Modulation of hepatitis b virus (HBV) expression

Abstract

Disclosed herein are chimeric antisense compounds and methods for reducing HBV mRNA, DNA, and protein expression. Such methods, compounds, and compositions are useful for treating, preventing, or ameliorating HBV-related diseases, disorders, or conditions.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to and the benefit of U.S. Provisional Application No. 63 / 298,092, filed on January 10, 2022, the contents of which are incorporated herein by reference in their entirety. Background Art

[0003] Hepatitis B is a viral disease that is transmitted parenterally through contaminated materials (such as blood and blood products), contaminated needles, sexually, and vertically from infected or carrier mothers to their offspring. The World Health Organization estimates that over 2 billion people are infected worldwide, with approximately 4 million acute cases, 1 million deaths, and 350-400 million chronic carriers each year (World Health Organization: Geographic Prevalence of Hepatitis B, 2004).

[0004] http: / / www.who.int / vaccines-surveillance / graphics / htmls / hepbprev.htm).

[0005] The virus, HBV, is a double-stranded hepatotropic virus that infects only humans and non-human primates. Viral replication occurs primarily in the liver and, to a lesser extent, in the kidneys, pancreas, bone marrow, and spleen (Hepatitis B virus biology. Microbiol Mol Biol Rev. 64: 2000; 51-68). Viral and immune markers are detectable in the blood, and characteristic antigen-antibody patterns evolve over time. The first detectable viral marker is HBsAg, followed by hepatitis B e antigen (HBeAg) and HBV DNA. During the incubation period, titers may be high, but HBV DNA and HBeAg levels begin to decline at the onset of disease and may be undetectable at peak clinical disease (Hepatitis B virus infection—natural history and clinical consequences. N Engl J Med., 350:2004;1118-1129). HBeAg is a detectable viral marker in the blood and is associated with active viral replication and, therefore, high viral load and infectivity (Hepatitis B e antigen—the dangerous end game of hepatitis B. N Engl J Med., 347:2002;208-210). The presence of anti-HBsAb and anti-HBcAb (IgG) indicates recovery and immunity in previously infected individuals.

[0006] At present, the therapy for chronic HBV infection recommended by the American Association for the Study of Liver Diseases (American Association for the Study of Liver Diseases, AASLD) and the European Association for the Study of the Liver (European Association for the Study of theLiver, EASL) includes interferon alpha (INFa), peg interferon alpha-2a (Peg-IFN2a), entecavir (entecavir) and tenofovir (tenofovir). Nucleoside and nucleotide therapy, entecavir and tenofovir are successful in reducing viral load, but the rate of HBeAg seroconversion and HBsAg loss is even lower than the rate of HBeAg seroconversion and HBsAg loss obtained using IFNa therapy. Other similar therapies have also been used, including lamivudine (lamivudine) (3TC), telbivudine (telbivudine) (LdT) and adefovir (adefovir), but usually for nucleoside / nucleotide therapy, the emergence of resistance limits the therapeutic efficacy.

[0007] Therefore, this area needs to discover and develop new antiviral therapies. Additionally, it is necessary to increase the new anti-HBV therapy that can increase the HBeAg and HBsAg seroconversion rate. Recent clinical studies have found that there is a correlation between seroconversion and the reduction of HBeAg (Fried et al. (2008) " Hepatology (Hepatology) " 47:428) and the reduction of HBsAg (Moucari et al. (2009) " Hepatology " 49:1151). The reduction of antigen levels may have allowed HBV infection to be immunocontrolled because high levels of antigen are considered to induce immune tolerance. Current nucleoside therapy for HBV can significantly reduce the serum level of HBV, but has little effect on HBeAg and HBsAg levels.

[0008] Antisense technology is becoming an effective means for reducing the expression of specific gene products, and therefore can prove to be uniquely useful in many treatments and diagnoses. The difference between antisense therapy and nucleoside therapy is that the antisense therapy can directly target transcripts for HBV antigens and thereby reduce serum HBeAg and HBsAg levels. Due to the multiple overlapping transcripts produced during HBV infection, a single antisense oligomer also has the opportunity to reduce HBV DNA in addition to both HBeAg and HBsAg. Therefore, antisense technology is becoming an effective means for reducing the expression of certain gene products, and therefore can prove to be uniquely useful in many treatments, diagnoses and research applications for regulating HBV.

[0009] HBV antisense oligonucleotides with a single gap segment directly flanking the 5' wing segment and the 3' wing segment have been developed (WO 2012 / 145697). However, many of the HBV antisense oligonucleotides with this structure have shown minimal efficacy in reducing serum HBsAg levels and / or have caused safety issues in patients with chronic hepatitis B. Therefore, there is a need in the art for improved HBV antisense oligonucleotides. Summary of the Invention

[0010] The present disclosure extends the principles of HBV antisense oligonucleotides by providing enhanced modified oligonucleotide structures that provide additional segmented gap structures using one or more spacers.

