complementary, such as fully complementary, to a region of nucleotides 16186 to 16203 of SEQ ID NO: 247.

[0404] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is complementary, such as fully complementary, to a region of nucleotides 16189 to 16205 of SEQ ID NO: 247.

[0405] In some embodiments, the target sequence is the region from nucleotides 16184 to 16200 of SEQ ID NO:247.

[0406] In some embodiments, the target sequence is the region of nucleotides 16186 to 16203 of SEQ ID NO:247.

[0407] In some embodiments, the target sequence is the region of nucleotides 16188 to 16205 of SEQ ID NO:247.

[0408] In some embodiments, the target sequence is the region of nucleotides 16189 to 16205 of SEQ ID NO:247.

[0409] target

[0410] As used herein, the term "target" may refer to the mammalian protein RTEL1 ("Telomere elongation helicase 1 regulator"), alternatively referred to as "KIAA1088" or "C20ORF41" or "Telomere length regulator" or "Telomere length regulator" or "Chromosome 20 open reading frame 41". The Homo sapiens RTEL1 gene is located at chromosome group 20, 63,657,810 to 63,696,253 (Homo sapiens updated annotation, version 109.20200228, GRCh38.p13). The RTEL1 protein is an ATP-dependent DNA helicase that is involved in telomere length regulation, DNA repair, and genomic stability maintenance. The amino acid sequence of human RTEL1 is known in the art and can be evaluated via UniProt, see UniProt entry Q9NZ71 for human RTEL1, incorporated herein by reference.

[0411] The term "target" as used herein may also refer to the mammalian protein "distal upstream element binding protein 1", alternatively referred to as "FUBP1" or "FBP" or "FUBP" or "hDH V". The Homo sapiens FUBP1 gene is located on chromosome 1, 77944055..77979435, complement (NC_000001.11, gene ID 1462). The FUBP1 gene encodes a ssDNA binding protein that activates the distal upstream element of c-myc and stimulates c-myc expression in undifferentiated cells. Regulation of FUSE by FUBP occurs through single-stranded binding of FUBP to the non-coding strand. The FUBP1 protein has ATP-dependent DNA helicase activity. The amino acid sequence of human FUBP1 is known in the art and can be assessed by UniProt, see, for example, UniProt entry Q96AE4 for human FUBP1, incorporated herein by reference.

[0412] Therapeutically effective dose

[0413] The term "therapeutically effective amount" means an amount of a compound-drug combination of the present invention that, when administered to a subject, (i) treats or prevents a particular disease, condition, or disorder, (ii) reduces, alleviates, or eliminates one or more symptoms of a particular disease, condition, or disorder, or (iii) prevents or delays the onset of one or more symptoms of a particular disease, condition, or disorder as described herein. The therapeutically effective amount depends on the compound, the disease state being treated, the severity of the disease being treated, the age and relative health of the subject, the route and form of administration, the judgment of the attending medical or veterinary doctor, and other factors.

[0414] treat

[0415] As used herein, the term "treatment" refers to the treatment of an existing disease (e.g., a disease or condition as referred to herein) or the prevention of a disease, i.e., prevention. It will therefore be appreciated that, in some embodiments, the treatment referred to herein may be preventative. Prevention may be understood as preventing HBV infection from becoming chronic HBV infection or preventing serious liver disease caused by chronic HBV infection, such as cirrhosis and hepatocellular carcinoma. DETAILED DESCRIPTION

[0416] HBV cccDNA in infected hepatocytes is responsible for persistent chronic infection and reactivation and is the template for all viral subgenomic transcripts and pregenomic RNA (pgRNA) to ensure that newly synthesized viral progeny and cccDNA pools are replenished by intracellular nuclear capsid recycling. In the context of the present invention, RTEL1 was shown for the first time to be associated with cccDNA stability. This understanding provides an opportunity for cccDNA destabilization in HBV-infected subjects, which in turn creates an opportunity for complete cure of chronically infected HBV patients.

[0417] For many years, overexpression and mutation of FUBP1 have been known to be associated with cancer. In particular, significant overexpression of FUBP1 in human hepatocellular carcinoma (HCC) supports tumor growth and is associated with poor patient prognosis. HBV cccDNA in infected hepatocytes is responsible for persistent chronic infection and reactivation, serving as a template for all viral subgenomic transcripts and pregenomic RNA (pgRNA) to ensure that the pool of newly synthesized viral progeny and cccDNA is replenished by intracellular nuclear capsid recycling. In the context of the present invention, it was shown for the first time that FUBP1 is associated with cccDNA stability. This understanding provides an opportunity for cccDNA destabilization in HBV-infected subjects, which in turn creates an opportunity for complete cure of chronically infected HBV patients. The roles of FUBP1 in HCC and cccDNA stability are expected to be different and independent of each other.

[0418] The present invention relates to a combination of two types of compounds: i) an inhibitor of RTEL1 and ii) an inhibitor of FUBP1 or a pharmaceutically acceptable salt thereof. Suitably, each compound is provided in the form of a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0419] Suitably, the combination according to the invention is for use in the treatment of hepatitis B virus infection and / or cancer, in particular in the treatment of patients suffering from chronic HBV infection.

[0420] In an embodiment, the combination of the present invention is a composition, pharmaceutical composition or kit comprising compound i) an inhibitor of RTEL1 and ii) an inhibitor of FUBP1 or a pharmaceutically acceptable salt thereof, preferably, each compound is provided in the form of a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0421] The present invention also relates to a method for treating or preventing a disease, which method comprises administering a combination according to the invention.

[0422] The invention also relates to the use of the combination according to the invention for the preparation of a medicament.

[0423] The present invention also relates to an in vivo or in vitro method for modulating the expression of RTEL1 and FUBP1 in a target cell expressing RTEL1 and FUBP1, said method comprising administering a combination according to the invention.

[0424] Below, each class of compounds in the combination will be described separately. However, it should be understood that at least one compound from each class is present in the combination. The compounds can be administered simultaneously or separately. The compounds in each class can be administered parenterally (such as intravenously, subcutaneously or intramuscularly) or enterally (such as orally or through the gastrointestinal tract).

[0425] RTEL1 inhibitors

[0426] In one aspect, the first class of compounds in the combination of the present invention is an inhibitor targeting RTEL1. Such inhibitors can be selected from the group consisting of, for example, small molecules, single-stranded antisense oligonucleotides; siRNA molecules; or shRNA molecules.

[0427] In this section, the term "oligonucleotide" should be understood as "oligonucleotide targeting RTEL1".

[0428] Therapeutic oligonucleotides may be excellent RTEL1 inhibitors because they can target RTEL1 transcripts and promote their degradation through the RNA interference pathway or through cleavage by RNase H. Alternatively, oligonucleotides such as aptamers can also act as inhibitors of RTEL1 protein interactions.

[0429] In one aspect, the first class of compounds in the combination of the present invention is an inhibitor targeting RTEL1. Such inhibitors can be selected from the group of oligonucleotides consisting of single-stranded antisense oligonucleotides; siRNA molecules; or shRNA molecules.

[0430] This section describes oligonucleotides or conjugates thereof of the present combination; and are suitable for use in treating and / or preventing hepatitis B virus (HBV) infection; such as chronic HBV viral infection, or treating cancer.

[0431] The oligonucleotides of the present invention are capable of inhibiting the expression of RTEL1 in vitro and in vivo. Inhibition is achieved by hybridizing the oligonucleotides to a target nucleic acid encoding RTEL1 or involved in RTEL1 regulation. The target nucleic acid can be a mammalian RTEL1 sequence, such as SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0432] In some embodiments of the invention, the oligonucleotide is capable of reducing cccDNA in infected cells.

[0433] In some embodiments, the oligonucleotides of the combination of the present invention can regulate the expression of the target by suppressing or down-regulating the expression of the target. Preferably, compared with the normal expression level of the target, this regulation produces at least 20% expression inhibition, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% inhibition compared with the normal expression level of the target. In some embodiments, 10 μM of oligonucleotides are used in PXB-PHH cells, and it is possible to suppress the expression level of RTEL1 mRNA by at least 60% or 70% in vitro. In some embodiments of the present invention, 10 μM of oligonucleotides are used in PXB-PHH cells, and it is possible to suppress the expression level of RTEL1 protein by at least 50% in vitro. In terms of selecting nucleic acid molecules with good correlation with cccDNA reduction, this range of target reduction is advantageous. Suitably, examples provide assays (such as Example 1) that can be used to measure RTEL1 RNA or protein inhibition. Target inhibition is triggered by hybridization between the continuous nucleotide sequence of the oligonucleotide and the target nucleic acid. In certain embodiments, the oligonucleotide comprises a mismatch between the oligonucleotide and the target nucleic acid. Despite the mismatch, hybridization with the target nucleic acid may still be sufficient to show desired RTEL1 expression inhibition. The binding affinity reduced by the mismatch can preferably be compensated by an increase in the number of nucleotides in the oligonucleotide and / or an increase in the number of modified nucleosides that can increase the binding affinity to the target, such as 2' sugar-modified nucleosides present in the oligonucleotide sequence, including LNA.

[0434] One aspect of the present invention relates to oligonucleotides of 12 to 60 nucleotides in length, comprising a contiguous nucleotide sequence of at least 10 nucleotides in length, such as at least 12 to 30 nucleotides in length, and at least 95% complementary, such as fully complementary, to a mammalian RTEL1 target nucleic acid, particularly a human RTEL1 nucleic acid. These oligonucleotides are capable of inhibiting the expression of RTEL1.

[0435] One aspect of the invention relates to oligonucleotides which are antisense oligonucleotides of 12 to 30 nucleotides in length comprising a contiguous nucleotide sequence of at least 10 nucleotides in length, such as 10 to 30 nucleotides, and which are at least 90% complementary, such as fully complementary, to mammalian RTEL1.

[0436] Another aspect of the invention relates to an oligonucleotide comprising a contiguous nucleotide sequence of 12 to 20 nucleotides, such as 15 to 22 nucleotides in length, which is at least 90% complementary, such as fully complementary, to the target nucleic acid of SEQ ID NO: 1.

[0437] In some embodiments, the oligonucleotide comprises a contiguous sequence of 10 to 30 nucleotides in length that is at least 90% complementary to a region or target sequence of the target nucleic acid, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98% or 100% complementary.

[0438] It is advantageous if the oligonucleotide or its contiguous nucleotide sequence for use in the present invention is fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments may contain one or two mismatches between the oligonucleotide and the target nucleic acid.

[0439] In some embodiments, the antisense oligonucleotide sequence is 100% complementary to the corresponding target nucleic acid of SEQ ID NO:1.

[0440] In some embodiments of the present invention, the oligonucleotides or contiguous nucleotide sequences of the combination of the present invention are at least 95% complementary to the target nucleic acids of SEQ ID NO: 1 and SEQ ID NO: 2, such as completely (or 100%) complementary.

[0441] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence of 15 to 22 nucleotides in length that is at least 90% complementary to the corresponding target sequence present in SEQ ID NO: 1, such as 100% complementary, wherein the target nucleic acid is selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO: 26 (Table 7) or region 1A to region 959A in Table 8A.

[0442] Table 8A: Regions of SEQ ID NO 1 that can be targeted using the combined oligonucleotides of the invention

[0443] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence of 16 to 20, such as 15 to 22, nucleotides in length that is at least 90% complementary, such as 100% complementary, to the corresponding target sequence present in SEQ ID NO: 1, wherein the target nucleic acid is selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO: 26 (Table 7) or region B1 to region B28 in Table 8B.

[0444] In some embodiments of the invention, the oligonucleotide comprises or consists of 12 to 60 nucleotides in length, such as 13 to 50, such as 14 to 35, such as 15 to 30, such as 16 to 20 consecutive nucleotides in length. In a preferred embodiment, the oligonucleotide comprises or consists of 15, 16, 17, 18, 19 or 20 nucleotides in length.

[0445] In some embodiments, the contiguous nucleotide sequence of the oligonucleotide complementary to the target nucleic acid comprises or consists of 12 to 30, such as 13 to 25, such as 15 to 23, such as 16 to 22, contiguous nucleotides in length.

[0446] In some embodiments, the contiguous nucleotide sequence of the siRNA or shRNA that is complementary to the target nucleic acid comprises or consists of 18 to 28, such as 19 to 26, such as 20 to 24, such as 21 to 23, contiguous nucleotides in length.

[0447] In some embodiments, the contiguous nucleotide sequence of the single-stranded antisense oligonucleotide that is complementary to the target nucleic acid comprises or consists of 12 to 22 consecutive nucleotides in length, such as 14 to 20, such as 16 to 20, such as 15 to 21, such as 15 to 18, such as 16 to 18, such as 16 to 17.

[0448] In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of the sequences listed in Table 9A.

[0449] In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length and is at least 90% identical, preferably 100% identical, to a sequence selected from the group consisting of SEQ ID NO: 27 to SEQ ID NO: 246 (see the motif sequences listed in Table 9A). In a specific embodiment, the oligonucleotide or contiguous nucleotide sequence is selected from SEQ ID NO: 27; 28; 29; 30; 31; 32; 33; 34; 37; 40; 41; 42; 43; 44; 45; 46; 47; 48; 51; 54; 88; 114; 135; 208; 237; 243; 244; 245 and 246.

[0450] In a specific embodiment, the oligonucleotide or contiguous nucleotide sequence is SEQ ID NO 243.

[0451] In a specific embodiment, the oligonucleotide or contiguous nucleotide sequence is SEQ ID NO 244.

[0452] In a specific embodiment, the oligonucleotide or contiguous nucleotide sequence is SEQ ID NO 245.

[0453] In a specific embodiment, the oligonucleotide or contiguous nucleotide sequence is SEQ ID NO 246.

[0454] It will be appreciated that the contiguous oligonucleotide sequence (motif sequence) may be modified, for example, to increase nuclease resistance and / or binding affinity to the target nucleic acid.

[0455] The pattern of incorporating modified nucleosides (eg, high affinity modified nucleosides) into an oligonucleotide sequence is often referred to as oligonucleotide design.

[0456] Oligonucleotides can be designed using modified nucleosides and RNA nucleosides (particularly for siRNA and shRNA molecules) or DNA nucleosides (particularly for single-stranded antisense oligonucleotides). Advantageously, high affinity modified nucleosides are used.

[0457] In one embodiment, the oligonucleotide comprises at least one modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 modified nucleosides. In one embodiment, the oligonucleotide comprises 1 to 10 modified nucleosides, such as 2 to 9 modified nucleosides, such as 3 to 8 modified nucleosides, such as 4 to 7 modified nucleosides, such as 6 or 7 modified nucleosides. Suitable modifications are described under "Modified Nucleosides", "High Affinity Modified Nucleosides", "Sugar Modifications", "2' Sugar Modifications" and "Locked Nucleic Acids (LNAs)" in the "Definitions" section.

[0458] In one embodiment, the oligonucleotide comprises one or more sugar-modified nucleosides, such as 2' sugar-modified nucleosides. Preferably, the oligonucleotide comprises one or more 2' sugar-modified nucleosides, and the one or more 2' sugar-modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleotide (ANA), 2'-fluoro-ANA and LNA nucleosides. If the nucleoside of one or more modifications is a locked nucleic acid (LNA), it is preferred.

[0459] In another embodiment, the oligonucleotide comprises at least one modified internucleoside bond.Suitable internucleoside modification is described in " modified internucleoside bonding " under " definition " chapters and sections.If at least 2 to 3 internucleoside bonds at the 5 ' or 3 ' end of the oligonucleotide are phosphorothioate internucleoside bonds, it is preferred.For single-stranded antisense oligonucleotide, if at least 75% (such as all) internucleoside bonds in the continuous nucleotide sequence are phosphorothioate internucleoside bonds, it is preferred.In certain embodiments, all internucleoside bonds in the continuous sequence of the single-stranded antisense oligonucleotide are phosphorothioate bonds.

[0460] In some embodiments of the present invention, the oligonucleotide comprises at least one LNA nucleoside, such as 1, 2, 3, 4, 5, 6, 7, or 8 LNA nucleosides, such as 2 to 6 LNA nucleosides, such as 3 to 7 LNA nucleosides, 4 to 8 LNA nucleosides, or 3, 4, 5, 6, 7, or 8 LNA nucleosides. In some embodiments, at least 75% of the modified nucleosides in the oligonucleotide are LNA nucleosides, such as 80%, such as 85%, such as 90%. In another embodiment, all modified nucleosides in the oligonucleotide are LNA nucleosides. In another embodiment, the oligonucleotide may comprise both β-D-oxy-LNA and one or more of the following LNA nucleosides: thio-LNA, amino-LNA, oxy-LNA, ScET, and / or ENA, or be in the β-D configuration or the α-L configuration, or a combination thereof. In another embodiment, all LNA cytosine units are 5-methylcytosine.For nuclease stability of the oligonucleotide or continuous nucleotide sequence, it is preferred to have at least one LNA nucleoside at the 5' end of the nucleotide sequence and at least two LNA nucleosides at the 3' end of the nucleotide sequence.

[0461] In one embodiment of the invention, the oligonucleotide is capable of recruiting RNase H.

[0462] In the present invention, preferred structural designs are those described in the "Definitions" section, for example, under "Gapmers," "LNA Spacers," and "MOE Spacers." In the present invention, it is advantageous if the antisense oligonucleotide is a gapmer with an FG-F' design. In some embodiments, the gapmer is an LNA gapmer with uniform flanks.

[0463] In a classic gapmer design, i.e., a gapmer with uniform flanks (e.g., 4-12-2), all nucleotides in the flanks (F and F') are composed of the same type of 2'-sugar-modified nucleosides, such as LNA, cET, or MOE, with a section of DNA forming a gap (G) in the middle. In a gapmer with an alternating flank design, the flanks of the oligonucleotide are annotated as a series of integers representing multiple β-D-oxy LNA nucleosides (L) followed by multiple DNA nucleosides (D). For example, the flank F' with a 1-2-1-1-3 motif represents LDDLDLLL (see CMP ID NO 246_1; Table 9A or 9B). Both flanks have β-D-oxy LNA nucleosides at the 5' and 3' ends. The gap region (G) composed of many DNA nucleosides is located between the flanks.

[0464] In some embodiments of the invention, the LNA spacer is selected from the following wing designs: 2-12-3, 4-14-2, 3-10-3, 3-9-3, 2-15-2, 2-12-4, 1-13-2, 3-13-2, 4-13-2, 2-12-2, 3-12-2, 3-15-2, 3-14-2, 3-13-3, 2-14-4, 3 -12-3, 1-14-3, 3-14-3, 2-14-3, 2-15-3, 3-11-3, 1-12-3, 1-11-4, 1-13-2, 2-13-2, 2-16-2, 1-14-2, 1-17-3, 1-18-2, 4-12-2, 2-13-4, 2-11-1-2-1-1-3 and 2-17-4.