[0011] The present disclosure is based at least in part on the following discovery: the discontinuous gap segment between the 5' wing segment and the 3' wing segment flanking the modified oligonucleotide provides improved activity (e.g., a reduction in serum HBsAg levels or HBeAg levels) over conventional antisense oligonucleotides with continuous gaps. One or more spacer segments placed directly between the gap segments can provide improved activity of antisense oligonucleotides, which is different from the current teachings in the art, thereby indicating that the spacer segments may cause adverse activity. The inventors have unexpectedly found that placing the spacer segments at specific positions of the full-length antisense oligonucleotides provides improved activity, while the spacer segments in other positions result in reduced activity or no change in activity. Further, only specific types of nucleoside modifications in the spacer segments provide improved activity, while other types of nucleoside modifications in the spacer segments result in reduced activity or no change in activity. Without being bound by theory, the specific combination of nucleoside modifications and the positioning of the spacer segments in the full-length antisense oligonucleotides improves the binding and activity of RNase H endonuclease without compromising complementarity with the HBV target sequence.

[0012] The present disclosure is based at least in part on the following discovery: specific nucleoside modifications of the 5' wing segment and the 3' wing segment reduce in vivo toxicity (e.g., a reduction in ALT levels, a proxy for liver toxicity, or CC30 (cytotoxic concentration, to reduce cell viability by 30%)). The present inventors have unexpectedly found that a specific type of modified nucleoside in the 5' wing segment increases in vivo toxicity, while a specific type of modified nucleoside in the 3' wing segment reduces in vivo toxicity. Further, the positioning of modified nucleosides in the 5' wing segment and the 3' wing segment also contributes to in vivo toxicity. Without being bound by theory, specific combinations of nucleoside modifications and positioning in the 5' wing segment and the 3' wing segment contribute to the complementarity of full-length antisense oligonucleotides to the HBV target sequence. Although the combination of specific types of modifications at certain positions improves complementarity, other combinations of specific types of modifications and positions reduce complementarity, thereby increasing off-target binding, which ultimately leads to toxicity.

[0013] Provided herein are methods, compounds, and compositions for regulating the expression of HBV mRNA and protein. In certain embodiments, the compound that can be used to regulate the expression of HBV mRNA and protein is an antisense compound. In certain embodiments, the antisense compound is an antisense oligonucleotide.

[0014] In certain embodiments, the modulation may occur in a cell or tissue. In certain embodiments, the cell or tissue is an animal cell or tissue. In certain embodiments, the animal is a human. In certain embodiments, HBV mRNA levels are reduced. In certain embodiments, HBV DNA levels are reduced. In certain embodiments, HBV protein levels are reduced. In certain embodiments, HBV antigen levels are reduced. In certain embodiments, HBV s antigen (HBsAg) levels are reduced. In certain embodiments, HBV e antigen (HBeAg) levels are reduced. Such reduction may occur in a time-dependent or dose-dependent manner.

[0015] Also provided are methods, compounds and compositions that can be used for preventing, treating and improving diseases, illnesses and conditions. In certain embodiments, such HBV related diseases, illnesses and conditions are liver diseases. In certain embodiments, such liver diseases, illnesses and conditions include jaundice, liver cancer, liver inflammation, liver fibrosis, inflammation, cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia and liver disease-related transplantation. In certain embodiments, such HBV related diseases, illnesses and conditions are hyperproliferative diseases, illnesses and conditions. In certain embodiments, such hyperproliferative diseases, illnesses and conditions include cancer and related malignancies and metastasis. In certain embodiments, such cancers include liver cancer and hepatocellular carcinoma (HCC).

[0016] Such diseases, disorders, and conditions may share one or more risk factors, causes, or outcomes. Certain risk factors and outcomes for the development of liver disease or a hyperproliferative disorder include the following: advancing age; tobacco use; exposure to sunlight and ionizing radiation; contact with certain chemicals; infection with certain viruses and bacteria; certain hormone therapies; a family history of cancer; alcohol use; and certain lifestyle choices, including a poor diet, lack of physical activity, and / or being overweight. Certain symptoms and outcomes associated with the development of liver disease or a hyperproliferative disorder include, but are not limited to: a flu-like illness, weakness, pain, headache, fever, loss of appetite, diarrhea, jaundice, nausea and vomiting, pain in the liver area of ​​the body, clay-colored or gray stools, general itching, and dark urine.

[0017] In certain embodiments, the method of treatment comprises administering to a subject in need thereof an HBV antisense compound. In certain embodiments, the method of treatment comprises administering to a subject in need thereof an HBV antisense oligonucleotide. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Provided in Figure 2 A legend for the nucleoside modifications at each position in the sequence shown in FIG. The “Example” column describes each type of nucleoside modification.

[0019] Figure 2 A table showing exemplary modified oligonucleotides of the present disclosure is shown. Figure 1 The legend in the figure reads out the modification at each position of the modified oligonucleotide sequence. AUS1010 to AUS1714 (SEQ ID NO: 11 to SEQ ID NO: 666) represent modified oligonucleotide sequences. AUS1233 (SEQ ID NO: 10), also known as AUS1138, is the reference modified oligonucleotide sequence.

[0020] Figure 3 A schematic diagram of the solid phase synthesis method for producing modified oligonucleotides is shown.

[0021] Figure 4 Schematic diagram showing the modified oligonucleotide dosing regimen and HBsAg level sampling schedule for HBV Tg mice.

[0022] Figure 5 Schematic diagram showing the modified oligonucleotide dosing regimen and HBsAg level sampling schedule for C57BL / 6Tg mice.

[0023] Figure 6 Schematic diagram showing the modified oligonucleotide dosing regimen and alanine aminotransferase (ALT) and aspartate aminotransferase (AST) level sampling schedule for C57BL / 6Tg mice.

[0024] Figure 7 Schematic diagram showing the modified oligonucleotide dosing regimen and HBsAg level sampling schedule for pAAV-1.2HBV-GTA HDI-HBV mice.

[0025] Figure 8 Schematic diagram showing the modified oligonucleotide dosing regimen and alanine aminotransferase (ALT) and aspartate aminotransferase (AST) level sampling schedule for C57BL / 6Tg mice.

[0026] Figure 9Schematic diagram showing an exemplary modified oligonucleotide dosing regimen and HBsAg level sampling schedule for pcDNA3.1-preS2-GTD HDI-HBV mice.

[0027] Figure 10 Schematic diagram showing an exemplary modified oligonucleotide dosing regimen and HBsAg level sampling schedule for pcDNA3.1-preS2-GTA HDI-HBV mice.

[0028] Figure 11 Schematic diagram showing an exemplary modified oligonucleotide dosing regimen and HBsAg level sampling schedule for GTA HBV Tg mice.

[0029] Figure 12 Schematic diagram showing an exemplary modified oligonucleotide dosing regimen and HBsAg level sampling schedule for GTD AAV-HBV Tg mice.

[0030] Figure 13 Schematic diagram showing an exemplary modified oligonucleotide dosing regimen and alanine aminotransferase (ALT) and aspartate aminotransferase (AST) level sampling schedule for C57BL / 6Tg mice.

[0031] Figure 14 Table 15.1 shows the serum levels of HBsAg in GT-C 1.0 HBV transgenic mice on days 3, 7, 10, 14, 21, and 28 after subcutaneous treatment with 40 mg / kg of modified oligonucleotides AUS1233, AUS1683, AUS1684, AUS1685, AUS1220, AUS1322, AUS1323, or AUS1324. Mean values ​​are expressed as log 10 express.

[0032] Figure 15 Table 15.2 shows the serum levels of HBsAg in GT-C 1.0 HBV transgenic mice on days 3, 7, 10, 14, 21, and 28 after subcutaneous treatment with 40 mg / kg of modified oligonucleotides AUS1169, AUS1171, AUS1170, AUS1168, or AUS1322. The mean values ​​are expressed as log 10 express.

[0033] Figure 16Table 15.3 shows the serum levels of HBsAg in GT-C 1.0 HBV transgenic mice on days 3, 7, 10, 14, and 21 after subcutaneous treatment with 30 mg / kg of modified oligonucleotides AUS1434, AUS1435, AUS1440, AUS1436, AUS1437, AUS1438, AUS1439, AUS1441, AUS1422, AUS1423, AUS1424, AUS1425, AUS1426, AUS1427, AUS1428, AUS1429, AUS1430, AUS1431, AUS1432, or AUS1433. Mean values ​​are expressed as log 10 express.

[0034] Figure 17 Table 15.4 shows the serum levels of HBsAg in GT-C 1.0 HBV transgenic mice on days 3, 7, 10, 14, and 21 after subcutaneous treatment with 30 mg / kg of modified oligonucleotides AUS1463, AUS1466, AUS1476, AUS1472, AUS1489, or AUS1459. The mean values ​​are expressed as log 10 express.

[0035] Figure 18 Table 15.5 shows the serum levels of HBsAg in GT-C 1.0 HBV transgenic mice on days 3, 7, 10, 14, 21, and 28 after subcutaneous treatment with 30 mg / kg of modified oligonucleotides AUS1492, AUS1495, AUS1494, AUS1493, AUS1482, or AUS1441. The mean values ​​are expressed as log 10 express.

[0036] Figure 19 Table 15.6 shows the serum levels of HBsAg in GT-C 1.0 HBV transgenic mice on days 3, 7, 10, 14, and 21 after subcutaneous treatment with 40 mg / kg of modified oligonucleotides AUS1693, AUS1694, AUS1695, AUS1696, AUS1697, AUS1698, AUS1699, or AUS1700. The mean values ​​are expressed as log 10 express.

[0037] Figure 20Table 15.7 shows the serum levels of HBsAg in GT-C 1.0 HBV transgenic mice on days 3, 7, 10, 14, 21, and 28 after treatment with modified oligonucleotides. Rows 1 and 2 show the HBsAg levels after a 10 mg / kg subcutaneous dose of AUS1493 or AUS1233 on day 0. Rows 3 and 4 show the HBsAg levels after a 30 mg / kg subcutaneous dose of AUS1493 or AUS1233 on day 0. The mean values ​​are expressed as log 10 express.