[0465] Table 9A: List of oligonucleotide motif sequences (represented by SEQ ID NOs), their designs and specific oligonucleotide compounds designed based on the motif sequences (represented by CMP ID NOs).

[0466]

[0467]

[0468]

[0469]

[0470]

[0471]

[0472]

[0473]

[0474]

[0475]

[0476]

[0477]

[0478] A motif sequence represents a contiguous sequence of nucleobases present in an oligonucleotide.

[0479] The design reference gapmer design FG-F', where each number represents the number of consecutive modified nucleosides, such as 2' modified nucleosides (first number = 5' flank), followed by the number of DNA nucleosides (second number = gap region), followed by the number of modified nucleosides, such as 2' modified nucleosides (third number = 3' flank), optionally preceded or followed by other repeat regions of DNA and LNA, which are not necessarily part of the continuous sequence complementary to the target nucleic acid.

[0480] The oligonucleotide compounds represent specific designs of the motif sequences. Capital letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and 5-methyl DNA cytosine is represented by "e", and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0481] In all cases, the FG-F' design may further include a region D' and / or D", as described under "Region D' or D" in the oligonucleotide" in the "Definitions" section. In some embodiments of the invention, the oligonucleotide has 1, 2, or 3 phosphodiester-linked nucleoside units, such as DNA units, at the 5' or 3' end of the spacer region. In some embodiments, the oligonucleotide consists of two 5' phosphodiester-linked DNA nucleosides followed by a FG-F' spacer region as defined in the "Definitions" section. Oligonucleotides containing phosphodiester-linked DNA units at the 5' or 3' end are suitable for conjugation and may further comprise a conjugate moiety as described herein. For delivery to the liver, an ASGPR targeting moiety is particularly preferred as a conjugate moiety.

[0482] For some embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having CMP-ID-NO: 27_1; 28_1; 29_1; 30_1; 31_1; 32_1; 33_1; 34_1; 35_1; 36_1; 37_1; 38_1; 39_1; 40_1; 41_1; 42_1; 43_1; 44_1; 45_1; 46_1; 47_1; 47_2; 47_3; 48_1; 48_2; 49_1; 50_1; 51_1; 52_1; 53_1; 54_1; 135_1; 114_1; 88_1; 208_1; 237_1; 243_1; 244_1; 245_1, 246_1, and 246_2 (see Tables 9A and 9B).

[0483] In a preferred embodiment of the present invention, the oligonucleotide is selected from the group of oligonucleotide compounds 243_1; 242_1; 245_1, 246_1 and 246_2 (see Tables 9A and 9B).

[0484] In a preferred embodiment of the present invention, the oligonucleotide is compound ID 243_1 (see Tables 9A and 9B).

[0485] In a preferred embodiment of the present invention, the oligonucleotide is compound ID 244_1 (see Tables 9A and 9B).

[0486] In a preferred embodiment of the present invention, the oligonucleotide is compound ID 245_1 (see Tables 9A and 9B).

[0487] In a preferred embodiment of the present invention, the oligonucleotide is compound ID 246_1 (see Tables 9A and 9B).

[0488] In a preferred embodiment of the present invention, the oligonucleotide is compound ID 246_2 (see Tables 9A and 9B).

[0489] In some embodiments of the invention, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 12 to 22 nucleotides, such as 15 to 20 nucleotides in length, which is at least 90% complementary, such as fully complementary, to the target nucleic acid of SEQ ID NO: 13.

[0490] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 18 nucleotides in length, such as 17 or 18 nucleotides, that is at least 90% complementary, such as fully complementary, to the target nucleic acid of SEQ ID NO: 16.

[0491] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 19 nucleotides in length, such as 18 or 19 nucleotides, that is at least 90% complementary, such as fully complementary, to the target nucleic acid of SEQ ID NO: 15.

[0492] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 18 nucleotides in length, such as 17 or 18 nucleotides, that is at least 90% complementary, such as fully complementary, to the target nucleic acid of SEQ ID NO: 14.

[0493] In some embodiments of the invention, the antisense oligonucleotides of the combination of the invention comprise a contiguous nucleotide sequence of 12 to 22 nucleotides, such as 17 to 22 nucleotides in length, which is at least 90% complementary, such as fully complementary, to the target nucleic acid of SEQ ID NO: 5.

[0494] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 22 nucleotides, such as 15 to 18 nucleotides, such as 17 or 18 nucleotides, which has at least 90% complementarity, such as perfect complementarity, to a target nucleic acid selected from the following regions of SEQ ID NO: 1: 8681-8701 of SEQ ID NO: 1, 11753-11774 of SEQ ID NO: 1, such as complementarity to a region from nucleotides 8681-8701, 11757-11774, 11756-11774, or 11753-11770 of SEQ ID NO: 1.

[0495] In some embodiments, the contiguous nucleotide sequence comprises a sequence of nucleobases selected from the group consisting of SEQ ID NOs 243, 244, 245, and 246, or at least 14 contiguous nucleotides thereof.

[0496] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 10 to 30 nucleotides in length, such as comprises or consists of from 12 to 25, such as 11 to 22, such as from 12 to 20, such as from 14 to 18 or 14 to 16 contiguous nucleotides in length.

[0497] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence comprises 22 or less nucleotides (such as 20 or less nucleotides, such as 18 or less nucleotides, such as 14, 15, 16 or 17 nucleotides) or consists of it. It should be understood that any range given herein includes the endpoints of the range. Accordingly, if an oligonucleotide is described herein to include from 10 to 30 nucleotides, then 10 and 30 nucleotides are included.

[0498] In some embodiments, the contiguous nucleotide sequence comprises or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides in length.

[0499] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of a sequence selected from SEQ ID NO: 243, 244, 245 and 246.

[0500] Antisense-oligonucleotides are such as antisense-oligonucleotides of 12 to 24 nucleotides in length, such as antisense-oligonucleotides of 12 to 18 nucleotides in length, wherein the antisense-oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, such as at least 14, such as at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 13.

[0501] Antisense-oligonucleotides that can be used in the present invention are such as antisense-oligonucleotides of 12 to 24 nucleotides in length, such as antisense-oligonucleotides of 12 to 18 nucleotides in length, wherein the antisense-oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, such as at least 14, such as at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 16.

[0502] Antisense-oligonucleotides that can be used in the present invention are such as antisense-oligonucleotides of 12 to 24 nucleotides in length, such as antisense-oligonucleotides of 12 to 18 nucleotides in length, wherein the antisense-oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, such as at least 14, such as at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 15.

[0503] Antisense-oligonucleotides that can be used in the present invention are such as antisense-oligonucleotides of 12 to 24 nucleotides in length, such as antisense-oligonucleotides of 12 to 18 nucleotides in length, wherein the antisense-oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, such as at least 14, such as at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 14.

[0504] Antisense-oligonucleotides that can be used in the present invention are such as antisense-oligonucleotides of 12 to 24 nucleotides in length, such as antisense-oligonucleotides of 12 to 18 nucleotides in length, wherein the antisense-oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, such as at least 14, such as at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 5.

[0505] In a preferred embodiment, the antisense oligonucleotides of the present invention comprise one or more sugar-modified nucleosides, such as one or more 2' sugar-modified nucleosides, such as one or more 2' sugar-modified nucleosides independently selected from 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleotide (ANA), 2'-fluoro-ANA and LNA nucleosides. It is preferred if one or more modified nucleosides are locked nucleic acids (LNA).

[0506] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides.

[0507] In some embodiments of the oligonucleotide, all LNA nucleosides are β-D-oxy LNA nucleosides.

[0508] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.

[0509] In some embodiments, the contiguous nucleotide sequence comprises 2'-O-methoxyethyl (2'MOE) nucleosides.

[0510] In some embodiments, the contiguous nucleotide sequence comprises 2'-O-methoxyethyl (2'MOE) nucleosides and DNA nucleosides.

[0511] Advantageously, the 3'-most nucleoside of the antisense oligonucleotide or its contiguous nucleotide sequence is a 2' sugar-modified nucleoside.

[0512] Preferably, the antisense oligonucleotide comprises at least one modified internucleoside linkage, such as phosphorothioate or phosphorodithioate.

[0513] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorothioate internucleoside linkage.

[0514] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorodithioate internucleoside linkage.

[0515] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphodiester internucleoside linkage.

[0516] In some embodiments, all internucleoside linkages in the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0517] In some embodiments, at least 75% of the internucleoside linkages in the antisense oligonucleotide or contiguous nucleotide sequence thereof are phosphorothioate internucleoside linkages.

[0518] In some embodiments, all internucleoside linkages in an antisense oligonucleotide or contiguous nucleotide sequence thereof are phosphorothioate internucleoside linkages.

[0519] In an advantageous embodiment of the invention, the antisense oligonucleotide is capable of recruiting RNase H, such as RNase HI. In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence is a gapmer.

[0520] In some embodiments, the antisense oligonucleotide, or a contiguous nucleotide sequence thereof, comprises or consists of a gapmer of the formula 5'-FG-F'-3'.

[0521] In some embodiments, region G consists of 6 to 16 DNA nucleosides, such as 11 to 16 DNA nucleosides. In some embodiments, region F comprises 2 to 4 DNA nucleosides and / or region F' comprises 2 to 6 DNA nucleosides.

[0522] In some embodiments, regions F and F' each comprise at least one LNA nucleoside.

[0523] In some embodiments, the oligonucleotides of the present invention are LNA spacers with uniform flanks. For example, an LNA spacer with uniform flanks can have a design selected from the following: 1-12-3, 4-12-2, 2-17-4, 2-13-4, and 2-12-4. Table 9B lists the preferred designs for each motif sequence.

[0524] In some embodiments of the present invention, the LNA spacer is an alternating-wing LNA spacer. In some embodiments, the alternating-wing LNA spacer comprises at least one alternating wing (such as wing F'). In some embodiments, the alternating-wing LNA spacer comprises one alternating wing (such as wing F') and one uniform wing (such as wing F). For example, an LNA spacer with an alternating F' wing may have the following design: 2-11-1-2-1-1-3.

[0525] The present invention provides the following oligonucleotide compounds (Tables 9B and 10):

[0526] Table 9B: List of suitable oligonucleotide motif sequences (represented by SEQ ID NOs) for use in the present invention, their designs and specific oligonucleotide compounds (represented by CMP ID NOs) designed based on the motif sequences for use in the present invention.

[0527]

[0528] Table 10. Compound Table (for exemplary antisense oligonucleotides used in the present invention) - HELM annotation format

[0529]

[0530] Helm annotation index:

[0531] [LR](G) is β-D-oxy-LNA guanosine,

[0532] [LR](T) is β-D-oxy-LNA thymidine,

[0533] [LR](A) is β-D-oxy-LNA adenine nucleoside,

[0534] [LR]([5meC]) is β-D-oxy-LNA 5-methylcytidine,

[0535] [dR](G) is DNA guanosine nucleoside,

[0536] [dR](T) is DNA thymidine nucleoside,

[0537] [dR](A) is a DNA adenine nucleoside,

[0538] [dR](C) is DNA cytosine nucleoside,

[0539] [sP] is a phosphorothioate internucleoside linkage,

[0540] P is a phosphodiester internucleoside linkage.

[0541] The title "Oligonucleotide Compounds" in Tables 9A and 9B represents a specific design of the motif sequence. Capital letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside bonds are phosphorothioate internucleoside bonds. The title "Design" refers to a gap polymer design, FG-F'. In a classic gap polymer design, i.e., a gap polymer with uniform flanks (e.g., 4-12-2), all nucleotides in the flanks (F and F') are composed of the same type of 2'-sugar modified nucleosides, such as LNA, cET, or MOE, and a section of DNA with a gap (G) in the middle. In a gap polymer with an alternating flank design, the flanks of the oligonucleotide are annotated as a series of integers, representing multiple β-D-oxy LNA nucleosides (L) followed by multiple DNA nucleosides (D). For example, the flank F' with a 1-2-1-1-3 motif represents LDDLDLLL (see CMP ID NO325_1). Both wings have β-D-oxy LNA nucleosides at the 5' and 3' ends. A gap region (G) consisting of many DNA nucleosides is located between the wings.

[0542] For some embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds consisting of CMP-ID-NO: 243_1, 244_1, 245_1, 246_1, and 246_2 (see Table 9B).

[0543] In all cases, the FG-F' design may further include region D' and / or D", as described under "Region D' or D" in the oligonucleotide" in the "Definitions" section. In some embodiments of the invention, the oligonucleotide has 1, 2 or 3 phosphodiester-linked nucleoside units, such as DNA units, at the 5' or 3' end of the spacer region, such as at the 5' end. In some embodiments of the invention, the oligonucleotide consists of two 5' phosphodiester-linked DNA nucleosides followed by a FG-F' spacer region as defined above. Oligonucleotides containing phosphodiester-linked DNA units at the 5' or 3' end are suitable for conjugation and may further comprise a conjugate moiety as described herein. For delivery to the liver, an ASGPR targeting moiety is particularly preferred as a conjugate moiety, see the conjugate section for more details.

[0544] FUBP1 inhibitors

[0545] In one aspect, the second class of compounds in the combination of the present invention is an inhibitor targeting FUBP1. Such inhibitors can be selected from the group consisting of, for example, small molecules, single-stranded antisense oligonucleotides; siRNA molecules; or shRNA molecules.

[0546] Without being bound by theory, it is believed that FUBP1 is involved in the stabilization of cccDNA in the nucleus, and by preventing FUBP1 from binding to DNA, particularly cccDNA, cccDNA is destabilized and becomes susceptible to degradation. Therefore, one embodiment of the present invention comprises a FUBP1 inhibitor that interacts with the DNA binding domain of the FUBP1 protein and prevents or reduces its binding to cccDNA.

[0547] Small molecules that inhibit FUBP1

[0548] Small molecules that inhibit FUBP1 have been identified and implicated in its role in cancer. These small molecules inhibit FUBP1's DNA binding activity, particularly its binding to the FUSE element on single-stranded DNA. In the present invention, it is envisioned that FUBP1 inhibitors could be used to treat HBV. In particular, targeting such small molecules to the liver, for example via conjugation or formulation, could be beneficial for HBV treatment.

[0549] Huth et al. 2004 J Med. Chem, Vol. 47, pp. 4851-4857, disclose a series of benzoylaminobenzoic acid compounds that bind to the four tandem K homology (KH) repeats of FUBP1. All compounds disclosed in Huth et al. 2004 are hereby incorporated by reference. In particular, compounds of Formula I, II, or III, as shown below, were found to effectively inhibit FUBP1 DNA binding activity.

[0550]

[0551] One embodiment of the present invention comprises a compound of Formula I, II, or III for use in the treatment and / or prevention of hepatitis B virus (HBV) infection.

[0552] Hauck et al. 2016 Bioorganic & Medicinal Chemistry, Vol. 24, pp. 5717-5729 describe another series of compounds with high FUBP1 inhibitory potential (see Table 2, hereby incorporated by reference). In particular, the following compound of formula IV effectively inhibits FUBP1 activity

[0553]

[0554] wherein R1 is selected from and

[0555] R2 is selected from

[0556] In particular, compounds of Formula V, VI and VII were shown to have IC50 values ​​below 15 μM.

[0557]

[0558] 2-(5-bromothiophen-2-yl)-5-(3,4-dimethoxyphenyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidine

[0559]

[0560] 2-(5-chlorothien-2-yl)-5-(3,4-dimethoxyphenyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidine

[0561]

[0562] 5-(3,4-Dimethoxyphenyl)-2-(thiophen-2-yl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidine

[0563] One embodiment of the present invention comprises a compound of formula IV for use in the treatment and / or prevention of hepatitis B virus (HBV) infection.

[0564] One embodiment of the present invention comprises a compound of Formula V, VI or VI for use in the treatment and / or prevention of hepatitis B virus (HBV) infection.

[0565] The S-adenosyl-L-methionine (SAM) competitive inhibitor GSK343 ​​(Formula VIII) is currently in preclinical development for osteosarcoma. GSK343 ​​has been shown to inhibit FUBP1 expression in osteosarcoma cells (Xiong et al. 2016 Int J Onc Vol. 49 p. 623).

[0566]

[0567] One embodiment of the present invention comprises a compound of Formula VII for use in the treatment and / or prevention of hepatitis B virus (HBV) infection.

[0568] The FDA-approved cancer drug camptothecin (CPT, Formula IX) and its derivative SN-38 (7-ethyl-10-hydroxycamptothecin, Formula X) are topoisomerase I (TOP1) inhibitors and have recently been shown to inhibit FUBP1 activity by preventing the FUBP1 / FUSE interaction (Hosseini et al. 2017 Biochemical Pharmacology Vol. 146 pp. 53–62).

[0569]

[0570] Camptothecin ((+)-4(S)-ethyl-4-hydroxy-3,4,12,14-tetrahydro-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinoline-3,14-dione).

[0571]

[0572] SN-38 (4(S),11-diethyl-4,9-dihydroxy-3,4,12,14-tetrahydro-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinoline-3,14-dione 7-ethyl-10-hydroxycamptothecin).

[0573] One embodiment of the present invention comprises a compound of Formula IX or X for use in the treatment and / or prevention of hepatitis B virus (HBV) infection.

[0574] Tringali et al. 2012 Journal of Pharmacy and Pharmacology, Vol. 64, pp. 360–365, describe the pharmacokinetic profile of SN-38 conjugated to hyaluronic acid (HA-SN-38, Formula XI) and show increased distribution to the liver.

[0575]

[0576] One embodiment of the present invention comprises a compound of formula XI for use in the treatment and / or prevention of hepatitis B virus (HBV) infection.

[0577] Various lipid conjugates of SN-38 are also known in the literature. WO 2006 / 082053 describes, for example, a molecule of formula XII.

[0578]

[0579] CN105777770 describes palmitate-conjugated SN-38 as shown in Formula XIII below.

[0580]

[0581] One embodiment of the present invention comprises a compound of Formula XII or XIII for use in the treatment and / or prevention of hepatitis B virus (HBV) infection.

[0582] In another aspect of the invention, FUBP1 inhibitors, for example for use in the treatment and / or prevention of hepatitis B virus (HBV) infection, can be directly targeted to the liver by covalently linking them to a conjugate moiety capable of binding to the asialoglycoprotein receptor (ASGPr), such as a bivalent or trivalent GalNAc cluster.

[0583] siRNA targeting FUBP1

[0584] Table 11: Human FUBP1 sequences targeted by single FUBP1 siRNA molecules

[0585]

[0586] A siRNA pool (ON-TARGETplus SMART pool siRNA Cat. No. L-011548-00-0005, Dharmacon) containing the four individual siRNA molecules listed in Table 11 was used.