[0038] Figure 21 Table 16.1 shows the serum levels of HBsAg in GT-D HDI HBV mice on days 3, 7, 10, 14, 21, and 28 after subcutaneous treatment with 60 mg / kg of eASO compounds AUS1683, AUS1684, AUS1685, AUS1220, AUS1322, AUS1323, or AUS1324. The mean values ​​are expressed as log 10 express.

[0039] Figure 22 Table 16.2 shows the serum levels of HBsAg in GT-D HDIHBV mice on days 3, 7, 10, 14, 21, and 28 after subcutaneous treatment with 60 mg / kg of eASO compounds AUS1169, AUS1171, AUS1170, or AUS1168. The mean values ​​are expressed as log 10 express.

[0040] Figure 23 Table 16.3 shows the serum levels of HBsAg in GT-D HDI HBV mice on days 3, 7, 10, 14, and 21 after subcutaneous treatment with 60 mg / kg of eASO compounds AUS1173, AUS1174, AUS1175, or AUS1176. The mean values ​​are expressed as log 10 express.

[0041] Figure 24Table 16.4 shows the GT-D HDI at days 3, 7, 10, and 14 after subcutaneous treatment with 60 mg / kg of eASO compounds AUS1173, AUS1177, AUS1178, AUS1179, AUS1180, AUS1181, AUS1182, AUS1194, AUS1184, AUS1185, AUS1186, AUS1187, AUS1188, AUS1189, AUS1190, AUS1191, AUS1192, AUS1193, AUS1183, AUS1239, AUS1325, AUS1326, AUS1327, AUS1328, AUS1329, AUS1175, AUS1361, or AUS1362. Serum levels of HBsAg in HBV mice. The mean values ​​are expressed as log 10 express.

[0042] Figure 25 Table 16.5 shows the serum levels of HBsAg in GT-D HDIHBV mice on days 3, 7, 10, 14, and 22 after subcutaneous treatment with 60 mg / kg of eASO compounds AUS1322, AUS1382, AUS1383, AUS1384, or AUS1385. The mean values ​​are expressed as log 10 express.

[0043] Figure 26 Table 16.6 shows the serum levels of HBsAg in GT-D HDI HBV mice on days 3, 7, 10, 14, and 21 after subcutaneous treatment with 60 mg / kg of eASO compounds AUS1322, AUS1388, AUS1389, AUS1390, AUS1392, AUS1393, AUS1396, AUS1403, AUS1409, AUS1411, AUS1413, AUS1414, or AUS1415. Mean values ​​are expressed as log 10 express.

[0044] Figure 27 Table 16.7 shows the serum levels of HBsAg in GT-D HDI HBV mice on days 3, 7, 10, and 14 after subcutaneous treatment with 60 mg / kg of eASO compounds AUS1387, AUS1326, AUS1328, AUS1388, AUS1390, AUS1403, or AUS1360. The mean values ​​are expressed as log 10 express.

[0045] Figure 28Table 16.8 shows the serum levels of HBsAg in GT-D HDI HBV mice on days 3, 7, 10, 14, and 21 following subcutaneous treatment with 40 mg / kg of eASO compounds AUS1434, AUS1435, AUS1440, AUS1436, AUS1437, AUS1438, AUS1439, AUS1441, AUS1422, AUS1423, AUS1424, AUS1425, AUS1426, AUS1427, AUS1428, AUS1429, AUS1430, AUS1431, AUS1432, or AUS1433. Mean values ​​are expressed as log 10 express.

[0046] Figure 29 Table 16.9 shows the results of the experiments using 40 mg / kg eASO compounds AUS1444, AUS1458, AUS1459, AUS1460, AUS1461, AUS1462, AUS1463, AUS1464, AUS1465, AUS1466, AUS1467, AUS1468, AUS1469, AUS1470, AUS1471, AUS1472, AUS1473, AUS1474, AUS1475, AUS1476, AUS1477, AUS1478, AUS1479, AUS1480, AUS1481, AUS182, AUS183 Serum levels of HBsAg in GT-D HDI HBV (1.5 μg / ml pcDNA3.1 preS2 / S plasmid) mice on days 3, 7, 10, 14, and 21 after subcutaneous treatment with AUS1473, AUS1474, AUS1475, AUS1476, AUS1477, AUS1478, AUS1479, AUS1480, AUS1481, AUS1482, AUS1483, AUS1488, AUS1489, AUS1490, AUS1443, AUS1444, or AUS1445. Mean values ​​are expressed as log 10 express.

[0047] Figure 30 Table 16.10 shows the serum levels of HBsAg in GT-D HDI HBV (1.5 ug / ml pcDNA3.1 preS2 / S plasmid) mice on days 3, 7, 10, 14, 21, and 28 after subcutaneous treatment with 15 mg / kg or 45 mg / kg of eASO compounds AUS1492, AUS1493, AUS1233, AUS1492, or AUS1493. Mean values ​​are expressed as log 10 express.

[0048] Figure 31Table 16.11 shows the serum levels of HBsAg in GT-A HDI HBV (1.5 ug / ml pcDNA3.1preS2 / S plasmid) mice on days 3, 7, 10, 14, 21, and 28 after subcutaneous treatment with 40 mg / kg of eASO compounds AUS1492, AUS1493, AUS1233, AUS1492, or AUS1493. Mean values ​​are expressed as log 10 express.

[0049] Figure 32 Table 16.12 shows the serum levels of HBsAg in GT-A HDIHBV (1.5 ug / ml pcDNA3.1preS2 / S plasmid) mice on days 3, 7, 10, 14, and 21 after subcutaneous treatment with 15 or 45 mg / kg of eASO compounds AUS1441, AUS1466, AUS1472, AUS1488, or AUS1489. Mean values ​​are expressed as log 10 express.

[0050] Figure 33 Table 16.13 shows the serum levels of HBsAg in GT-DHDI HBV (1.5 ug / ml pcDNA3.1 preS2 / S plasmid) mice on days 3, 7, 10, 14, 21, and 28 after subcutaneous treatment with 15 or 45 mg / kg of eASO compounds AUS1495, AUS1494, AUS1233, AUS1495, AUS1494, AUS1492, or AUS1441. Mean values ​​are expressed as log 10 express.

[0051] Figure 34 Table 16.14 shows the serum levels of HBsAg in GT-A HDI HBV (1.5 ug / ml pcDNA3.1 preS2 / S plasmid) mice on days 3, 7, 10, 14, 21, and 28 after subcutaneous treatment with 15 or 45 mg / kg of eASO compounds AUS1495, AUS1494, AUS1233, AUS1495, AUS1494, AUS1492, AUS1482, or AUS1441. Mean values ​​are expressed as log 10 express.

[0052] Figure 35Table 16.15 shows the serum levels of HBsAg in GT-B HDI HBV (0.5 ug / ml pcDNA3.1 preS2 / S plasmid) mice treated subcutaneously with 40 mg / kg of eASO compound AUS1684 on days 3, 7, 10, 14, and 21. The mean values ​​are expressed as log 10 express.

[0053] Figure 36 Table 16.16 shows the serum levels of HBsAg in GT-A1.2HBV mice on days 3, 7, 10, 14, 21, and 28 after subcutaneous treatment with 45 mg / kg of eASO compounds AUS1492 or AUS1493. The mean values ​​are expressed as log 10 express.

[0054] Figure 37 Table 16.17 shows the serum levels of HBsAg in GT-A HDI HBV (1.5 ug / ml pAAV-1.2HBV plasmid) mice on days 3, 7, 10, 14, and 21 after subcutaneous treatment with 40 mg / kg of eASO compounds AUS1396, AUS1422, AUS1423, AUS1424, AUS1425, AUS1426, AUS1427, AUS1428, AUS1429, AUS1430, AUS1431, AUS1432, or AUS1433. Mean values ​​are expressed as log 10 express.

[0055] Figure 38 Table 16.18 shows the effect of 40 mg / kg eASO compounds AUS1444, AUS1458, AUS1459, AUS1460, AUS1461, AUS1462, AUS1463, AUS1464, AUS1465, AUS1466, AUS1467, AUS1468, AUS1469, AUS1470, AUS1471, AUS1472, Serum levels of HBsAg in GT-A HDIHBV (1.5 μg / ml pAAV-1.2HBV plasmid) mice on days 3, 7, 10, 14, and 21 after subcutaneous treatment with AUS1473, AUS1474, AUS1475, AUS1476, AUS1477, AUS1478, AUS1479, AUS1480, AUS1481, AUS1482, AUS1483, AUS1488, AUS1489, AUS1490, AUS1443, or AUS1434. Mean values ​​are expressed as log10 express.

[0056] Figure 39 Table 17 shows the serum levels of HBsAg, HBeAg and HBV DNA in GT-DAAV HBV (rAAV-HBV1.3-mer WT replicon) mice treated subcutaneously with 40 mg / kg of eASO compound AUS1493 on days 3, 7, 10, 14, 21 and 28. The mean values ​​are expressed as log 10 express.

[0057] Figure 40 Table 18.1 shows the effects of 60 mg / kg eASO compounds AUS1434, AUS1435, AUS1440, AUS1436, AUS1437, AUS1438, AUS1439, AUS1441, AUS1178, AUS1190, AUS1188, AUS1192, AUS1422, AUS1423, AUS1424, AUS1425, AUS1426, AUS1427, AUS1428, AUS1429, AUS1430, AUS1431, AUS1432, AUS1433, AUS1434, AUS1435, AUS1440, AUS1436, AUS1437, AUS1438, AUS1439, AUS1441, AUS1178, AUS1190, AUS1188, AUS1192, AUS1422, AUS1423, AUS1424, AUS1426, AUS1427, AUS1428, AUS1429, AUS1430, AUS1431 Serum levels of ALT in WT male C57BL / 6 mice on days 5, 7, 10, 14, 17, and 21 after subcutaneous treatment with 1425, AUS1426, AUS1427, AUS1428, AUS1429, AUS1430, AUS1431, AUS1432, AUS1433, AUS1360, AUS1401, AUS1361, AUS1362, or AUS1411.