[0587] Oligonucleotides targeting FUBP1

[0588] In this section, the term "oligonucleotide" should be understood as "oligonucleotide targeting FUBP1".

[0589] Nucleic acid molecules (or oligonucleotides) may be excellent FUBP1 inhibitors because they can target FUBP1 transcripts and promote their degradation through the RNA interference pathway or through cleavage by RNase H. Alternatively, nucleic acid molecules such as aptamers can also act as inhibitors of the DNA binding site of FUBP1 consistent with the above-mentioned small molecules.

[0590] In one aspect of the invention, the combination comprises a nucleic acid molecule for use in the treatment and / or prevention of hepatitis B virus (HBV) infection. Such nucleic acid molecule may be selected from the group consisting of: a single-stranded antisense oligonucleotide; an siRNA molecule; or an shRNA molecule.

[0591] The nucleic acid molecules useful in the present invention are capable of inhibiting the expression of FUBP1 in vitro and in vivo. Inhibition is achieved by hybridizing an oligonucleotide to a target nucleic acid encoding FUBP1.

[0592] The target nucleic acid may be a mammalian FUBP1 sequence, such as a sequence selected from the group consisting of SEQ ID NOs: 247 to 266. It is advantageous if the mammalian FUBP1 sequence is selected from the group consisting of SEQ ID NOs: 247, 248, 249, 250, 251, 252, 253 and 254.

[0593] In some embodiments, nucleic acid molecules useful in the present invention are capable of modulating FUBP1 expression by inhibiting or downregulating its expression. Preferably, such modulation results in at least 40% inhibition of expression compared to the target's normal expression level, more preferably at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% inhibition compared to the target's normal expression level. In some embodiments, nucleic acid molecules useful in the present invention are capable of inhibiting FUBP1 mRNA expression by at least 65% to 98%, such as 70% to 95%, in vitro using HepG2-NTCP cells or HBV-infected primary human hepatocytes. This target reduction range is advantageous in selecting nucleic acid molecules that correlate well with cccDNA reduction. In some embodiments, oligonucleotides useful in the present invention may be capable of inhibiting FUBP1 protein expression by at least 50% in vitro using HepG2-NTCP cells or HBV-infected primary human hepatocytes. The Materials and Methods section and Examples herein provide assays that can be used to measure target RNA inhibition in HepG2-NTCP cells or HBV-infected primary human hepatocytes, as well as in cccDNA. Target regulation is triggered by hybridization between a continuous nucleotide sequence of an oligonucleotide (such as the leading strand of an siRNA or the spacer region of an antisense oligonucleotide) and a target nucleic acid. In some embodiments, the oligonucleotides useful in the present invention comprise a mismatch between one or both of the oligonucleotide or the continuous nucleotide sequence and the target nucleic acid. Despite the mismatch, hybridization with the target nucleic acid can still be sufficient to demonstrate desired FUBP1 expression regulation. The reduced binding affinity resulting from the mismatch can advantageously be compensated by an increase in the length of the oligonucleotide and / or an increase in the number of modified nucleosides within the oligonucleotide sequence that can increase binding affinity to the target. Advantageously, the oligonucleotides useful in the present invention contain modified nucleosides that can increase binding affinity, such as 2' sugar-modified nucleosides, including LNAs.

[0594] One aspect of the present invention relates to a combination comprising a nucleic acid molecule having a length of 12 to 60 nucleotides, which comprises a contiguous nucleotide sequence having a length of 12 to 30 nucleotides capable of inhibiting the expression of FUBP1.

[0595] In some embodiments, the nucleic acid molecule comprises a contiguous sequence that is at least 90% complementary to a region or target sequence of a target nucleic acid, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98% or 100% complementary.

[0596] In one embodiment, the combined nucleic acid molecules of the present invention or their contiguous nucleotide sequences are fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments, may contain one or two mismatches between the oligonucleotide and the target nucleic acid.

[0597] In some embodiments, the nucleic acid molecule comprises a contiguous nucleotide sequence of 12 to 30 nucleotides in length that is at least 95% complementary, such as completely (or 100%) complementary, to the target nucleic acid region present in SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249 and / or SEQ ID NO:250.

[0598] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is at least 93% complementary, such as completely (or 100%) complementary, to the target nucleic acid of SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, SEQ ID NO;253 and / or SEQ ID NO;254.

[0599] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is at least 95% complementary, such as completely (or 100%) complementary, to the target nucleic acid of SEQ ID NO: 247 and SEQ ID NO: 251.

[0600] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is at least 95% complementary, such as completely (or 100%) complementary, to the target nucleic acid of SEQ ID NO: 247, SEQ ID NO: 251, and SEQ ID NO: 255.

[0601] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is 100% complementary to positions 14200-14218 of SEQ ID NO:247.

[0602] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is 100% complementary to positions 14413-14431 of SEQ ID NO:247.

[0603] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is 100% complementary to positions 14966-14984 of SEQ ID NO:247.

[0604] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is 100% complementary to positions 30344-30362 of SEQ ID NO: 247.

[0605] In some embodiments, the nucleic acid molecule comprises or consists of 12 to 60 nucleotides in length, such as 13 to 50, such as 14 to 35, such as 15 to 30, such as 16 to 22 nucleotides in length.

[0606] In some embodiments, the contiguous nucleotide sequence of the acid molecule complementary to the target nucleic acid comprises or consists of a length of 12 to 30, such as 14 to 25, such as 16 to 23, such as 18 to 22, contiguous nucleotides.

[0607] In some embodiments, the contiguous nucleotide sequence of the siRNA or shRNA that is complementary to the target nucleic acid comprises or consists of 18 to 28, such as 19 to 26, such as 20 to 24, such as 21 to 23, contiguous nucleotides in length.

[0608] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide that is complementary to the target nucleic acid comprises or consists of 12 to 22, such as 14 to 20, such as 16 to 20, such as 15 to 18, such as 16 to 18, such as 16 to 17 contiguous nucleotides in length.

[0609] In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length and is at least 90% identical, preferably 100% identical, to a sequence selected from the group consisting of SEQ ID NO: 275 to SEQ ID NO: 330 (see the motif sequences listed in Table 12A). In a specific embodiment, the oligonucleotide or contiguous nucleotide sequence is selected from SEQ ID NO: 325; 326; 327; 328; 329 and 330.

[0610] Table 12A: List of oligonucleotide motif sequences (represented by SEQ ID NOs), their designs and specific oligonucleotide compounds designed based on the motif sequences (represented by CMP ID NOs).

[0611]

[0612]

[0613]

[0614] It will be appreciated that the contiguous nucleobase sequence (motif sequence) may be modified, for example, to increase nuclease resistance and / or binding affinity to the target nucleic acid.

[0615] The pattern of incorporating modified nucleosides (e.g., high-affinity modified nucleosides) into oligonucleotide sequences is commonly referred to as oligonucleotide design. The oligonucleotides of the combination of the present invention are designed using modified nucleosides and RNA nucleosides (particularly for siRNA and shRNA molecules) or DNA nucleosides (particularly for single-stranded antisense oligonucleotides). Advantageously, high-affinity modified nucleosides are used.

[0616] In one embodiment, the oligonucleotide comprises at least one modified nucleoside, such as at least two, at least three, at least four, at least five, at least six, at least seven, at least eight modified nucleosides. In one embodiment, the oligonucleotide comprises one to eight modified nucleosides, such as two to seven modified nucleosides, such as three to six modified nucleosides, such as four to six modified nucleosides, such as four or five modified nucleosides. Suitable modifications are described under "modified nucleosides," "high-affinity modified nucleosides," "sugar modifications," "2' sugar modifications," and "locked nucleic acids (LNA)" in the "Definitions" section.

[0617] In one embodiment, the oligonucleotide comprises one or more sugar-modified nucleosides, such as 2' sugar-modified nucleosides. Preferably, the oligonucleotides useful in the present invention comprise one or more 2' sugar-modified nucleosides, independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleotides (ANA), 2'-fluoro-ANA, and LNA nucleosides. If the one or more modified nucleosides are locked nucleic acids (LNA), it is preferred. Commonly used LNA nucleosides are oxy-LNA or cET.

[0618] In another embodiment, the oligonucleotide comprises at least one modified internucleoside bond.Suitable internucleoside modification is described in " modified internucleoside bonding " under " definition " chapters and sections.If at least 2 to 3 internucleoside bonds at the 5 ' or 3 ' ends of the oligonucleotide are phosphorothioate internucleoside bonds, it is preferred.For single-stranded antisense oligonucleotide, if at least 75% (such as all) internucleoside bonds in the continuous nucleotide sequence are phosphorothioate internucleoside bonds, it is favourable.

[0619] In a further aspect of the invention, nucleic acid molecules useful in the invention (such as antisense oligonucleotides, siRNA or shRNA) can be directly targeted to the liver by covalently linking the nucleic acid molecule to a conjugate moiety (such as a bivalent or trivalent GalNAc cluster) capable of binding to the asialoglycoprotein receptor (ASGPr).

[0620] Also provided are enhanced antisense oligonucleotides or conjugates thereof that are useful in the present invention and may be excellent FUBP1 inhibitors because they can target FUBP1 transcripts and promote their degradation by RNase H cleavage.

[0621] In some embodiments of the present invention, the enhanced antisense oligonucleotides or conjugates thereof are capable of modulating target expression by inhibiting or downregulating target expression. Preferably, such modulation results in at least 20% inhibition of expression compared to the target's normal expression level, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% inhibition compared to the target's normal expression level. In some embodiments, the antisense oligonucleotides or conjugates of the combinations of the present invention may be capable of inhibiting FUBP1 mRNA expression levels by at least 50% or 60% in vitro in PXB-PHH cells using 25 μM. In some embodiments of the present invention, the antisense oligonucleotides or conjugates thereof may be capable of inhibiting FUBP1 protein expression levels by at least 50% in vitro in PXB-PHH cells using 25 μM. This range of target reduction is advantageous for selecting antisense oligonucleotides that correlate well with cccDNA reduction. Suitably, assays useful for measuring FUBP1 RNA inhibition are provided in the Examples (e.g., Example 1 or Example 2). Target inhibition is triggered by hybridization between a continuous nucleotide sequence of the antisense oligonucleotide and the target nucleic acid. In some embodiments, the antisense oligonucleotides of the combination of the present invention contain a mismatch between the antisense oligonucleotide and the target nucleic acid. Despite the mismatch, hybridization with the target nucleic acid may still be sufficient to show the desired inhibition of FUBP1 expression. The reduced binding affinity caused by the mismatch can preferably be compensated by an increase in the number of nucleotides in the oligonucleotide and / or an increase in the number of modified nucleosides that can improve binding affinity to the target, such as 2' sugar-modified nucleosides present in the antisense oligonucleotide sequence, including LNA.

[0622] The antisense oligonucleotides of the combination of the present invention are generally 12 to 30 nucleotides in length, such as 12 to 22 nucleotides, such as 16 to 20 nucleotides, and comprise a contiguous nucleotide sequence of at least 12 nucleotides (such as 13, 14, 15, 16, 17 or 18 nucleotides) that is complementary (such as fully complementary) to a region of human FUBP1 pre-mRNA (as shown in SEQ ID NO: 247) selected from nucleotides 9141 to 9156, 16184 to 16205, 16184 to 16200, 16186 to 16203, 16188 to 16205, 16189 to 16205 and 30536 to 30553 of SEQ ID NO: 247.

[0623] In some embodiments of the invention, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 12 to 22 nucleotides, such as 15 to 20 nucleotides in length, which is at least 90% complementary, such as fully complementary, to the target nucleic acid of SEQ ID NO: 256.

[0624] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 18 nucleotides in length, such as 17 or 18 nucleotides, that is at least 90% complementary, such as fully complementary, to the target nucleic acid of SEQ ID NO: 257.

[0625] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 22 nucleotides, such as 18 to 22 nucleotides, or such as 15 to 18 nucleotides, such as 17 or 18 nucleotides, which antisense oligonucleotide has at least 90% complementarity, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, such as fully complementary to the target nucleic acid, which target nucleic acid is selected from the following regions of SEQ ID NO: 247: 9141 to 9156, 16184 to 16205, 16184 to 16200, 16186 to 16203, 16188 to 16205, 16189 to 16205 and 30536 to 30553 of SEQ ID NO: 247. In some embodiments, the antisense oligonucleotide comprises a contiguous sequence of 12 to 30 nucleotides in length that is at least 90% complementary to a target nucleic acid or a region of a target sequence, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98% or 100% complementary.

[0626] It is advantageous if the antisense oligonucleotides of the combinations of the invention or their contiguous nucleotide sequences are fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments may contain one or two mismatches between the oligonucleotide and the target nucleic acid.

[0627] In some embodiments, the antisense oligonucleotide sequence is 100% complementary to the corresponding target nucleic acid of SEQ ID NO: 247.

[0628] In some embodiments, the antisense oligonucleotides of the combination of the invention or contiguous nucleotide sequences thereof are at least 95% complementary, such as fully (or 100%) complementary, to the target nucleic acids of SEQ ID NO: 247 and SEQ ID NO: 250.

[0629] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 22 nucleotides in length that is at least 90%, such as 100%, complementary to the corresponding target sequence present in SEQ ID NO: 247, wherein the target sequence is selected from nucleotides 9141 to 9156, 16184 to 16205, 16184 to 16200, 16186 to 16203, 16188 to 16205, 16189 to 16205, and 30536 to 30553 of SEQ ID NO: 247.

[0630] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary to the target site sequence of SEQ ID NO: 256, and preferably 100% complementary.

[0631] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary to the target site sequence of SEQ ID NO: 257, and preferably 100% complementary.

[0632] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary to the target site sequence of SEQ ID NO: 261, and preferably 100% complementary.

[0633] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary to the target site sequence of SEQ ID NO: 270, and preferably 100% complementary.

[0634] In some embodiments, the contiguous nucleotide sequence comprises a sequence of nucleobases selected from the group consisting of SEQ ID NOs: 325, 326, 327, 328, 329 and 330, or at least 14 contiguous nucleotides thereof, such as 17 or 18 contiguous nucleotides thereof.

[0635] In some embodiments, the antisense oligonucleotides of the combination of the present invention or their consecutive nucleotide sequences comprise or consist of 10 to 30 nucleotides in length, such as from 12 to 25, such as 11 to 22, such as from 12 to 20, such as from 14 to 18 or 16 to 18 consecutive nucleotides in length.

[0636] In certain embodiments, the antisense oligonucleotide or its continuous nucleotide sequence comprises 22 or less nucleotides, such as 20 or less nucleotides, such as 18 or less nucleotides, or consists of them. For example, the antisense oligonucleotide or its continuous nucleotide sequence may comprise 14, 15, 16 or 17 nucleotides. It should be understood that any range given herein includes the endpoints of the range. Accordingly, if an oligonucleotide is described herein to include from 10 to 30 nucleotides, then 10 and 30 nucleotides are included.

[0637] The invention provides antisense-oligonucleotides, such as antisense-oligonucleotides of 12 to 24 nucleotides in length, such as antisense-oligonucleotides of 12 to 18 nucleotides in length, wherein the antisense-oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, such as at least 14, such as at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 325.

[0638] The present invention provides antisense oligonucleotides, such as antisense oligonucleotides of 12 to 24 nucleotides in length, such as antisense oligonucleotides of 12 to 18 nucleotides in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, such as at least 14, such as at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 326.

[0639] The invention provides antisense-oligonucleotides, such as antisense-oligonucleotides of 12 to 24 nucleotides in length, such as antisense-oligonucleotides of 12 to 18 nucleotides in length, wherein the antisense-oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, such as at least 14, such as at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 327.

[0640] The invention provides antisense-oligonucleotides, such as antisense-oligonucleotides of 12 to 24 nucleotides in length, such as antisense-oligonucleotides of 12 to 18 nucleotides in length, wherein the antisense-oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, such as at least 14, such as at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 328.

[0641] The invention provides antisense-oligonucleotides, such as antisense-oligonucleotides of 12 to 24 nucleotides in length, such as antisense-oligonucleotides of 12 to 18 nucleotides in length, wherein the antisense-oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, such as at least 14, such as at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 329.

[0642] The invention provides antisense-oligonucleotides, such as antisense-oligonucleotides of 12 to 24 nucleotides in length, such as antisense-oligonucleotides of 12 to 18 nucleotides in length, wherein the antisense-oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, such as at least 14, such as at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 330.

[0643] In some embodiments, the contiguous nucleotide sequence comprises or consists of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides in length, such as 16, 17, or 18 contiguous nucleotides.

[0644] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of a sequence selected from SEQ ID NO: 325, 326, 327, 328, 329 and 330.

[0645] In a preferred embodiment, the antisense oligonucleotides of the present invention comprise one or more sugar-modified nucleosides, such as one or more 2' sugar-modified nucleosides, such as one or more 2' sugar-modified nucleosides independently selected from 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleotide (ANA), 2'-fluoro-ANA and LNA nucleosides. It is preferred if one or more modified nucleosides are locked nucleic acids (LNA).

[0646] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides.

[0647] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.

[0648] In some embodiments, the contiguous nucleotide sequence comprises 2'-O-methoxyethyl (2'MOE) nucleosides.

[0649] In some embodiments, the contiguous nucleotide sequence comprises 2'-O-methoxyethyl (2'MOE) nucleosides and DNA nucleosides.

[0650] Advantageously, the 3'-most nucleoside of the antisense oligonucleotide or its contiguous nucleotide sequence is a 2' sugar-modified nucleoside.

[0651] Preferably, the antisense oligonucleotide comprises at least one modified internucleoside linkage, such as phosphorothioate or phosphorodithioate.

[0652] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorothioate internucleoside linkage.

[0653] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorodithioate internucleoside linkage.

[0654] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphodiester internucleoside linkage.

[0655] In some embodiments, all internucleoside linkages in the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0656] In some embodiments, at least 75% of the internucleoside linkages in the antisense oligonucleotide or contiguous nucleotide sequence thereof are phosphorothioate internucleoside linkages.

[0657] In some embodiments, all internucleoside linkages in an antisense oligonucleotide or contiguous nucleotide sequence thereof are phosphorothioate internucleoside linkages.

[0658] In an advantageous embodiment of the present invention, the antisense oligonucleotides of the combination of the present invention are capable of recruiting RNase H, such as RNase HI. In some embodiments of the present invention, the antisense oligonucleotides of the combination of the present invention or a contiguous nucleotide sequence thereof is a gapmer.

[0659] In some embodiments, the antisense oligonucleotide, or a contiguous nucleotide sequence thereof, comprises or consists of a gapmer of the formula 5'-FG-F'-3'.

[0660] In some embodiments, region G consists of 6 to 16 DNA nucleosides, such as 7 to 12 DNA nucleosides. In some embodiments, region F comprises 4 to 6 nucleosides and / or region F' comprises 2 to 6 nucleosides.