[0058] Figure 41

[00155] Table 18.2 shows serum levels of ALT in WT male C57BL / 6 mice on days 5, 7, 10, 14, 17, and 21 following subcutaneous treatment on days 0, 2, and 4 with 60 mg / kg of eASO compounds AUS1443, AUS1444, AUS1445, AUS1446, AUS1447, AUS1448, AUS1449, AUS1450, AUS1452, AUS1453, AUS1454, AUS1455, AUS1456, or AUS1457. DETAILED DESCRIPTION

[0059] It should be understood that the foregoing general description and the following detailed description are merely exemplary and explanatory and do not limit the claimed invention. In this article, unless otherwise expressly stated, the use of the singular includes the plural. As used herein, unless otherwise stated, the use of "or" means "and / or". In addition, the use of the term "including" and other forms such as "includes" and "included" is not restrictive. In addition, unless otherwise expressly stated, terms such as "element" or "component" cover both elements and components including one unit and elements and components including more than one subunit.

[0060] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety, both for the portions of the documents discussed herein and in their entireties.

[0061] definition

[0062] Unless specific definition is provided, the nomenclature and procedures and techniques used in conjunction with analytical chemistry, synthetic organic chemistry, and medicine and pharmaceutical chemistry as described herein are well known in the art and are commonly used. Standard techniques can be used for chemical synthesis and chemical analysis. Where permitted, all patents, applications, disclosed applications and other publications, GENBANK accession numbers and associated sequence information that can be obtained through databases such as the National Center for Biotechnology Information (NCBI), and other data mentioned in the disclosure throughout this paper are incorporated by reference into the part of the document discussed herein, and are incorporated into with its entirety.

[0063] Unless otherwise stated, the following terms have the following meanings:

[0064] "2'-O-methoxyethyl" (also 2'-MOE and 2'-O(CH2)2-OCH3) refers to an O-methoxy-ethyl modification at the 2' position of the furanose ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

[0065] "2'-MOE nucleoside" (also 2'-O-methoxyethyl nucleoside) means a nucleoside that includes a 2'-MOE modified sugar moiety.

[0066] "2'-substituted nucleoside" means a nucleoside that includes a substituent other than H or OH at the 2' position of the furanoyl ring. In certain embodiments, the 2'-substituted nucleoside comprises a nucleoside with a bicyclic sugar modification.

[0067] "3' target site" refers to the nucleotide of a target nucleic acid that is complementary to the 3'-most nucleotide of a particular antisense compound.

[0068] "5' target site" refers to the nucleotide of a target nucleic acid that is complementary to the 5'-most nucleotide of a particular antisense compound.

[0069] "5-methylcytosine" means cytosine modified with a methyl group attached to the 5 position. 5-Methylcytosine is a modified nucleobase.

[0070] "About" means within ±7% of a value. For example, if it is stated that "the compound affects at least about 70% inhibition of HBV," it implies that HBV levels are inhibited in the range of 63% and 77%.

[0071] An "acceptable safety profile" means a pattern of adverse effects that is within clinically acceptable limits.

[0072] "Active pharmaceutical agent" means one or more substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide targeting HBV is an active pharmaceutical agent.

[0073] "Active target region" means a target region to which one or more active antisense compounds are targeted. "Active antisense compound" means an antisense compound that reduces target nucleic acid levels or protein levels.

[0074] "Acute hepatitis B infection occurs when a person exposed to the hepatitis B virus begins to develop signs and symptoms of viral hepatitis. This period of time, called the incubation period, averages 90 days but can be as short as 45 days or as long as six months. For most people, the infection causes mild to moderate discomfort that goes away on its own because the body's immune response successfully fights the virus. However, some people, particularly those with compromised immune systems, such as those with AIDS, undergoing chemotherapy, taking immunosuppressant drugs, or taking steroids, have very serious problems due to acute HBV infection and can go on to develop more severe conditions, such as fulminant liver failure.

[0075] "Concurrent administration" refers to the co-administration of two pharmaceutical agents in any manner where the pharmacological effects of both agents manifest in the patient's body at the same time. Concomitant administration does not require that the two agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of the two agents do not need to manifest simultaneously. The effects need only overlap for a certain period of time and need not be coextensive.

[0076] "Administering" means providing a pharmaceutical agent to an individual and includes, but is not limited to, administration by a medical professional and self-administration.

[0077] "Agent" means an active substance that can provide a therapeutic benefit when administered to an animal. "First agent" means a therapeutic compound described herein. For example, a first agent can be an antisense oligonucleotide targeting HBV. "Second agent" means a second therapeutic compound described herein (e.g., a second antisense oligonucleotide targeting HBV) and / or a non-HBV therapeutic compound.

[0078] "Improvement" refers to a reduction in at least one indicator of the severity of a condition or disease. The severity of an indicator can be determined by subjective or objective measurements known to those skilled in the art.

[0079] "Animal" refers to human and non-human animals, including but not limited to mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including but not limited to monkeys and chimpanzees.

[0080] "Antibody" refers to a molecule characterized by reacting specifically with an antigen in some manner, wherein antibody and antigen are each defined in another manner. Antibody can refer to a complete antibody molecule or any fragment or region thereof, such as a heavy chain, light chain, F chain, or antigen. ab Area and F c district.

[0081] "Antisense activity" means any detectable or measurable activity attributable to hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.

[0082] "Antisense compound" means an oligomeric compound capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as antisense oligonucleotides, siRNA, shRNA, snoRNA, miRNA, and satellite repeat sequences.

[0083] "Antisense inhibition" means a decrease in the level of a target nucleic acid in the presence of an antisense compound that is complementary to the target nucleic acid, compared to the level of the target nucleic acid in the absence of the antisense compound.

[0084] "Antisense mechanisms" are all those mechanisms involving hybridization of a compound to a target nucleic acid, wherein the result or effect of hybridization is target degradation or target occupancy, accompanied by arrest of cellular machinery involved, for example, transcription or splicing.

[0085] "Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.

[0086] The "area under the curve" or "AUC" is the integral of the change in drug concentration in plasma over time. AUC can be determined for the total time for which data are available, e.g., until the drug is no longer detectable (AUC 0-t), the area under the curve (AUC 0-￥ ), or for a specific truncated time window, such as 24 hours after administration (AUC 0-24 ).

[0087] "Base complementarity" refers to the ability of nucleobases of an antisense oligonucleotide to precisely base pair (i.e., hybridize) with corresponding nucleobases in a target nucleic acid, and is mediated by Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between corresponding nucleobases.

[0088] "Bicyclic sugar" means a furanose ring modified by bridging two non-geminal carbon atoms. A bicyclic sugar is a modified sugar.

[0089] "Body weight" refers to the total body weight of an animal, including all tissues including adipose tissue.

[0090] "Cap structure" or "terminal cap moiety" means a chemical modification that has been incorporated at either terminus of an antisense compound.

[0091] "cEt" or "constrained ethyl" means a bicyclic sugar moiety including a bridge connecting the 4'-carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH3)-O-2'.

[0092] "Constrained ethyl nucleoside" (also cEt nucleoside) means a nucleoside that includes a bicyclic sugar moiety that includes a 4'-CH(CH3)-O-2' bridge.

[0093] A "chemically distinct region" refers to a region of an antisense compound that is chemically different to some extent from another region of the same antisense compound. For example, a region having 2'-O-methoxyethyl nucleotides is chemically different from a region having nucleotides without 2'-O-methoxyethyl modifications.

[0094] "Chimeric antisense compound" means an antisense compound having at least two chemically distinct regions, with multiple subunits at each position.

[0095] "Chronic hepatitis B infection" occurs when a person initially has an acute infection but is subsequently unable to fight off the infection. Whether the disease is chronic or resolves completely depends primarily on the age of the infected person. Approximately 90% of infants infected at birth will develop chronic disease. However, as a person ages, the risk of chronic infection decreases, such that between 20% and 50% of children and less than 10% of older children or adults will progress from acute infection to chronic infection. Although the ASO compositions of the present invention can also treat HBV-related conditions such as inflammation, fibrosis, cirrhosis, liver cancer, serum hepatitis, etc., chronic HBV infection remains the primary therapeutic target of embodiments of the present invention.

[0096] "Co-administration" means administering two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents can be in a single pharmaceutical composition, or they can be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents can be administered by the same or different routes of administration. Co-administration encompasses concurrent or sequential administration.

[0097] "Complementarity" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

[0098] "Adherence" refers to an individual's adherence to recommended therapy.

[0099] “Comprise”, “comprises” or “comprising” will be understood to imply the inclusion of stated steps or elements or groups of steps or elements but not the exclusion of any other steps or elements or groups of steps or elements.

[0100] "Consecutive nucleobases" means nucleobases that are immediately adjacent to each other.

[0101] "Cure" means a method or process of restoring health or prescribing treatment for an illness.

[0102] "Deoxyribonucleotide" means a nucleotide having a hydrogen at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotides can be modified with any of a variety of substituents.

[0103] "Design" or "designed to" refers to the process of designing oligomeric compounds that specifically hybridize to a selected nucleic acid molecule.

[0104] "Diluent" means an ingredient in a composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, in a drug to be injected, the diluent can be a liquid, such as a saline solution.

[0105] "Dosage unit" means the form in which a pharmaceutical agent is provided, for example, a pill, tablet, or other dosage unit known in the art.