[0661] In some embodiments, regions F and F' each comprise at least one LNA nucleoside.

[0662] In some embodiments of the oligonucleotides of the invention, all LNA nucleosides are β-D-oxy LNA nucleosides.

[0663] In some embodiments, the oligonucleotides of the invention are LNA spacers with uniform flanks.

[0664] In some embodiments of the present invention, the LNA gapmer is an alternating-flank LNA gapmer. In some embodiments, the alternating-flank LNA gapmer comprises at least one alternating flank (such as wing F). In some embodiments, the alternating-flank LNA gapmer comprises one alternating flank (such as wing F) and one uniform flank (such as wing F'). In some embodiments, the alternating-flank LNA gapmer comprises two alternating flanks. For example, the LNA gapmer can have a design selected from the following: 1-12-3, 3-2-1-9-2, 3-1-1-10-2, 2-1-2-10-3, 2-1-1-11-3, 2-1-1-10-1-1-2, 2-1-1-10-4, 1-3-1-7-1-1-3, 3-2-1-9-3, and 1-1-3-9-1-1-2. Table 12B lists preferred designs for each motif sequence.

[0665] The present invention provides the following oligonucleotide compounds (Table 12B):

[0666] Table 12B: List of the combinatorial oligonucleotide motif sequences of the present invention (represented by SEQ ID NOs), their designs and the combinatorial specific oligonucleotide compounds of the present invention (represented by CMP ID NOs) designed based on the motif sequences.

[0667]

[0668]

[0669] The title "Oligonucleotide Compounds" in Tables 12A and 12B represents a specific design of the motif sequence. Capital letters are β-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside bonds are phosphorothioate internucleoside bonds. The title "Design" refers to the gapmer design, FG-F'. In a gapmer with an alternating flank design, the flanks of the oligonucleotide are annotated as a series of integers, representing many β-D-oxy LNA nucleosides (L), followed by many DNA nucleosides (D). For example, the flanks with a 2-2-1 motif represent LLDDL. Both flanks have β-D-oxy LNA nucleosides at the 5' and 3' ends. The gap region (G) consisting of many DNA nucleosides is located between the flanks.

[0670] For some embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having CMP-ID-NO: 325_1, 325_2, 326_1, 326_2, 326_3, 326_4, 327_1, 328_1, 329_1, and 330_1 (see Table 12B).

[0671] In a specific embodiment, the compound of the combination of the present invention is the compound with CMP ID NO: 325_1 (see Table 12B).

[0672] In a specific embodiment, the compound of the combination of the present invention is the compound with CMP ID NO: 325_2 (see Table 12B).

[0673] In a specific embodiment, the compound of the combination of the present invention is the compound having CMP ID NO: 326_1 (see Table 12B).

[0674] In a specific embodiment, the compound of the combination of the present invention is the compound having CMP ID NO: 326_2 (see Table 12B).

[0675] In a specific embodiment, the compound of the combination of the present invention is the compound with CMP ID NO: 326_3 (see Table 12B).

[0676] In a specific embodiment, the compound of the combination of the present invention is the compound with CMP ID NO: 326_4 (see Table 12B).

[0677] In a specific embodiment, the compound of the combination of the present invention is the compound with CMP ID NO: 327_1 (see Table 12B).

[0678] In a specific embodiment, the compound of the combination of the present invention is the compound with CMP ID NO: 328_1 (see Table 12B).

[0679] In a specific embodiment, the compound of the combination of the present invention is the compound having CMP ID NO: 329_1 (see Table 12B).

[0680] In a specific embodiment, the compound of the combination of the present invention is the compound having CMP ID NO: 330_1 (see Table 12B).

[0681] The antisense oligonucleotide may be selected from the group listed in Table 13 or a pharmaceutically acceptable salt thereof.

[0682] Table 13. Compound Table (Exemplary Antisense Oligonucleotides of the Invention)—HELM Annotation Format

[0683]

[0684]

[0685] Helm annotation index:

[0686] [LR](G) is β-D-oxy-LNA guanosine,

[0687] [LR](T) is β-D-oxy-LNA thymidine,

[0688] [LR](A) is β-D-oxy-LNA adenine nucleoside,

[0689] [LR]([5meC] is β-D-oxy-LNA 5-methylcytosine nucleoside, [dR](G) is DNA guanosine nucleoside,

[0690] [dR](T) is DNA thymidine nucleoside,

[0691] [dR](A) is a DNA adenine nucleoside,

[0692] [dR]([C] is DNA cytosine nucleoside,

[0693] [sP] is a phosphorothioate internucleoside linkage,

[0694] P. is a phosphodiester internucleoside linkage.

[0695] Therefore, the present invention provides an antisense oligonucleotide selected from the group consisting of compound ID #325_1, 325_2, 326_1, 326_2, 326_3, 326_4, 327_1, 328_1, 329_1 and 330_1.

[0696] In all cases, the FG-F' design may further include regions D' and / or D", as described under "Region D' or D" in the oligonucleotide" in the "Definitions" section. In some embodiments, the combined oligonucleotides of the invention have 1, 2, or 3 phosphodiester-linked nucleoside units, such as DNA units, at the 5' or 3' end of the spacer region, such as at the 5' end. In some embodiments, the combined oligonucleotides of the invention consist of two 5' phosphodiester-linked DNA nucleosides followed by a FG-F' spacer region as defined above. Oligonucleotides containing phosphodiester-linked DNA units at the 5' or 3' end are suitable for conjugation and may further comprise a conjugate moiety as described herein. For delivery to the liver, an ASGPR targeting moiety is particularly preferred as a conjugate moiety, see the conjugate section for more details

[0697] combination

[0698] In one aspect, the third class of compounds in the combination of the invention is an oligonucleotide targeting RTEL1 linked to an oligonucleotide targeting FUBP1 via a linker.

[0699] In one embodiment, the linker consists of a DNA dinucleotide having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein a phosphodiester bond exists between the two DNA nucleosides. Preferably, the linker is a CA DNA dinucleotide.

[0700] In one embodiment, the bond at the 5' end of the dinucleotide, which connects the dinucleotide to one of the oligonucleotides targeting RTEL1 or FUBP1, is a phosphodiester bond or a phosphorothioate bond; and the bond at the 3' end of the dinucleotide, which connects the dinucleotide to another oligonucleotide targeting RTEL1 or FUBP1, is a phosphodiester bond or a phosphorothioate bond.

[0701] In one embodiment, the oligonucleotide targeting RTEL1 is linked at its 3' end to the 5' end of the oligonucleotide targeting FUBP1 via a CA DNA dinucleotide, wherein the bond between the 3' end of the oligonucleotide targeting RTEL1 and the 5' end of the dinucleotide is a phosphodiester bond; and wherein the bond between the 3' end of the dinucleotide and the 5' end of the oligonucleotide targeting FUBP1 is a phosphodiester bond.

[0702] In one embodiment, an oligonucleotide targeting FUBP1 is linked at its 3' end to the 5' end of an oligonucleotide targeting RTEL1 via a CA DNA dinucleotide, wherein the bond between the 3' end of the oligonucleotide targeting FUBP1 and the 5' end of the dinucleotide is a phosphodiester bond; and wherein the bond between the 3' end of the dinucleotide and the 5' end of the oligonucleotide targeting RTEL1 is a phosphodiester bond.

[0703] In one embodiment, the oligonucleotide targeting RTEL1 is linked at its 3' end to the 5' end of the oligonucleotide targeting FUBP1 via a CA DNA dinucleotide, wherein the bond between the 3' end of the oligonucleotide targeting RTEL1 and the 5' end of the dinucleotide is a phosphorothioate bond; and wherein the bond between the 3' end of the dinucleotide and the 5' end of the oligonucleotide targeting FUBP1 is a phosphodiester bond.

[0704] In one embodiment, the oligonucleotide targeting FUBP1 is linked at its 3' end to the 5' end of the oligonucleotide targeting RTEL1 via a CA DNA dinucleotide, wherein the bond between the 3' end of the oligonucleotide targeting FUBP1 and the 5' end of the dinucleotide is a phosphorothioate bond; and wherein the bond between the 3' end of the dinucleotide and the 5' end of the oligonucleotide targeting RTEL1 is a phosphodiester bond.

[0705] In one embodiment, the 5'-most oligonucleotide of the combination consisting of an oligonucleotide targeting RTEL1 linked to an oligonucleotide targeting FUBP1 via a linker is further linked to a conjugate moiety via a linker.

[0706] In one embodiment, the conjugate moiety is linked to the 5'-most oligonucleotide via a linker consisting of a DNA dinucleotide having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein a phosphodiester bond exists between the two DNA nucleosides. Preferably, the linker is a CA DNA dinucleotide.

[0707] In one embodiment, the bond at the 5' end of the dinucleotide, linking the dinucleotide to the conjugate moiety, is a phosphodiester or phosphorothioate bond; and the bond at the 3' end of the dinucleotide, linking the dinucleotide to the 5' end of the 5'-most oligonucleotide, is a phosphodiester or phosphorothioate bond.

[0708] In one embodiment, the 5'-most oligonucleotide is an oligonucleotide targeting RTEL1 that is linked at its 5' end to the conjugate moiety via a CA DNA dinucleotide, wherein the bond between the 5' end of the oligonucleotide targeting RTEL1 and the 3' end of the dinucleotide is a phosphodiester bond; and wherein the bond between the 5' end of the dinucleotide and the conjugate moiety is a phosphodiester bond.

[0709] In one embodiment, the 5'-most oligonucleotide is an oligonucleotide targeting FUBP1 that is linked at its 5' end to the conjugate moiety via a CA DNA dinucleotide, wherein the bond between the 5' end of the oligonucleotide targeting FUBP1 and the 3' end of the dinucleotide is a phosphodiester bond; and wherein the bond between the 5' end of the dinucleotide and the conjugate moiety is a phosphodiester bond.

[0710] In one embodiment, the oligonucleotide targeting RTEL1 is CMP ID NO 245_1 (SEQ ID NO: 245) or CMP ID NO 246_2 (SEQ ID NO: 246).

[0711] In one embodiment, the oligonucleotide targeting FUBP1 is CMP ID NO: 326_3 (SEQ ID NO: 326) or CMP ID NO: 330_1 (SEQ ID NO: 330).

[0712] Table 12C: List of sequences of oligonucleotide combinations (indicated by SEQ ID NO), their designs, and specific combination compounds (indicated by CMP ID NO).

[0713]

[0714] Table 12D: Compound combination table (exemplary combinations of the invention) - HELM annotation format

[0715]

[0716]

[0717] Conjugation

[0718] Because HBV infection primarily affects hepatocytes in the liver, it is advantageous to conjugate the RTEL1 and / or FUBP1 inhibitors useful in the present invention to a conjugate moiety that will increase delivery of the inhibitor to the liver compared to unconjugated inhibitors. In one embodiment, the liver targeting moiety is selected from cholesterol or other lipids or conjugate moieties that are capable of binding to the asialoglycoprotein receptor (ASGPR).

[0719] In some embodiments of the invention, the conjugate comprises an antisense oligonucleotide covalently linked to a conjugate moiety.

[0720] The asialoglycoprotein receptor (ASGPR) conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGR targeting moiety) with an affinity equal to or greater than that of galactose. The affinity of many galactose derivatives for the asialoglycoprotein receptor has been studied (e.g., Jobst, ST and Drickamer, K. JB. C. 1996, 271, 6686) or can be readily determined using methods typical in the art.

[0721] In one embodiment, the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butyryl-galactosamine and N-isobutyrylgalactosamine. Preferably, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0722] To generate the ASGPR conjugate moiety, an ASPGR targeting moiety (preferably GalNAc) can be attached to the conjugate scaffold. Typically, the ASPGR targeting moieties can be at the same end of the scaffold. In one embodiment, the conjugate moiety consists of two to four terminal GalNAc moieties connected to a spacer, which connects each GalNAc moiety to a branched molecule that can be conjugated to the antisense oligonucleotide.

[0723] In another embodiment, the conjugate moiety is monovalent, divalent, trivalent or tetravalent with respect to the asialoglycoprotein receptor targeting moiety.Preferably, the asialoglycoprotein receptor targeting moiety comprises an N-acetylgalactosamine (GalNAc) moiety.

[0724] GalNAc conjugate moieties can include, for example, those described in WO 2014 / 179620 and WO 2016 / 055601 and PCT / EP2017 / 059080 (incorporated herein by reference), as well as small peptides to which a GalNAc moiety is attached, such as Tyr-Glu-Glu-(aminohexylGalNAc)3 (YEE(ahGalNAc)3; a glycotripeptide that binds to the asialoglycoprotein receptor on hepatocytes, see, e.g., Duff et al., Methods Enzymol, 2000, 313, 297); lysine-based galactose clusters (e.g., L3G4; Biessen et al., Cardovasc. Med., 1999, 214); and cholane-based galactose clusters (e.g., the carbohydrate recognition motif of the asialoglycoprotein receptor).

[0725] The ASGPR conjugate moiety, particularly the trivalent GalNAc conjugate moiety, can be attached to the 3' or 5' end of the oligonucleotide using methods known in the art. In one embodiment, the ASGPR conjugate moiety is linked to the 5' end of the oligonucleotide.

[0726] In one embodiment, the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc), such as those shown in Figure 5. In one embodiment, the conjugate moiety is the trivalent N-acetylgalactosamine (GalNAc) of Figure 5A-1 or Figure 5A-2 or a mixture thereof. In one embodiment, the conjugate moiety is the trivalent N-acetylgalactosamine (GalNAc) of Figure 5B-1 or Figure 5B-2 or a mixture thereof. In one embodiment, the conjugate moiety is the trivalent N-acetylgalactosamine (GalNAc) of Figure 5C-1 or Figure 5C-2 or a mixture thereof. In one embodiment, the conjugate moiety is the trivalent N-acetylgalactosamine (GalNAc) of Figure 5D-1 or Figure 5D-2 or a mixture thereof.

[0727] Conjugates targeting RTEL1

[0728] In some embodiments, the conjugate targeting RTEL1 is selected from the group consisting of:

[0729] 5'-GN2-C6 o [X]A s A s T s T s ts t s a s c s a s t s a s c s t s c s t s g s G s T s 、

[0730] 5'-GN2-C6 o [X]A s A s t s t s t s t s a s c s a s t s a s c s t s c s t s G s G s T s m C s 、

[0731] 5'-GN2-C6 o [X]T s T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A s 、

[0732] 5'-GN2-C6 o [X] m C s T s t s t s a s t s ts a s t s a s a s c s t s T s g s a s A s t s m C s T s m C s ;and

[0733] 5'-GN2-C6 o [X] m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g s a s a s T s m C s T s m C s .

[0734] wherein uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, wherein each LNA cytosine is 5-methylcytosine, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc), such as those shown in FIG5 , for example, a trivalent N-acetylgalactosamine (GalNAc) such as FIG5D-1 or FIG5D-2 , or a mixture of the two, and wherein and [X] represents c according to the foregoing o a o .

[0735] In some embodiments, the conjugate targeting RTEL1 is selected from the group of conjugates listed in Table 14 or pharmaceutically acceptable salts thereof.

[0736] Table 14. Compound table (exemplary conjugates of the invention) - HELM annotation format (for comments on HELM annotations, see explanation of Table 10).

[0737]

[0738]

[0739] Helm annotation index:

[0740] [LR](G) is β-D-oxy-LNA guanosine,

[0741] [LR](T) is β-D-oxy-LNA thymidine,

[0742] [LR](A) is β-D-oxy-LNA adenine nucleoside,

[0743] [LR]([5meC]) is β-D-oxy-LNA 5-methylcytidine,

[0744] [dR](G) is DNA guanosine nucleoside,

[0745] [dR](T) is DNA thymidine nucleoside,

[0746] [dR](A) is a DNA adenine nucleoside,

[0747] [dR](C) is DNA cytosine nucleoside,

[0748] [sP] is a phosphorothioate internucleoside linkage,

[0749] P is a phosphodiester internucleoside linkage.

[0750] 5gn2c6 is the trivalent N-acetylgalactosamine (GalNAc) of FIG. 5D-1 or FIG. 5D-2 , or a mixture of the two.

[0751] In some embodiments, 5gn2c6 is a GalNAc residue R having the formula:

[0752]

[0753] It should be understood that R as shown in the above figure is a mixture of the two stereoisomers shown in Figure 5D1 and Figure 5D2.

[0754] According to another aspect of the present invention, R as shown in the above figure is a stereoisomer as shown in Figure 5D1.

[0755] According to another aspect of the present invention, R as shown in the figure above is a stereoisomer as shown in Figure 5D2. The structures of the conjugates provided in Table 14 are as follows: Figure 1 As shown in 4.

[0756] Inhibitors may include Figure 1The inhibitor may comprise the antisense oligonucleotide of Compound ID No. 243_1 or a pharmaceutically acceptable salt thereof.

[0757] The inhibitor may comprise the conjugate of Figure 2 or a pharmaceutically acceptable salt thereof. The inhibitor may comprise the antisense oligonucleotide of Compound ID No. 244_1 or a pharmaceutically acceptable salt thereof.

[0758] Inhibitors may include Figure 3 The inhibitor may comprise the antisense oligonucleotide of Compound ID No. 245_1 or a pharmaceutically acceptable salt thereof.

[0759] The inhibitor may comprise the conjugate of Figure 4 or a pharmaceutically acceptable salt thereof. The inhibitor may comprise the antisense oligonucleotide of Compound ID No. 246_1 or a pharmaceutically acceptable salt thereof.

[0760] Chemical diagrams representing some of the conjugates of the combinations of the present invention are shown in FIG. Figure 1 As shown in 4.

[0761] In some embodiments, the conjugate is Figure 1 The conjugates shown.

[0762] In some embodiments, the conjugate is a conjugate as shown in FIG. 2 .

[0763] In some embodiments, the conjugate is Figure 3 The conjugates shown.

[0764] In some embodiments, the conjugate is a conjugate as shown in FIG. 4 .

[0765] Figure 1 The compounds shown in Figures 4 to 5 are shown in protonated form, i.e., the S atom on the phosphorothioate bond is protonated; it should be understood that the presence of a proton will depend on the acidity of the molecule's environment and the presence of alternative cations (e.g., when the oligonucleotide is in the form of a salt). Protonated phosphorothioates exist in tautomeric forms.

[0766] Conjugates targeting FUBP1

[0767] In some embodiments, the conjugate targeting FUBP1 is selected from the group consisting of:

[0768] 5'-GN2-C6 o [X] m C s T s T s a s t s G s c s t s t s ts t s t s a s t s g s G s T、

[0769] 5'-GN2-C6 o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T、

[0770] 5'-GN2-C6 o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T、

[0771] 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s g s G s T s T、

[0772] 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T、

[0773] 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T、

[0774] 5'-GN2-C6 o [X]G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A s m C、

[0775] 5'-GN2-C6 o [X]T s A s T sg s c s T s t s t s t s t s a s t s g s g s t s T s T s m C,

[0776] 5'-GN2-C6 o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C and

[0777] 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C s

[0778] Wherein capital letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, wherein each LNA cytosine is 5-methylcytosine, subscript s represents phosphorothioate internucleoside linkage, subscript o represents phosphodiester internucleoside linkage, GN2-C6 is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5D, such as trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5D-1 or Figure 5D2, or a mixture of both, preferably bound via a phosphodiester bond at the 5' end of the oligonucleotide. Chemical diagrams representing some molecules are shown. Figures 8 to 16 As shown, and wherein [X] represents the c o a o .

[0779] In some embodiments, the conjugate targeting FUBP1 is selected from the group of conjugates listed in Table 15 or pharmaceutically acceptable salts thereof.

[0780] Table 15A. Compound Table (Exemplary Conjugates of the Invention) - HELM Annotation Format

[0781]

[0782]

[0783] In the above table, [5gn2c6] is a GalNAc residue R having the formula:

[0784]

[0785] It should be understood that R as shown in the above figures and used in the above tables is a mixture of the two stereoisomers shown in Figures 5D1 and 5D2.

[0786] According to another aspect of the present invention, R as shown in the above figures and used in the above tables is a stereoisomer as shown in Figure 5D1.

[0787] According to another aspect of the present invention, R as shown in the above figure and used in the above table is a stereoisomer as shown in Figure 5D1. The structures of the conjugates provided in Table 15 are as follows: Figures 8 to 16 shown.

[0788] The present invention provides Figure 8 conjugate or a pharmaceutically acceptable salt thereof.

[0789] The present invention provides an antisense oligonucleotide of Compound ID No. 325_1 or a pharmaceutically acceptable salt thereof.

[0790] The present invention provides Figure 9 conjugate or a pharmaceutically acceptable salt thereof.

[0791] The present invention provides an antisense oligonucleotide of compound ID No. 325_2 or a pharmaceutically acceptable salt thereof.

[0792] The present invention provides Figure 10 conjugate or a pharmaceutically acceptable salt thereof.

[0793] The present invention provides an antisense oligonucleotide of compound ID No. 326_1 or a pharmaceutically acceptable salt thereof.

[0794] The present invention provides Figure 11 conjugate or a pharmaceutically acceptable salt thereof.

[0795] The present invention provides an antisense oligonucleotide of compound ID No. 326_2 or a pharmaceutically acceptable salt thereof.

[0796] The present invention provides Figure 12 conjugate or a pharmaceutically acceptable salt thereof.

[0797] The present invention provides an antisense oligonucleotide of compound ID No. 326_3 or a pharmaceutically acceptable salt thereof.

[0798] The present invention provides Figure 13 conjugate or a pharmaceutically acceptable salt thereof.

[0799] The present invention provides an antisense oligonucleotide of Compound ID No. 326_4 or a pharmaceutically acceptable salt thereof.

[0800] The present invention provides Figure 14 conjugate or a pharmaceutically acceptable salt thereof.

[0801] The present invention provides an antisense oligonucleotide of Compound ID No. 327_1 or a pharmaceutically acceptable salt thereof.

[0802] The present invention provides Figure 15 conjugate or a pharmaceutically acceptable salt thereof.

[0803] The present invention provides an antisense oligonucleotide of Compound ID No. 328_1 or a pharmaceutically acceptable salt thereof.

[0804] The present invention provides Figure 16 conjugate or a pharmaceutically acceptable salt thereof.

[0805] The present invention provides an antisense oligonucleotide of Compound ID No. 329_1 or a pharmaceutically acceptable salt thereof.

[0806] The present invention provides an antisense oligonucleotide of Compound ID No. 330_1 or a pharmaceutically acceptable salt thereof.

[0807] In some embodiments, the conjugate is Figure 8 The conjugates shown.

[0808] In some embodiments, the conjugate is Figure 9 The conjugates shown.

[0809] In some embodiments, the conjugate is Figure 10 The conjugates shown.

[0810] In some embodiments, the conjugate is Figure 11 The conjugates shown.

[0811] In some embodiments, the conjugate is Figure 12 The conjugates shown.

[0812] In some embodiments, the conjugate is Figure 13 The conjugates shown.

[0813] In some embodiments, the conjugate is Figure 14 The conjugates shown.

[0814] In some embodiments, the conjugate is Figure 15 The conjugates shown.

[0815] In some embodiments, the conjugate is Figure 16 The conjugates shown.

[0816] Figures 8 to 16 The compounds shown in are shown in protonated form, i.e., the S atom on the phosphorothioate bond is protonated; it should be understood that the presence of a proton will depend on the acidity of the molecule's environment and the presence of alternative cations (e.g., when the oligonucleotide is in the form of a salt). Protonated phosphorothioates exist in tautomeric forms.

[0817] Targeted combination conjugates

[0818] In some embodiments, the conjugate of the combination of compounds targeting RTEL1 and FUBP1 is selected from the group consisting of:

[0819] 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T o c o a o T s T s as c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A s (CMP ID NO 350_1) and

[0820] 5'-GN2-C6 o [X]T s T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T(CMP ID NO 351_1)

[0821] wherein capital letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, wherein each LNA cytosine is 5-methylcytosine, subscript s represents a phosphorothioate internucleoside linkage, subscript o represents a phosphodiester internucleoside linkage, GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) as shown in FIG5D , such as a trivalent N-acetylgalactosamine (GalNAc) as shown in FIG5D-1 or FIG5D2 , or a mixture of both, preferably bound via a phosphodiester bond at the 5′-most end of the 5′ oligonucleotide, and wherein [X] represents a c according to the aforementioned o a o .

[0822] Table 15B: Compound Combination Table (Exemplary Conjugates of the Invention) - HELM Annotation Format

[0823]

[0824] Manufacturing method

[0825] On the other hand, the method for the oligonucleotide of the combination for the manufacture of the present invention includes making nucleotide unit react and forming the continuous nucleotide unit of the covalent bond included in the oligonucleotide.Preferably, the method uses phosphoramidite chemical method (see, for example, Caruthers et al., 1987, Methods in Enzymology the 154th volume, 287-313 page).In another embodiment, the method further includes making continuous nucleotide sequence and conjugate part (part) react so that conjugate part is covalently connected to oligonucleotide.On the other hand, a kind of method for the composition of the combination for the manufacture of the present invention includes the oligonucleotide of the combination of the present invention or puts together oligonucleotide and medicinal diluent, solvent, carrier, salt and / or adjuvant mixing.

[0826] medicinal salts

[0827] Compounds according to the present invention may exist in the form of their pharmaceutical salts. The term "pharmaceutical salt" or "pharmaceutical salt" refers to conventional acid addition salts or base addition salts that retain the biological effectiveness and characteristics of the compounds of this invention and are formed by suitable non-toxic organic or inorganic acids or organic or inorganic bases. Acid addition salts include, for example, those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid and nitric acid, and those derived from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, fumaric acid, etc. Base addition salts include those derived from ammonium, potassium, sodium and quaternary ammonium hydroxides such as tetramethylammonium hydroxide. Chemically modifying pharmaceutical compounds into salts in order to obtain improved physical and chemical stability, hygroscopicity, fluidity and solubility of the compound is a well-known technique for pharmaceutical chemists. This is described, for example, by Bastin in Organic Process Research & Development, 4, 2000, pp. 427-435, or by Ansel in Pharmaceutical Dosage Forms and Drug Delivery Systems, 6th ed. (1995), pp. 196 and 1456-1457. For example, a pharmaceutically acceptable salt of a compound provided herein may be a sodium salt.

[0828] In another aspect, the invention relates to a pharmaceutically acceptable salt, such as a pharmaceutically acceptable sodium, ammonium or potassium salt, of one or more of the antisense oligonucleotides or their conjugates.

[0829] Drug combinations and kits

[0830] One aspect of the present invention relates to a pharmaceutical combination of an inhibitor targeting RTEL1 and a FUBP1 inhibitor as described herein, each formulated in a pharmaceutically acceptable carrier.

[0831] The drug combination of the present invention can be used to treat HBV infection more effectively than the therapeutic inhibitor (such as oligonucleotide) contained alone. In one embodiment, the drug combination of the present invention can be used to suppress HBV more quickly, suppress HBV with an increased duration and / or suppress HBV with a greater effect compared to the therapeutic inhibitor (such as oligonucleotide) contained alone. These effects can be measured by the reduction of cccDNA in infected cells. In one embodiment, the drug combination of the present invention causes a reduction in cccDNA in infected cells more quickly than the therapeutic inhibitor (such as oligonucleotide) contained alone. In one embodiment, the drug combination of the present invention causes a reduction in cccDNA for a longer time than the therapeutic oligonucleotide or TLR7 agonist contained alone. In one embodiment, the drug combination of the present invention causes a reduction in cccDNA titer to a greater extent than the therapeutic oligonucleotide or TLR7 agonist contained alone.

[0832] In a preferred embodiment of the present invention, the pharmaceutical combination comprises or consists of an oligonucleotide targeting RTEL1 and an oligonucleotide targeting FUBP1 or a conjugate thereof.

[0833] In a preferred embodiment of the present invention, the pharmaceutical combination comprises or consists of a single-stranded antisense oligonucleotide targeting RTEL1 and a single-stranded antisense oligonucleotide targeting FUBP1 or a conjugate thereof.

[0834] The single-stranded antisense oligonucleotide targeting RTEL1 may be a single-stranded antisense oligonucleotide targeting RTEL1 as described herein.The single-stranded antisense oligonucleotide targeting FUBP1 may be a single-stranded antisense oligonucleotide targeting FUBP1 as described herein.

[0835] application

[0836] The pharmaceutical combination of the present invention is used in the treatment of hepatitis B virus infection and / or cancer, especially in the treatment of patients with chronic HBV.

[0837] The pharmaceutical combination of the present invention can be used as a research reagent or for diagnosis, treatment and prevention.

[0838] The drug combination of the present invention can be used as a combined drug for hepatitis B virus targeted therapy and immunotherapy.

[0839] In research, such combinations can be used to specifically modulate the synthesis of RTEL1 protein in cells (e.g., in vitro cell cultures) and experimental animals, thereby facilitating functional analysis of the target or evaluating its suitability as a target for therapeutic intervention. Typically, target modulation is achieved by degrading or inhibiting the mRNA that produces the protein, thereby preventing protein formation, or by degrading or inhibiting the gene or mRNA that produces the protein.

[0840] If the combination of the invention is employed in research or diagnostics, the target nucleic acid may be cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0841] The present invention also encompasses an in vivo or in vitro method for modulating RTEL1 expression in a target cell expressing RTEL1, said method comprising administering to said cell an effective amount of a combination of the present invention.

[0842] In some embodiments, the target cell is a mammalian cell, particularly a human cell. The target cell can be an in vitro cell culture or an in vivo cell that forms part of a mammalian tissue. In a preferred embodiment, the target cell is present in the liver. The target cell can be a hepatocyte.

[0843] One aspect of the present invention relates to a combination of the present invention for use as a medicament.

[0844] In one aspect of the invention, the combination of the invention is capable of reducing cccDNA levels in infected cells and thereby inhibiting HBV infection. In particular, the combination is capable of affecting one or more of the following parameters: i) reduction of cccDNA and / or ii) reduction of pgRNA and / or iii) reduction of HBV DNA and / or iv) reduction of HBV viral antigens in infected cells.

[0845] For example, a combination that inhibits HBV infection can i) reduce the level of cccDNA in infected cells by at least 40%, such as by 50%, 60%, 70%, 80%, or 90%, compared to a control; or ii) reduce the level of pgRNA by at least 40%, such as by 50%, 60%, 70%, 80%, or 90%, compared to a control. The control can be an untreated cell or animal, or a cell or animal treated with an appropriate control.

[0846] The inhibitory effect of HBV infection can be measured in vitro using primary human hepatocytes infected with HBV, or in vivo using a humanized hepatocyte PXB mouse model (available from PhoenixBio, see also Kakuni et al., 2014 Int. J. Mol. Sci. 15: 58-74). The inhibition of HBsAg and / or HBeAg secretion can be measured by ELISA, for example, using a CLIA ELISA kit (Autobio Diagnostic) according to the manufacturer's instructions. The reduction of intracellular cccDNA or HBV mRNA and pgRNA can be measured by qPCR, for example, as described in the "Materials and Methods" section. Other methods for evaluating whether a test compound inhibits HBV infection are to measure the secretion of HBV DNA by qPCR, for example, as described in WO 2015 / 173208, or to measure using Northern blot hybridization, in situ hybridization, or immunofluorescence.

[0847] Due to the reduction in RTEL1 levels, the combination of the present invention can be used to inhibit the development of HBV infection or treat HBV infection. In particular, the destabilization and reduction of cccDNA by the combination of the present invention is more effective in inhibiting the development of chronic HBV infection or treating chronic HBV infection compared to compounds that only reduce HBsAg secretion.

[0848] Therefore, one aspect of the present invention relates to the use of the combination of the present invention for reducing cccDNA and / or pgRNA in HBV infected persons.

[0849] Another aspect of the invention relates to the use of a combination of the invention for inhibiting the development of or treating a chronic HBV infection.

[0850] Another aspect of the invention relates to the use of the combination of the invention for reducing the infectivity of a human infected with HBV.In a specific aspect of the invention, the combination of the invention inhibits the development of a chronic HBV infection.

[0851] The subject treated with the combination of the invention (or prophylactically receiving the composition of the invention) is preferably a human, more preferably a HBsAg-positive and / or HBeAg-positive human patient, even more preferably a HBsAg-positive and HBeAg-positive human patient.

[0852] Therefore, the present invention relates to a method for treating HBV infection, wherein the method comprises administering an effective amount of the combination of the present invention. The present invention further relates to a method for preventing cirrhosis and hepatocellular carcinoma caused by chronic HBV infection.

[0853] The present invention also provides the use of the combination of the present invention in the preparation of a medicament, in particular a medicament for treating HBV infection or chronic HBV infection or reducing the infectivity of a person infected with HBV. In a preferred embodiment, the medicament is prepared in a dosage form for subcutaneous administration.

[0854] The present invention also provides the use of a combination of the invention for the manufacture of a medicament, wherein the medicament is in a dosage form for intravenous administration.

[0855] The combination of the present invention can be used in combination therapy. For example, the combination of the present invention can be used in combination therapy with other anti-HBV agents such as interferon alpha-2b, interferon alpha-2a and interferon alphacon-1 (pegylated and non-pegylated), ribavirin, lamivudine (3TC), entecavir, tenofovir, telbivudine (LdT), adefovir or other emerging anti-HBV drugs such as HBV RNA replication inhibitors, HBsAg secretion inhibitors, HBV capsid inhibitors, antisense oligomers (e.g., as described in WO 2012 / 145697, WO 2014 / 179629 and WO 2017 / 216390), siRNA (e.g., as described in WO 2005 / 014806, WO 2012 / 024170, WO 2012 / 2055362, WO 2013 / 003520, WO 2013 / 159109, WO 2017 / 027350 and WO2017 / 015175), HBV therapeutic vaccines, HBV prophylactic vaccines, HBV antibody therapy (monoclonal or polyclonal) or TLR 2, 3, 7, 8 or 9 agonists are used to treat and / or prevent HBV.

[0856] Modes for Carrying Out the Invention

[0857] The following embodiments of the invention may be used in combination with any other embodiments described herein.

[0858] A composition comprising an inhibitor of RTEL1 and an inhibitor of FUBP1.

[0859] 2. A pharmaceutical composition comprising an inhibitor of RTEL1 and an inhibitor of FUBP1 or pharmaceutically acceptable salts thereof, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0860] 3. A kit comprising an inhibitor of RTEL1 and an inhibitor of FUBP1.

[0861] 4. The composition according to claim 1 or 2, or the kit according to claim 3, wherein the inhibitor of RTEL1 is capable of reducing cccDNA in infected cells.

[0862] 5. The composition or kit according to any one of the preceding claims, wherein the RTEL1 inhibitor is a nucleic acid molecule having a length of 12 to 60 nucleotides, preferably a length of 12 to 30 nucleotides, more preferably a length of 12 to 25 nucleotides, even more preferably a length of 15 to 21 nucleotides, comprising a contiguous nucleotide sequence of at least 10 nucleotides in length that is at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% complementary to a mammalian RTEL1 target nucleic acid, particularly a human RTEL1 target nucleic acid, wherein the nucleic acid molecule is capable of reducing the expression of RTEL1.

[0863] 6. The composition or kit according to claim 5, wherein the mammalian RTEL1 target nucleic acid is selected from SEQ ID NO: 1 or 2.

[0864] 7. The composition or kit according to claim 5 or 6, wherein the contiguous nucleotide sequence is at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% complementary to SEQ ID NO: 1 and / or 2, preferably SEQ ID NO: 1.

[0865] 8. The composition or kit according to any one of claims 5 to 7, wherein the contiguous nucleotide sequence is at least 98% complementary to the target nucleic acid of SEQ ID NO: 1 and / or SEQ ID NO: 2, preferably SEQ ID NO: 1.

[0866] 9. The composition or kit according to any one of claims 5 to 8, wherein the contiguous nucleotide sequence is 100% complementary to the target nucleic acid of SEQ ID NO: 1 and / or SEQ ID NO: 2, preferably SEQ ID NO: 1.

[0867] 10. The composition or kit according to any one of claims 5 to 9, wherein the contiguous nucleotide sequence is at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, such as 100% complementary to a target sequence selected from SEQ ID NOs: 3-26, preferably 100% complementary to a target sequence selected from SEQ ID NOs: 5, 13, 14, 15, 16; more preferably 100% complementary to a target sequence selected from SEQ ID NOs: 14 and 16.

[0868] 11. The composition or kit according to any one of the preceding claims, wherein the RTEL1 inhibitor is selected from a single-stranded antisense oligonucleotide, siRNA or shRNA molecule.

[0869] 12. The composition or kit according to any one of the preceding claims, wherein the RTEL1 inhibitor is a single-stranded antisense oligonucleotide.

[0870] 13. A composition or kit according to any one of the preceding claims, wherein the RTLE1 inhibitor is a single-stranded antisense oligonucleotide of 12 to 30 nucleotides in length, comprising a contiguous nucleotide sequence of at least 10 nucleotides complementary to a mammalian RTEL1 target nucleic acid, such as an RTEL1 pre-mRNA, for example, the RTEL1 pre-mRNA of SEQ ID NO: 1 or 2, in particular a human RTEL1 target nucleic acid, such as a human RTEL1 pre-mRNA, such as the human RTEL1 pre-mRNA of SEQ ID NO: 1, wherein the oligonucleotide is capable of reducing the expression of RTEL1.

[0871] 14. The composition or kit of claim 13, wherein the contiguous nucleotide sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.

[0872] 15. The composition or kit according to claim 13 or 14, wherein the length of the contiguous nucleotide sequence is 12 to 25, in particular 15 to 21 nucleotides.

[0873] 16. The composition or kit of any one of claims 12 to 15, wherein the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 27 to 246.

[0874] 17. The composition or kit of any one of claims 12 to 16, wherein the antisense oligonucleotide comprises one or more 2' sugar-modified nucleosides.

[0875] 18. The composition or kit of claim 17, wherein the one or more 2' sugar modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleotide (ANA), 2'-fluoro-ANA, and LNA nucleosides.

[0876] 19. The composition or kit of claim 17 or 18, wherein the one or more 2' sugar modified nucleosides are LNA nucleosides.

[0877] 20. The composition or kit of any one of claims 12 to 19, wherein the antisense oligonucleotide comprises at least one phosphorothioate internucleoside linkage.

[0878] 21. The composition or kit of any one of claims 12 to 20, wherein all internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0879] 22. The composition or kit of any one of claims 12 to 21, wherein the oligonucleotide is capable of recruiting RNase H.

[0880] 23. A composition or kit according to any one of claims 12 to 22, wherein the antisense oligonucleotide or its contiguous nucleotide sequence consists of or comprises a gap polymer of the formula 5'-FG-F'-3', wherein regions F and F' independently comprise 1-4 2' sugar-modified nucleosides, and G is a region of between 6 and 16 nucleosides capable of recruiting RNase H, for example a region comprising between 6 and 18 DNA nucleosides.

[0881] 24. The composition or kit according to any one of claims 12 to 23, wherein the antisense oligonucleotide capable of reducing the expression of RTEL1 is selected from the group of antisense oligonucleotides comprising or consisting of:

[0882] AATTttacatactctgGT (SEQ ID NO:243),

[0883] AAtttacatactctGGTC(SEQ ID NO:244),

[0884] TTacatactctggtCAAA(SEQ ID NO:245),

[0885] CTttattataactTgaAtCTC (SEQ ID NO: 246), and

[0886] CTttattataacttgaaTCTC (SEQ ID NO:246);

[0887] Preferably TTacatactctggtCAAA (SEQ ID NO: 245); or

[0888] CTttattataacttgaaTCTC (SEQ ID NO:246);

[0889] Wherein uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0890] 25. The composition or kit according to claim 11, wherein the RTEL1 inhibitor is shRNA.

[0891] 26. The composition or kit according to claim 11, wherein the RTEL1 inhibitor is siRNA.

[0892] 27. The composition or kit of any preceding claim, wherein the RTEL1 inhibitor is covalently linked to at least one conjugate moiety.

[0893] 28. The composition or kit of claim 27, wherein the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butyryl-galactosamine, and N-isobutyrylgalactosamine.

[0894] 29. The composition or kit of claim 28, wherein the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0895] 30. The composition or kit of claim 27 or 28, wherein the conjugate moiety is monovalent, divalent, trivalent, or tetravalent with respect to the asialoglycoprotein receptor targeting moiety.

[0896] 31. The composition or kit of claim 30, wherein the conjugate moiety consists of two to four terminal GalNAc moieties and a spacer connecting each GalNAc moiety to a branched molecule to which an antisense compound can be conjugated.

[0897] 32. The composition or kit of claim 31, wherein the spacer is a PEG spacer.

[0898] 33. The composition or kit of any one of claims 28 to 32, wherein the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) moiety.

[0899] 34. The composition or kit of any one of claims 28 to 33, wherein the conjugate moiety is selected from one of the trivalent GalNAc moieties in Figure 5.

[0900] 35. The composition or kit according to any one of claims 34, wherein the conjugate moiety is a trivalent GalNAc moiety in Figure 5, such as the trivalent GalNAc moiety in Figure 5D-1 or Figure 5D-2, or a mixture of the two.

[0901] 36. The composition or kit according to any one of claims 28 to 35, comprising a linker positioned between the antisense oligonucleotide and the conjugate moiety, preferably wherein the linker is a CA DNA dinucleotide.

[0902] 37. The composition or kit of any one of claims 28 to 36, wherein the conjugate is selected from the group consisting of:

[0903] 5'-GN2-C6 o [X]A s A s T s T s t s t s a s c s a s t s a s c s t s c s t s g s G s T.

[0904] 5'-GN2-C6 o [X]A s A s t s t s t s t s a s c s a s t s a s c s t s c s t s G s G s T s m C.

[0905] 5'-GN2-C6 o [X]T s T s a s c s a s t s a s c s t s c s t s g s g s t sm C s A s A s A,

[0906] 5'-GN2-C6 o [X] m C s T s t s t s a s t s t s a s t s a s a s c s t s T s g s a s A s t s m C s T s m C and

[0907] 5'-GN2-C6 o [X] m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g s a s a s T s m C s T s m C;

[0908] Preferably 5'-GN2-C6 o [X]T s T s a s c s a s t s a s c s t s c s ts g s g s t s m C s A s A s A or

[0909] 5'-GN2-C6 o [X] m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g s a s a s T s m C s T s m C;

[0910] Wherein capital letters represent β-D-oxy LNA nucleosides and lowercase letters represent DNA nucleosides, where each LNA cytosine is 5-methylcytosine, m C is 5-methylcytosine DNA, and wherein the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 is a residue of the formula:

[0911]

[0912] wherein residues GN2-C6 are linked to the 5' end of the oligonucleotide via a phosphodiester bond, and / or wherein GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) residue as shown in FIG. 5D1 or FIG. 5D2 , or a mixture thereof, more preferably wherein GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in FIG. 5D1 or FIG. 5D2 , and wherein [X] represents a residue according to the aforementioned c o a o .

[0913] 38. The composition or kit according to any one of claims 28 to 37, wherein the conjugate is Figure 1 The conjugates shown.

[0914] 39. The composition or kit according to any one of claims 28 to 37, wherein the conjugate is a conjugate as shown in Figure 2.

[0915] 40. The composition or kit according to any one of claims 28 to 37, wherein the conjugate is Figure 3 The conjugates shown.

[0916] 41. The composition or kit according to any one of claims 28 to 37, wherein the conjugate is a conjugate as shown in Figure 4.

[0917] 42. The composition or kit according to any one of the preceding claims, wherein the RTEL1 inhibitor is in the form of a pharmaceutically acceptable salt.

[0918] 43. The composition or kit of claim 28, wherein the salt is a sodium salt, a potassium salt, or an ammonium salt.

[0919] 44. A composition or kit according to any preceding claim, wherein the composition comprises an aqueous diluent or solvent, such as phosphate buffered saline.

[0920] 45. The composition or kit according to any one of the preceding claims, wherein the inhibitor of FUBP1 is capable of reducing cccDNA and / or pgRNA in infected cells.

[0921] 46. ​​The composition or kit according to any one of the preceding claims, wherein the FUBP1 inhibitor is a nucleic acid molecule of 12 to 60 nucleotides in length, preferably 12 to 30 nucleotides in length, more preferably 12 to 25, even more preferably 15 to 21 nucleotides in length, comprising or consisting of a contiguous nucleotide sequence of 10 to 30 nucleotides in length, preferably 12 to 25, in particular 15 to 21 nucleotides in length, wherein the contiguous nucleotide sequence is at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% complementary to a mammalian FUBP1 target nucleic acid, in particular a human FUBP1 target nucleic acid, wherein the nucleic acid molecule is capable of inhibiting the expression of FUBP1.

[0922] 47. The composition or kit of claim 46, wherein the mammalian FUBP1 target nucleic acid is selected from the group consisting of SEQ ID NOs: 247 to 254.

[0923] 48. A composition or kit according to claim 46 or 47, wherein the contiguous nucleotide sequence is at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% complementary to SEQ ID NO: 247 and / or 251, preferably SEQ ID NO: 247.

[0924] 49. The composition or kit according to any one of claims 46 to 48, wherein the contiguous nucleotide sequence is at least 98% complementary to the target nucleic acid of SEQ ID NO: 247 and / or SEQ ID NO: 251, preferably SEQ ID NO: 247.

[0925] 50. The composition or kit according to any one of claims 46 to 49, wherein the contiguous nucleotide sequence is 100% complementary to the target nucleic acid of SEQ ID NO: 247 and / or SEQ ID NO: 251, preferably SEQ ID NO: 247.

[0926] 51. The composition or kit according to any one of claims 46 to 50, wherein the contiguous nucleotide sequence is at least 90% complementary to a region within exon 14 or exon 20 of human FUBP1 (see Table 4).

[0927] 52. The composition or kit according to any one of claims 46 to 51, wherein the contiguous nucleotide sequence is 100% complementary to a region within exon 14 or exon 20 of human FUBP1 (see Table 4).

[0928] 53. The composition or kit of any one of claims 46 to 50, wherein the contiguous nucleotide sequence is at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% complementary to a target sequence selected from the group consisting of positions 9141 to 9156, 16184 to 16205, 16188 to 16205, 16184 to 16203, 16184 to 16200, 16186 to 16203, 16189 to 16205, or 30536 to 30553 of SEQ ID NO: 247.

[0929] 54. The composition or kit of any one of claims 46 to 53, wherein the contiguous nucleotide sequence is 100% complementary to a target sequence selected from the group consisting of positions 9141 to 9156, 16184 to 16205, 16188 to 16205, 16184 to 16203, 16184 to 16200, 16186 to 16203, 16189 to 16205, or 30536 to 30553 of SEQ ID NO: 247.

[0930] 55. The composition or kit according to any one of the preceding claims, wherein the FUBP1 inhibitor is selected from a single-stranded antisense oligonucleotide, siRNA or shRNA molecule.

[0931] 56. The composition or kit according to any one of the preceding claims, wherein the FUBP1 inhibitor is a single-stranded antisense oligonucleotide.

[0932] 57. The composition or kit according to any one of the preceding claims, wherein the FUBP1 inhibitor is a single-stranded antisense oligonucleotide of 12 to 30 nucleotides in length, comprising a contiguous nucleotide sequence of at least 10 nucleotides complementary to mammalian FUBP1, particularly human FUBP1, wherein the oligonucleotide is capable of inhibiting the expression of FUBP1.

[0933] 58. A composition or kit according to claim 57, wherein the length of the contiguous nucleotide sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.

[0934] 59. The composition or kit according to claim 57 or 58, wherein the length of the contiguous nucleotide sequence is 12 to 25, in particular 15 to 21 nucleotides.

[0935] 60. The composition or kit of any one of claims 56 to 59, wherein the single-stranded antisense oligonucleotide comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 275 to 330.

[0936] 61. The composition or kit of any one of claims 56 to 60, wherein the antisense oligonucleotide comprises one or more 2' sugar modified nucleosides.

[0937] 62. The composition or kit of claim 61, wherein the one or more 2' sugar modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleotide (ANA), 2'-fluoro-ANA, and LNA nucleosides.

[0938] 63. The composition or kit of claim 61 or 62, wherein the one or more 2' sugar modified nucleosides are LNA nucleosides.

[0939] 64. The composition or kit of any one of claims 56 to 63, wherein the antisense oligonucleotide comprises at least one phosphorothioate internucleoside linkage.

[0940] 65. The composition or kit of any one of claims 56 to 64, wherein all internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0941] 66. The composition or kit of any one of claims 56 to 65, wherein the oligonucleotide is capable of recruiting RNase H.

[0942] 67. A composition or kit according to any one of claims 56 to 66, wherein the antisense oligonucleotide or its contiguous nucleotide sequence consists of or comprises a gap polymer of the formula 5'-FG-F'-3', wherein regions F and F' independently comprise 1-4 2' sugar-modified nucleosides, and G is a region of between 6 and 16 nucleosides capable of recruiting RNase H, for example a region comprising between 6 and 18 DNA nucleosides.

[0943] 68. The composition or kit according to any one of claims 56 to 67, wherein the single-stranded antisense oligonucleotide capable of inhibiting the expression of FUBP1 is selected from the group of antisense oligonucleotides comprising or consisting of:

[0944] CTTatGctttttatgGT(SEQ ID NO:325),

[0945] CTTaTgctttttatgGT(SEQ ID NO:325),

[0946] CTtATgctttttatgGTT (SEQ ID NO: 326),

[0947] CTtAtgctttttatgGTT (SEQ ID NO:326),

[0948] CTtAtgctttttatGgTT (SEQ ID NO: 326),

[0949] CTtAtgctttttatGGTT(SEQ ID NO:326),

[0950] GcttTttatggtTtCAC (SEQ ID NO:327),

[0951] TATgcTttttatggtTTC (SEQ ID NO:328),

[0952] AcCAAttttcatttCtAC (SEQ ID NO: 329), and

[0953] CcccataaccataGTC (SEQ ID NO:330);

[0954] Preferably CTtAtgctttttatGgTT (SEQ ID NO: 326); or

[0955] CcccataaccataGTC (SEQ ID NO:330);

[0956] Wherein uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0957] 69. The composition or kit of claim 55, wherein the FUBP1 inhibitor is shRNA.

[0958] 70. The composition or kit of claim 55, wherein the FUBP1 inhibitor is siRNA.

[0959] 71. The composition or kit of any preceding claim, wherein the FUBP1 inhibitor is covalently linked to at least one conjugate moiety.

[0960] 72. The composition or kit of claim 71, wherein the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butyryl-galactosamine, and N-isobutyrylgalactosamine.

[0961] 73. The composition or kit of claim 72, wherein the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0962] 74. The composition or kit of claim 71 or 72, wherein the conjugate moiety is monovalent, divalent, trivalent, or tetravalent with respect to the asialoglycoprotein receptor targeting moiety.

[0963] 75. The composition or kit of claim 74, wherein the conjugate moiety consists of two to four terminal GalNAc moieties and a spacer connecting each GalNAc moiety to a branched molecule to which an antisense compound can be conjugated.

[0964] 76. The composition or kit of claim 75, wherein the spacer is a PEG spacer.

[0965] 77. The composition or kit of any one of claims 71 to 76, wherein the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) moiety.

[0966] 78. The composition or kit of any one of claims 71 to 77, wherein the conjugate moiety is selected from one of the trivalent GalNAc moieties in Figure 5.

[0967] 79. The composition or kit of any claim 71, wherein the conjugate moiety is a trivalent GalNAc moiety in Figure 5, such as the trivalent GalNAc moiety in Figure 5D-1 or Figure 5D-2, or a mixture of the two.

[0968] 80. The composition or kit of any one of claims 71 to 79, comprising a linker positioned between the antisense oligonucleotide and the conjugate moiety, preferably wherein the linker is a CA DNA dinucleotide.

[0969] 81. The composition or kit of any one of claims 71 to 80, wherein the conjugate is selected from the group consisting of:

[0970] 5'-GN2-C6 o [X] m C s T s T s a s t s G s c s t s t s t s t s t s a s t s g s G s T.

[0971] 5'-GN2-C6 o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T.

[0972] 5'-GN2-C6 o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T、

[0973] 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s g s G s T s T、

[0974] 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T、

[0975] 5'-GN2-C6 o [X] m C s T st s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T、

[0976] 5'-GN2-C6 o [X]G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A s m C、

[0977] 5'-GN2-C6 o [X]T s A s T s g s c s T s t s t s t s t s a s t s g s g s t s T s T s m C、

[0978] 5'-GN2-C6 o [X]A S c S m C S A S A S t S t S t S tS c S a S t S t S t S m C S tA S m C and

[0979] 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C s ;

[0980] Preferably 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s ; or

[0981] 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s Gs T s m C s ;

[0982] Wherein capital letters represent β-D-oxy LNA nucleosides and lowercase letters represent DNA nucleosides, where each LNA cytosine is 5-methylcytosine, m C is 5-methylcytosine DNA, and wherein the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 is a residue of the formula:

[0983]

[0984] wherein residues GN2-C6 are linked to the 5' end of the oligonucleotide via a phosphodiester bond, and / or wherein GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) residue as shown in FIG. 5D1 or FIG. 5D2 , or a mixture thereof, more preferably wherein GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in FIG. 5D1 or FIG. 5D2 , and wherein [X] represents a residue according to the aforementioned c o a o .

[0985] 82. The composition or kit according to any one of claims 71 to 81, wherein the conjugate is Figure 8 The conjugates shown.

[0986] 83. The composition or kit according to any one of claims 71 to 81, wherein the conjugate is Figure 9 The conjugates shown.

[0987] 84. The composition or kit according to any one of claims 71 to 81, wherein the conjugate is Figure 10 The conjugates shown.

[0988] 85. The composition or kit according to any one of claims 71 to 81, wherein the conjugate is Figure 11 The conjugates shown.

[0989] 86. The composition or kit according to any one of claims 71 to 81, wherein the conjugate is Figure 12 The conjugates shown.

[0990] 87. The composition or kit according to any one of claims 71 to 81, wherein the conjugate is Figure 13 The conjugates shown.

[0991] 88. The composition or kit according to any one of claims 71 to 81, wherein the conjugate is Figure 14 The conjugates shown.

[0992] 89. The composition or kit according to any one of claims 71 to 81, wherein the conjugate is Figure 15 The conjugates shown.

[0993] 90. The composition or kit according to any one of claims 71 to 81, wherein the conjugate is Figure 16 The conjugates shown.

[0994] 91. The composition or kit according to any one of the preceding claims, wherein the FUBP1 inhibitor is in the form of a pharmaceutically acceptable salt.

[0995] 92. The composition or kit of claim 91, wherein the salt is a sodium salt, a potassium salt, or an ammonium salt.

[0996] 93. A composition or kit according to any one of the preceding claims, wherein the composition comprises an aqueous diluent or solvent, such as phosphate buffered saline.

[0997] 94. The composition or kit according to any one of claims 1 to 44, wherein the FUBP1 inhibitor is selected from a compound of Formula VII, IX or X

[0998]

[0999] 95. The composition or kit according to any one of the preceding claims, wherein the inhibitor of RTEL1 is a single-stranded antisense oligonucleotide capable of inhibiting RTEL1 expression comprising or consisting of: AATTttacatactctgGT (SEQ ID NO: 243), and wherein the inhibitor of FUBP1 is a single-stranded antisense oligonucleotide capable of reducing FUBP1 expression, selected from the group of antisense oligonucleotides comprising or consisting of:

[1000] CTTatGctttttatgGT(SEQ ID NO:325),

[1001] CTTaTgctttttatgGT(SEQ ID NO:325),

[1002] CTtATgctttttatgGTT (SEQ ID NO: 326),

[1003] CTtAtgctttttatgGTT (SEQ ID NO:326),

[1004] CTtAtgctttttatGgTT (SEQ ID NO: 326),

[1005] CTtAtgctttttatGGTT(SEQ ID NO:326),

[1006] GcttTttatggtTtCAC (SEQ ID NO:327),

[1007] TATgcTttttatggtTTC (SEQ ID NO:328),

[1008] AcCAAttttcatttCtAC (SEQ ID NO: 329), and

[1009] CcccataaccataGTC (SEQ ID NO:330);

[1010] Wherein uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[1011] 96. The composition or kit according to 95, wherein the inhibitor of RTEL1 is composed of 5'-GN2-C6 o [X]A s A s T s T s t s t s a s c s a s t s a s c s t s c s t s g s G s T-combined conjugates, such as Figure 1 shown, and

[1012] wherein the inhibitor of FUBP1 is a conjugate selected from the group consisting of:

[1013] like Figure 8 5'-GN2-C6 o [X] m C s T s T s a s t s G s c s t s t st s t s t s a s t s g s G s T,

[1014] such as Figure 9 the 5'-GN2-C6 shown o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T,

[1015] such as Figure 10 the 5'-GN2-C6 shown o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T,

[1016] such as Figure 11 the 5'-GN2-C6 shown o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s ts g s G s T s T,

[1017] such as Figure 12 the 5'-GN2-C6 shown o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T,

[1018] such as Figure 13 the 5'-GN2-C6 shown o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T,

[1019] such as Figure 14 the 5'-GN2-C6 shown o [X]G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A sm C,

[1020] such as Figure 15 the 5'-GN2-C6 shown o [X]T s A s T s g s c s T s t s t s t s t s a s t s g s g s t s T s T s m C,

[1021] such as Figure 16 the 5'-GN2-C6 shown o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C, and

[1022] 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C s ;

[1023] Wherein capital letters represent β-D-oxy LNA nucleosides and lowercase letters represent DNA nucleosides, where each LNA cytosine is 5-methylcytosine, m C is 5-methylcytosine DNA, and wherein the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 is a residue of the formula:

[1024]

[1025] wherein residues GN2-C6 are linked to the 5' end of the oligonucleotide via a phosphodiester bond, and / or wherein GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) residue as shown in FIG. 5D1 or FIG. 5D2 , or a mixture thereof, more preferably wherein GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in FIG. 5D1 or FIG. 5D2 , and wherein [X] represents a residue according to the aforementioned c o a o .

[1026] 97. A composition or kit according to any one of the preceding claims, wherein the inhibitor of RTEL1 is a single-stranded antisense oligonucleotide capable of inhibiting RTEL1 expression comprising or consisting of: AAttttacatactctGGTC (SEQ ID NO: 244), and

[1027] The FUBP1 inhibitor is a single-stranded antisense oligonucleotide capable of reducing FUBP1 expression, which is selected from the group consisting of antisense oligonucleotides comprising or consisting of:

[1028] CTTatGctttttatgGT(SEQ ID NO:325),

[1029] CTTaTgctttttatgGT(SEQ ID NO:325),

[1030] CTtATgctttttatgGTT (SEQ ID NO: 326),

[1031] CTtAtgctttttatgGTT (SEQ ID NO:326),

[1032] CTtAtgctttttatGgTT (SEQ ID NO: 326),

[1033] CTtAtgctttttatGGTT(SEQ ID NO:326),

[1034] GcttTttatggtTtCAC (SEQ ID NO:327),

[1035] TATgcTttttatggtTTC (SEQ ID NO:328),

[1036] AcCAAttttcatttCtAC (SEQ ID NO: 329), and

[1037] CcccataaccataGTC (SEQ ID NO: 330); wherein uppercase letters are β-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[1038] 98. The composition or kit according to claim 97, wherein the inhibitor of RTEL1 is composed of 5'-GN2-C6 o [X]A s A s t s t s t s t s a s c s a s t s a s c s t s c s t s G s G s T s m C s A conjugate composed of, such as shown in FIG2 , and

[1039] wherein the inhibitor of FUBP1 is a conjugate selected from the group consisting of:

[1040] like Figure 8 5'-GN2-C6 o [X] m C s T s T s a s t s G s c s t s t s t s t s t s a s t s g s G s T,

[1041] like Figure 9 5'-GN2-C6 o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T,

[1042] like Figure 10 5'-GN2-C6 o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T,

[1043] like Figure 11 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s g s G s T s T,

[1044] like Figure 12 5'-GN2-C6 o[X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T,

[1045] such as Figure 13 5'-GN2-C6 as shown o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T,

[1046] such as Figure 14 5'-GN2-C6 as shown o [X]G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A s m C,

[1047] such as Figure 15 5'-GN2-C6 as shown o [X]T s A s Ts g s c s T s t s t s t s t s a s t s g s g s t s T s T s m C,

[1048] like Figure 16 5'-GN2-C6 o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C, and

[1049] 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C s ;

[1050] Wherein capital letters represent β-D-oxy LNA nucleosides and lowercase letters represent DNA nucleosides, where each LNA cytosine is 5-methylcytosine, mC is 5-methylcytosine DNA, and wherein the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 is a residue of the formula:

[1051]

[1052] wherein residues GN2-C6 are linked to the 5' end of the oligonucleotide via a phosphodiester bond, and / or wherein GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) residue as shown in FIG. 5D1 or FIG. 5D2 , or a mixture of the two, more preferably wherein GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in FIG. 5D1 or FIG. 5D2 .

[1053] 99. The composition or kit according to any one of the preceding claims, wherein the inhibitor of RTEL1 is a single-stranded antisense oligonucleotide capable of inhibiting RTEL1 expression comprising or consisting of: TTacatactctggtCAAA (SEQ ID NO: 245), and wherein the inhibitor of FUBP1 is a single-stranded antisense oligonucleotide capable of inhibiting FUBP1 expression, selected from the group of antisense oligonucleotides comprising or consisting of:

[1054] CTTatGctttttatgGT(SEQ ID NO:325),

[1055] CTTaTgctttttatgGT(SEQ ID NO:325),

[1056] CTtATgctttttatgGTT (SEQ ID NO: 326),

[1057] CTtAtgctttttatgGTT (SEQ ID NO:326),

[1058] CTtAtgctttttatGgTT (SEQ ID NO: 326),

[1059] CTtAtgctttttatGGTT(SEQ ID NO:326),

[1060] GcttTttatggtTtCAC (SEQ ID NO:327),

[1061] TATgcTttttatggtTTC (SEQ ID NO:328),

[1062] AcCAAttttcatttCtAC (SEQ ID NO: 329), and

[1063] CcccataaccataGTC (SEQ ID NO:330);

[1064] Preferred is CTtAtgctttttatGgTT (SEQ ID NO: 326);

[1065] Wherein uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[1066] 100. The composition or kit according to claim 99, wherein the inhibitor of RTEL1 is composed of 5'-GN2-C6 o [X]T s T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A s Conjugates composed of Figure 3 shown, and

[1067] wherein the inhibitor of FUBP1 is a conjugate selected from the group consisting of:

[1068] like Figure 8 5'-GN2-C6 o [X] m C s T s T s a s t s G s c s t s t s t s t s t s a s t s g s G s T,

[1069] like Figure 9 5'-GN2-C6o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T,

[1070] such as Figure 10 the 5'-GN2-C6 shown o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T,

[1071] such as Figure 11 the 5'-GN2-C6 shown o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s g s G s T s T,

[1072] such as Figure 12 the 5'-GN2-C6 shown o [X] m C s Ts t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T,

[1073] such as Figure 13 the 5'-GN2-C6 shown o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T,

[1074] such as Figure 14 the 5'-GN2-C6 shown o [X]G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A s m C,

[1075] such as Figure 15 the 5'-GN2-C6 shown o [X]T s A s T s g s c sT s t s t s t s t s a s t s g s g s t s T s T s m C,

[1076] like Figure 16 5'-GN2-C6 o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C, and

[1077] 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C s ;

[1078] Preferably Figure 12 5'-GN2-C6 o [X] m C s T s t s A s t s g s c st s t s t s t s t s a s t s G s g s T s T;

[1079] Wherein capital letters represent β-D-oxy LNA nucleosides and lowercase letters represent DNA nucleosides, where each LNA cytosine is 5-methylcytosine, m C is 5-methylcytosine DNA, and wherein the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 is a residue of the formula:

[1080]

[1081] wherein residues GN2-C6 are linked to the 5' end of the oligonucleotide via a phosphodiester bond, and / or wherein GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) residue as shown in FIG. 5D1 or FIG. 5D2 , or a mixture thereof, more preferably wherein GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in FIG. 5D1 or FIG. 5D2 , and wherein [X] represents a residue according to the aforementioned c o a o .

[1082] 101. The composition or kit according to any one of the preceding claims, wherein the inhibitor of RTEL1 is a single-stranded antisense oligonucleotide capable of inhibiting RTEL1 expression comprising or consisting of: CTttattataactTgaAtCTC (SEQ ID NO: 246), and wherein the inhibitor of FUBP1 is a single-stranded antisense oligonucleotide capable of inhibiting FUBP1 expression, selected from the group of antisense oligonucleotides comprising or consisting of:

[1083] CTTatGctttttatgGT(SEQ ID NO:325),

[1084] CTTaTgctttttatgGT(SEQ ID NO:325),

[1085] CTtATgctttttatgGTT (SEQ ID NO: 326),

[1086] CTtAtgctttttatgGTT (SEQ ID NO:326),

[1087] CTtAtgctttttatGgTT (SEQ ID NO: 326),

[1088] CTtAtgctttttatGGTT(SEQ ID NO:326),

[1089] GcttTttatggtTtCAC (SEQ ID NO:327),

[1090] TATgcTttttatggtTTC (SEQ ID NO:328),

[1091] AcCAAttttcatttCtAC (SEQ ID NO: 329), and

[1092] CcccataaccataGTC (SEQ ID NO:330);

[1093] Wherein uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[1094] 102. The composition or kit according to claim 101, wherein the RTEL1 inhibitor is composed of 5'-GN2-C6 o [X] m C s T s t s t s a s t s t s a s t s a s a s c s t s T s g s a s A s t s m C s T s m C s A conjugate composed of, such as shown in FIG4 , and

[1095] wherein the inhibitor of FUBP1 is a conjugate selected from the group consisting of:

[1096] like Figure 8 5'-GN2-C6 o [X] m Cs T s T s a s t s G s c s t s t s t s t s t s a s t s g s G s T,

[1097] such as Figure 9 the 5'-GN2-C6 shown o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T,

[1098] such as Figure 10 the 5'-GN2-C6 shown o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T,

[1099] such as Figure 11 the 5'-GN2-C6 shown o [X] m C s T s t s A s t sg s c s t s t s t s t s t s a s t s g s G s T s T,

[1100] such as Figure 12 the 5'-GN2-C6 shown o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T,

[1101] such as Figure 13 the 5'-GN2-C6 shown o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T,

[1102] such as Figure 14 the 5'-GN2-C6 shown o [X]G s c s t s t s T s t s t s a s ts g s g s t s T s t s m C s A s m C,

[1103] such as Figure 15 the 5'-GN2-C6 shown o [X]T s A s T s g s c s T s t s t s t s t s a s t s g s g s t s T s T s m C,

[1104] such as Figure 16 the 5'-GN2-C6 shown o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C, and

[1105] 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s as t s a s G s T s m C s ;

[1106] Wherein capital letters represent β-D-oxy LNA nucleosides and lowercase letters represent DNA nucleosides, where each LNA cytosine is 5-methylcytosine, m C is 5-methylcytosine DNA, and wherein the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 is a residue of the formula:

[1107]

[1108] wherein residues GN2-C6 are linked to the 5' end of the oligonucleotide via a phosphodiester bond, and / or wherein GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) residue as shown in FIG. 5D1 or FIG. 5D2 , or a mixture thereof, more preferably wherein GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in FIG. 5D1 or FIG. 5D2 , and wherein [X] represents a residue according to the aforementioned c o a o .

[1109] 103. The composition or kit according to any one of the preceding claims, wherein the inhibitor of RTEL1 is a single-stranded antisense oligonucleotide capable of inhibiting RTEL1 expression comprising or consisting of: CTttattataacttgaaTCTC (SEQ ID NO: 246), and wherein the inhibitor of FUBP1 is a single-stranded antisense oligonucleotide capable of inhibiting FUBP1 expression, selected from the group of antisense oligonucleotides comprising or consisting of:

[1110] CTTatGctttttatgGT(SEQ ID NO:325),

[1111] CTTaTgctttttatgGT(SEQ ID NO:325),

[1112] CTtATgctttttatgGTT (SEQ ID NO: 326),

[1113] CTtAtgctttttatgGTT (SEQ ID NO:326),

[1114] CTtAtgctttttatGgTT (SEQ ID NO: 326),

[1115] CTtAtgctttttatGGTT(SEQ ID NO:326),

[1116] GcttTttatggtTtCAC (SEQ ID NO:327),

[1117] TATgcTttttatggtTTC (SEQ ID NO:328),

[1118] AcCAAttttcatttCtAC (SEQ ID NO: 329), and

[1119] CcccataaccataGTC (SEQ ID NO:330);

[1120] CcccataaccataGTC (SEQ ID NO: 330) is preferred;

[1121] Wherein uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[1122] 104. The composition or kit according to claim 103, wherein the inhibitor of RTEL1 is composed of 5'-GN2-C6 o [X] m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g s a s a s T s m C s T s m C s A conjugate composed of

[1123] wherein the inhibitor of FUBP1 is a conjugate selected from the group consisting of:

[1124] like Figure 8 5'-GN2-C6 o [X] m Cs T s T s a s t s G s c s t s t s t s t s t s a s t s g s G s T,

[1125] such as Figure 9 the 5'-GN2-C6 shown o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T,

[1126] such as Figure 10 the 5'-GN2-C6 shown o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T,

[1127] such as Figure 11 the 5'-GN2-C6 shown o [X] m C s T s t s A s t sg s c s t s t s t s t s t s a s t s g s G s T s T,

[1128] Such as Figure 12 The 5'-GN2-C6 shown o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T,

[1129] Such as Figure 13 The 5'-GN2-C6 shown o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T,

[1130] Such as Figure 14 The 5'-GN2-C6 shown o [X]G s c s t s t s T s t s t s a s ts g s g s t s T s t s m C s A s m C,

[1131] such as Figure 15 the 5'-GN2-C6 as shown o [X]T s A s T s g s c s T s t s t s t s t s a s t s g s g s t s T s T s m C,

[1132] such as Figure 16 the 5'-GN2-C6 as shown o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C, and <s

[1133] 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s as t s a s G s T s m C s ;

[1134] Preferred 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C s ; wherein capital letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, wherein each LNA cytosine is 5-methylcytosine, and m C is 5-methylcytosine DNA, and wherein the subscript s represents a phosphorothioate internucleoside linkage, and the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 is a residue of the formula:

[1135]

[1136] wherein residues GN2-C6 are linked to the 5' end of the oligonucleotide via a phosphodiester bond, and / or wherein GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) residue as shown in FIG. 5D1 or FIG. 5D2 , or a mixture thereof, more preferably wherein GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in FIG. 5D1 or FIG. 5D2 , and wherein [X] represents a residue according to the aforementioned c o a o .

[1137] 105. A composition or kit according to any preceding claim for use in the treatment or prevention of a disease.

[1138] 106. A composition or kit according to any preceding claim for use in the treatment or prevention of hepatitis B virus (HBV) infection.

[1139] 107. An inhibitor of RTEL1 for use in the treatment or prevention of a disease, wherein the treatment or prevention further comprises administering an inhibitor of FUBP1.

[1140] 108. An inhibitor of RTEL1 for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer, preferably in a subject who is at risk of developing, has developed or has previously developed HBV-related hepatocellular carcinoma (HCC), wherein the treatment or prevention further comprises administering an inhibitor of FUBP1.

[1141] 109. An inhibitor of RTEL1 for use according to any one of claims 107 or 108, wherein the inhibitor of RTEL1 is an inhibitor as defined in any one of claims 4 to 44.

[1142] 110. An inhibitor of FUBP1 for use in the treatment or prevention of a disease, wherein the treatment or prevention further comprises administering an inhibitor of RTEL1.

[1143] 111. An inhibitor of FUBP1 for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer, preferably in a subject who is at risk of developing, has developed or has previously developed HBV-related hepatocellular carcinoma (HCC), wherein the treatment or prevention further comprises administering an inhibitor of RTEL1.

[1144] 112. The FUBP1 inhibitor for use according to any one of claims 110 or 111, wherein the FUBP1 inhibitor is an inhibitor as defined in any one of claims 45 to 94.

[1145] 113. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1, for use in the treatment or prevention of a disease.

[1146] 114. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use in the treatment or prevention of a disease; wherein the inhibitor of RTEL1 is an inhibitor according to any one of claims 4 to 44.

[1147] 115. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 according to claim 113 or 114; wherein the inhibitor of FUBP1 is an inhibitor according to any one of claims 45 to 94.

[1148] 116. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer, preferably in subjects who are at risk of developing, have developed or have previously developed HBV-related hepatocellular carcinoma (HCC).

[1149] 117. The combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use according to claim 116, wherein the inhibitor of RTEL1 is an inhibitor according to any one of claims 4 to 44.

[1150] 118. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use according to claim 116 or 117; wherein the inhibitor of FUBP1 is an inhibitor according to any one of claims 45 to 94.

[1151] 119. A composition or kit for use according to claim 105 or 106; an inhibitor of RTEL1 for use according to any one of claims 107 to 109; an inhibitor of FUBP1 for use according to any one of claims 110 to 112; or a combination for use according to any one of claims 113 to 118, wherein the HBV infection is a chronic HBV infection.

[1152] 120. A composition or kit for use according to claim 105 or 106; an inhibitor of RTEL1 for use according to any one of claims 107 to 109; an inhibitor of FUBP1 for use according to any one of claims 110 to 112; or a combination for use according to any one of claims 113 to 118, wherein the inhibitor of RTEL1 is capable of reducing cccDNA in infected cells.

[1153] 121. A composition or kit for use according to claim 120; an inhibitor of RTEL1 for use; an inhibitor of FUBP1 for use; or a combination for use, wherein cccDNA in HBV infected cells is reduced by at least 60% compared to a control.

[1154] 122. A method for treating or preventing a disease, the method comprising administering a therapeutically or prophylactically effective amount of an inhibitor of RTEL1 to a subject suffering from or susceptible to the disease, wherein the method further comprises administering an effective amount of an inhibitor of FUBP1.

[1155] 123. A method for treating or preventing a disease, the method comprising administering a therapeutically or prophylactically effective amount of an inhibitor of FUBP1 to a subject suffering from or susceptible to the disease, wherein the method further comprises administering an effective amount of an inhibitor of RTEL1.

[1156] 124. A method for treating or preventing a disease, comprising administering to a subject suffering from or susceptible to the disease a therapeutically or prophylactically effective amount of a combination of an inhibitor of RTEL1 and an inhibitor of FUBP1.

[1157] 125. Use of an inhibitor of FUBP1 and an inhibitor of RTEL1 for preparing a medicament for treating or preventing hepatitis B virus (HBV) and / or cancer.

[1158] 126. The method or use according to any one of claims 122 to 125, wherein the disease is hepatitis B virus (HBV) infection and / or cancer.

[1159] 127. The method or use of any one of claims 122 to 126, wherein the disease is chronic hepatitis B virus (HBV) infection.

[1160] 128. An in vivo or in vitro method for regulating the expression of RTEL1 and FUBP1 in a target cell expressing RTEL1 and FUBP1, the method comprising administering to the cell an effective amount of an inhibitor of FUBP1 and an inhibitor of RTEL1.

[1161] 129. The method or use according to any one of claims 122 to 128, wherein the inhibitor of RTEL1 is an inhibitor as defined in any one of claims 4 to 44 or a pharmaceutical composition according to claim 2.

[1162] 130. The method or use according to any one of claims 122 to 129, wherein the inhibitor of FUBP1 is an inhibitor as defined in any one of claims 45 to 94 or a pharmaceutical composition according to claim 2.

[1163] 131. A compound comprising or consisting of an antisense oligonucleotide capable of reducing the expression of RTEL1 and FUBP1, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides having a nucleotide sequence comprising or consisting of:

[1164] CCCCATAACCATAGTCCACTTTATTATAACTTGAATCTC (SEQ ID NO:348);

[1165] CTTTATTATAACTTGAATCTCCACCCATAACCATAGTC(SEQ ID NO:349);

[1166] CTTATGCTTTTTATGGTTCATTACATACTCTGGTCAAA (SEQ ID NO:350); or

[1167] TTACATACTCTGGTCAAACACTTATGCTTTTTATGGTT (SEQ ID NO: 351);

[1168] Preferably,

[1169] CTTATGCTTTTTATGGTTCATTACATACTCTGGTCAAA (SEQ ID NO:350); or

[1170] TTACATACTCTGGTCAAACACTTATGCTTTTTATGGTT (SEQ ID NO: 351).

[1171] 132. A compound comprising or consisting of an antisense oligonucleotide capable of reducing the expression of RTEL1 and FUBP1, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides comprising or consisting of:

[1172] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C o c o a o m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g s a s a s T sm C s T s m C;

[1173] m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g s a s a s T s m C s T s m C o c o a o m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C;

[1174] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T o c o a o Ts T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A; or

[1175] T s T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T;

[1176] The capital letters represent β-D-oxy LNA nucleosides, and the lowercase letters represent DNA nucleosides. m C is 5-methylcytosine LNA, and wherein the subscript s represents a phosphorothioate internucleoside linkage and the subscript o represents a phosphodiester internucleoside linkage.

[1177] 133. A compound comprising or consisting of an antisense oligonucleotide capable of reducing the expression of RTEL1 and FUBP1, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides comprising or consisting of:

[1178] 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C o c o a o m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g s a s a s T s m C s T s m C;

[1179] 5'-GN2-C6 o [X] m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g sa s a s T s m C s T s m C o c o a o m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C;

[1180] 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T o c o a o T s T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A, or

[1181] 5'-GN2-C6 o [X]T s T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T;

[1182] The capital letters represent β-D-oxy LNA nucleosides, and the lowercase letters represent DNA nucleosides. m C is 5-methylcytosine LNA, and wherein the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 is a residue of the formula:

[1183]

[1184] wherein residues GN2-C6 are linked to the 5' end of the oligonucleotide via a phosphodiester bond, and / or wherein GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) residue as shown in FIG. 5D1 or FIG. 5D2 , or a mixture thereof, more preferably wherein GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in FIG. 5D1 or FIG. 5D2 , and wherein [X] represents a residue according to the aforementioned c o a o .

[1185] 134. A compound comprising or consisting of an antisense oligonucleotide capable of reducing the expression of RTEL1 and FUBP1, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides having a sequence comprising or consisting of any one of the HELM sequences shown in Table 12D or Table 15B.

[1186] 135. A compound according to any one of claims 131 to 134 for use in the treatment or prevention of a disease, preferably hepatitis B virus (HBV) infection.

[1187] 136. A compound according to any one of claims 131 to 134 for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer, preferably in a subject who is at risk of developing, has developed or has previously developed HBV-related hepatocellular carcinoma (HCC).

[1188] 137. A method for treating or preventing a disease, preferably hepatitis B virus (HBV) infection and / or cancer, more preferably in a subject at risk of developing, having developed or having previously developed HBV-related hepatocellular carcinoma (HCC), said method comprising administering a therapeutically or prophylactically effective amount of a compound according to any one of claims 131 to 134.

[1189] 138. Use of a compound according to any one of claims 13 to 134 for the preparation of a medicament for the treatment or prevention of hepatitis B virus (HBV) and / or cancer.

[1190] 139. An in vivo or in vitro method for regulating the expression of RTEL1 and FUBP1 in a target cell expressing RTEL1 and FUBP1, the method comprising administering to the cell a compound according to any one of claims 131 to 134.

[1191] Examples

[1192] Example 1 - Antisense Oligonucleotides Targeting RTEL1

[1193] Materials and methods

[1194] Oligonucleotide synthesis

[1195] Oligonucleotide synthesis is well known in the art. The following is a protocol that can be implemented. With respect to equipment, carriers, and concentrations used, the oligonucleotides of the present invention can be produced by slightly varying methods.

[1196] Oligonucleotides were synthesized on a uridine universal support using the phosphoramidite method on an Oligomaker 48 at a 1 μmol scale. At the end of the synthesis, the oligonucleotides were cleaved from the solid support using aqueous ammonia at 60°C for 5-16 hours. The oligonucleotides were purified by reversed-phase HPLC (RP-HPLC) or by solid-phase extraction and characterized by UPLC, with molecular weights further confirmed by ESI-MS.

[1197] Coupling of β-cyanoethylphosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf), or LNA-T) was performed using a 0.1 M solution of the 5'-O-DMT protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as an activator. For the final cycle, the phosphoramidite with the desired modification can be used, for example, a C6 linker for attaching a conjugate group or such a conjugate group. Thiolation is performed using hydrogenated xanthan (0.01 M in acetonitrile / pyridine 9:1) to introduce phosphorothioate bonds. Phosphodiester bonds can be introduced using 0.02 molar iodine in THF / pyridine / water 7:2:1. The remaining reagents are those commonly used for oligonucleotide synthesis.

[1198] For conjugation after solid phase synthesis, a commercially available C6 amino linker phosphoramidite can be used in the last cycle of solid phase synthesis, and after deprotection and cleavage from the solid support, the amino-linked deprotected oligonucleotide is isolated. The conjugate is introduced by activation of the functional group using standard synthetic methods.

[1199] The crude compound was prepared at Phenomenex Purification was performed by preparative RP-HPLC on a C18 10μ1 50x10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile were used as buffers at a flow rate of 5 mL / min. Collected fractions were lyophilized to give the purified compound, typically as a white solid.

[1200] abbreviation:

[1201] DCI: 4,5-Dicyanoimidazole

[1202] DCM: dichloromethane

[1203] DMF: dimethylformamide

[1204] DMT: 4,4'-dimethoxytrityl

[1205] THF: Tetrahydrofuran

[1206] Bz: Benzoyl

[1207] Ibu: isobutyryl

[1208] RP-HPLC: Reversed-phase high-performance liquid chromatography

[1209] Primary human hepatocytes (PXB-PHH)

[1210] Fresh primary human hepatocytes (PXB-PHH) harvested from humanized mice (uPA / SCID mice) (herein referred to as PHH)

[1211] Cells were obtained from PhoenixBio Co., Ltd (Japan) in a 96-well format and cultured in modified hepatocyte colony growth medium (dHCGM), which is DMEM medium containing 100 U / ml penicillin, 100 μg / ml streptomycin, 20 mM Hepes, 44 mM NaHCO 3 , 15 μg / ml L-proline, 0.25 μg / ml insulin, 50 nM dexamethasone, 5 ng / ml EGF, 0.1 mM Asc-2P, 2% DMSO, and 10% FBS ( Ishida et al., 2015 ).

[1212] The cells were cultured at 37° C. in a humidified atmosphere with 5% CO 2 . The culture medium was changed every 2 days except weekends until harvest.

[1213] HBV infection and oligonucleotide processing (RTEL1)

[1214] PHH were incubated with HBV (purified from chronic hepatitis B (CHB) individuals) and 4% PEG for 24 hours at a multiplicity of infection (MOI) of 40. The next day, the viral inoculum was removed and the cells were washed three times with PBS before adding fresh medium.

[1215] To establish cccDNA, compounds were treated in PHH starting on day 3 after HBV infection. Cells were dosed in a 1:10 dilution step dose response starting at 10 μM. Oligonucleotide compounds were administered to cells in a final volume of 100 μI / well of dHCGM medium on days 3, 5, and 7 after HBV infection. Treatment with 10 nM entecavir (ETV) was started on day 5 after infection to ensure true cccDNA measurement by qPCR, and the medium containing 10 nM ETV was replaced every two days (except weekends) until cells were harvested on day 16 after HBV infection. All experiments were performed in triplicate.

[1216] HBV infection and oligonucleotide processing (FUBP1)

[1217] Upon arrival, PHH cells were incubated with a solution of HBV in 4% (v / v) PEG in PHH medium for 16 hours, and then infected with a purified inoculum derived from a chronic patient (genotype C) at an MOI of 110. The cells were then washed three times with PBS and cultured in fresh PHH medium in a humidified atmosphere containing 5% CO2. Four days post-infection, cells were treated with FUBP1 LNA (see Table 11) at a final concentration of 10 μM in duplicate or with PBS as a no-drug control (NDC). On the day of treatment, the old medium was removed from the cells and replaced with 400 μl / well of fresh PHH medium. For each well, 100 μl of 50 μM of each FUBP1 LNA or PBS as an NDC was added to 400 μl of PHH medium. The same treatment was repeated three times on days 4, 11, and 18 post-infection. On days 7, 14, and 21 post-infection, the original cell culture medium was replaced with fresh cell culture medium every three days.

[1218] Real-time PCR of intracellular RTEL1 RNA

[1219] Using the Qiagen BioRobot Universal System and

[1220] RNeasy 96-well extraction plate (RNeasy 96 BioRobot 8000 kit (12) / catalog number IID: 967152)

[1221] Total mRNA was extracted from cells according to the manufacturer's protocol. TM mRNA expression levels were analyzed using real-time PCR on a 12k Flex. β-actin (ACT B) was quantified by qPCR using TaqMan Fast Advanced Master Mix (Life Technologies, catalog number 4444558) in technical replicates. FastSYBR TM RTEL1 gene qPCR was performed using Green Master Mix (Life Technologies, catalog number 4385612). Results were normalized to the human ACT B endogenous control. mRNA expression was analyzed using the comparative cycle threshold 2-ΔΔCt method, which was normalized to the reference gene ACT B and untreated cells. Table 16 lists the primers used for quantification of ACTB RNA and RTEL1 RNA:

[1222] Table 16: ACT B and RTEL1 RNA qPCR Primers

[1223]

[1224]

[1225] HBV cccDNA quantification

[1226] DNA was extracted from HBV-infected primary human hepatocytes using SDS lysis buffer (50 mM Tris pH 8, 5 mM EDTA, 1% SDS). After lysing the cells in 80 μl of SDS lysis buffer, the samples were frozen at -80 ° C for at least 2 hours. The samples were thawed at 37 ° C, and 1 μl of proteinase K (catalog number AM25448 @ Ambionbiosciences, 20 mg / mL stock solution) was added to each well of a 96-well plate, and the samples were incubated at 56 ° C for 30 minutes. After incubation, 3 volumes of ChIP DNA binding buffer from the ZYMOResearch Genomic DNA Clean & Concentrator kit (ZymoResearch, catalog number D4067) were added, and the DNA was purified according to the manufacturer's protocol. The DNA was eluted in 20 μl DNA elution buffer, and 2 μl of DNA was used for qPCR.

[1227] cccDNA expression levels in technical replicates were quantified using the comparative cycle threshold 2-ΔΔCt method. Quantitative real-time polymerase chain reaction measurements were performed on a QuantStudio 12K Flex PCR system (Applied Biosystems). Fast SYBR TM Green Master Mix (Life Technologies, catalog number 4385612) was used to normalize mitochondrial DNA (mitoDNA) and untreated cells as an endogenous control. The cycler settings were adjusted to incubate at 95°C for 5 minutes, followed by 45 cycles of incubation at 95°C for 1 second and 60°C for 35 seconds. The primers used are listed in Table 17 below (all probes in the chart are SYBR Green):

[1228] Table 17: cccDNA qPCR primers.

[1229]

[1230] Example 1.1 - Effects of antisense oligonucleotides targeting RTEL1 on RTEL1 RNA and cccDNA in HBV-infected PHH cells.

[1231] The effects of RTEL1 knockdown on RTEL1 RNA and cccDNA were tested using the oligonucleotide compounds in Table 6. PHHs were cultured as described in the Materials and Methods section. HBV-infected PHH cells were treated with compounds from Table 6 as described above. After 16 days of treatment, RTEL1 mRNA and cccDNA were measured by qPCR as described above. The results are shown in Table 18 as a percentage of the mean no drug control (NDC) sample (ie, the lower the value, the greater the inhibition / reduction).

[1232] Table 18: Effects of LNA ASO on cccDNA knockdown of RTEL1

[1233]

[1234] For compounds: capital letters represent LNA nucleosides (β-D-oxy-LNA nucleosides were used), all LNA cytosines are 5-methylcytosine, lowercase letters represent DNA nucleosides, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[1235] Example 1.2 - Testing of the in vitro efficacy of different concentrations of antisense oligonucleotides targeting RTEL1 mRNA in human MDA-MB-231 cells in terms of dose response curves.

[1236] The human MDA-MB-231 cell line was purchased from ATCC and maintained in a humidified incubator at 37°C and 5% CO2 as recommended by the supplier. For the assay, 3500 cells / well were seeded in culture medium in 96-well plates. The cells were cultured for 24 hours before the addition of oligonucleotides dissolved in PBS. The highest screening concentration of oligonucleotides was 50 μM and then 8 steps of 1:1 dilution were added. Three days after the addition of oligonucleotides, cells were harvested. PureLink was used according to the manufacturer's instructions. TM RNA was extracted using the Pro 96 RNA purification kit (Thermo Fisher Scientific) and eluted in 50 μl of water. RNA was then diluted 10-fold with DNase / RNase-free water (Gibco) and heated to 90°C for one minute.

[1237] For gene expression analysis, use qScript TM XLT One-...

Claims

1. A composition comprising an inhibitor of RTEL1 and an inhibitor of FUBP1.

2. A pharmaceutical composition comprising an inhibitor of RTEL1 and an inhibitor of FUBP1 or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

3. A kit comprising an inhibitor of RTEL1 and an inhibitor of FUBP1.

4. The composition according to claim 1 or 2, or the kit according to claim 3, wherein the inhibitor of RTEL1 is capable of reducing cccDNA in infected cells.

5. A composition or kit according to any of the preceding claims, wherein the RTEL1 inhibitor is a nucleic acid molecule of 12 to 60 nucleotides in length, preferably 12 to 30 nucleotides in length, more preferably 12 to 25, even more preferably 15 to 21 nucleotides in length, comprising a contiguous nucleotide sequence of at least 10 nucleotides in length that is at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% complementary to a mammalian RTEL1 target nucleic acid, in particular a human RTEL1 target nucleic acid, wherein the nucleic acid molecule is capable of reducing the expression of RTEL1.

6. The composition or kit according to claim 5, wherein the mammalian RTEL1 target nucleic acid is selected from SEQ ID NO: 1 or 2, preferably SEQ ID NO:

1.

7. The composition or kit according to claim 6, wherein the antisense oligonucleotide capable of reducing the expression of RTEL1 is selected from the group of antisense oligonucleotides comprising or consisting of: AATTttacatactctgGT(SEQ ID NO:243), AAtttacatactctGGTC(SEQ ID NO:244), TTacatactctggtCAAA(SEQ ID NO:245), CTttattataactTgaAtCTC (SEQ ID NO: 246), and CTttattataacttgaaTCTC (SEQ ID NO:246), Wherein capital letters are β-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside bonds are phosphorothioate internucleoside bonds.

8. The composition or kit according to any one of the preceding claims, wherein the inhibitor of FUBP1 is capable of reducing cccDNA and / or pgRNA in infected cells.

9. The composition or kit according to any one of the preceding claims, wherein the FUBP1 inhibitor is a nucleic acid molecule of 12 to 60 nucleotides in length, preferably 12 to 30 nucleotides in length, more preferably 12 to 25, even more preferably 15 to 21 nucleotides in length, comprising or consisting of: A contiguous nucleotide sequence of 10 to 30 nucleotides in length, preferably 12 to 25, and especially 15 to 21 nucleotides in length, wherein the contiguous nucleotide sequence is at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95% complementary to a mammalian FUBP1 target nucleic acid, especially a human FUBP1 target nucleic acid, wherein the nucleic acid molecule is capable of inhibiting the expression of FUBP1.

10. The composition or kit according to claim 9, wherein the mammalian FUBP1 target nucleic acid is selected from SEQ ID NOs: 247 to 254, preferably SEQ ID NO:

247.

11. The composition or kit according to claim 10, wherein the single-stranded antisense oligonucleotide capable of inhibiting the expression of FUBP1 is selected from the group consisting of antisense oligonucleotides comprising or consisting of: CTTatGctttttatgGT(SEQ ID NO:325), CTTaTgctttttatgGT(SEQ ID NO:325), CTtATgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatgGTT (SEQ ID NO:326), CTtAtgctttttatGgTT (SEQ ID NO: 326), CTtAtgctttttatGGTT(SEQ ID NO:326), GcttTttatggtTtCAC (SEQ ID NO:327), TATgcTttttatggtTTC (SEQ ID NO:328), AcCAAttttcatttCtAC (SEQ ID NO: 329), and CcccataaccataGTC (SEQ ID NO:330), Wherein capital letters are β-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside bonds are phosphorothioate internucleoside bonds.

12. A composition or kit according to any one of the preceding claims for use in the treatment or prevention of a disease, preferably a hepatitis B virus (HBV) infection.

13. An inhibitor of RTEL1 for use in the treatment or prevention of a disease, wherein the treatment or prevention further comprises administering an inhibitor of FUBP1.

14. An inhibitor of FUBP1 for use in the treatment or prevention of a disease, wherein the treatment or prevention further comprises administering an inhibitor of RTEL1.

15. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use in the treatment or prevention of a disease.

Images