[0106] "Dose" means a specified amount of a medicament provided in a single administration or over a specified time period. In certain embodiments, a dose can be administered as two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose requires a volume that is not easily accommodated by a single injection. In such embodiments, two or more injections can be used to achieve the desired dose. In certain embodiments, a dose can be administered as two or more injections to minimize injection site reactions in an individual. In other embodiments, the medicament is administered by infusion over an extended period of time or continuously. The dose can be stated as the amount of the medicament per hour, day, week, or month.

[0107] A "dosage regimen" is a combination of dosages designed to achieve one or more desired effects.

[0108] "Duration" means the period of time that an activity or event continues. In certain embodiments, the duration of treatment is the period of time during which a dose of a pharmaceutical agent is administered.

[0109] "Effective amount" in the context of modulating an activity or treating or preventing a condition means administering to a subject in need of such modulation, treatment or prevention that amount of active ingredient, in a single dose or as part of a series, which is effective to modulate the effect or treat or prevent or ameliorate the condition. The effective amount will vary depending on the health and physical condition of the subject to be treated, the classification group of the subject to be treated, the formulation of the composition, the assessment of the medical condition, and other relevant factors.

[0110] "Efficacy" means the ability to produce a desired effect.

[0111] "Expression" includes all functions of converting the coded information of a gene into structures that exist and operate in the cell. Such structures include, but are not limited to, the products of transcription and translation.

[0112] The term "fragment" as applied to polynucleotides will be understood to mean a nucleotide sequence that is reduced in length relative to a reference nucleic acid or nucleotide sequence, and comprises, consists essentially of, and / or consists of a nucleotide sequence of consecutive nucleotides that are identical or nearly identical (e.g., 60%, 70%, 80%, 90%, 92%, 95%, 98% or 99% identical) to a reference nucleic acid or nucleotide sequence. Where appropriate, such nucleic acid fragments according to the present invention may be included in a larger polynucleotide of which the nucleic acid fragment is a component. In some embodiments, such fragments may include, consist essentially of, and / or consist of an oligonucleotide that is at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200 or more consecutive nucleotides of a nucleic acid or nucleotide sequence according to the present invention.

[0113] "Fully complementary" or "100% complementary" means that every nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, the first nucleic acid is an antisense compound and the target nucleic acid is a second nucleic acid.

[0114] "Fully modified motif" refers to an antisense compound comprising a contiguous sequence of nucleosides, wherein substantially every nucleoside is a sugar-modified nucleoside having uniform modifications.

[0115] "Gapmer" means a chimeric antisense compound in which an internal region having multiple nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region may be chemically different from the one or more nucleosides comprising the external regions. The internal region may be referred to as the "gap," and each of the 5' and 3' external regions may be referred to as a "wing."

[0116] The "gap" is an internal segment of a chimeric antisense compound that includes one or more linked deoxynucleosides and is located between the 5' wing (W1) and the 3' wing (W2). The gap may be referred to as a "gap," "gap region," or "gap segment."

[0117] "HBV" means mammalian hepatitis B virus, including human hepatitis B virus. The term encompasses geographic genotypes of hepatitis B virus, particularly human hepatitis B virus, and variant strains of geographic genotypes of hepatitis B virus.

[0118] "HBV antigen" means any hepatitis B virus antigen or protein, including core proteins, such as "hepatitis B core antigen" or "HBcAG" and "hepatitis B E antigen" or "HBeAG", and envelope proteins, such as "HBV surface antigen" or "HBsAg" or "HBsAG".

[0119] "Hepatitis B E antigen" or "HBeAg" or "HBeAG" is a secreted, non-granular form of the HBV core protein. The HBV antigens HBeAg and HBcAg share primary amino acid sequences and therefore show cross-reactivity at the T cell level. HBeAg is not required for viral assembly or replication, but studies have shown that it may be required for the establishment of chronic infection. Neonatal infection with HBeAg-negative mutants typically results in fulminant acute rather than chronic HBV infection (Terezawa et al. (1991) Pediatr. Res. 29:5), while infection of young woodchucks with WHeAg-negative mutants results in a much lower rate of chronic WHV infection (Cote et al. (2000) Hepatology 31:190). HBeAg may act as a tolerogen by inactivating core-specific T cells through deletion or clonal anergy (Milich et al. (1998) J. Immunol. 160:8102). Following antiviral therapy and HBeAg seroconversion, there is a positive correlation between reductions in HBV viral load and antigen and reductions in T-cell expression of the inhibitory receptor programmed death-1 (PD-1; also known as PDCD1), a negative regulator of activated T cells (Evans et al. (2008) Hepatology 48:759).

[0120] "HBV mRNA" means any messenger RNA expressed by the hepatitis B virus.

[0121] "HBV nucleic acid" or "HBV DNA" means any nucleic acid encoding HBV. For example, in certain embodiments, HBV nucleic acid includes, but is not limited to, any viral DNA sequence encoding the HBV genome or a portion thereof, any RNA sequence transcribed from viral DNA including any mRNA sequence encoding an HBV protein.

[0122] "HBV protein" means any protein secreted by the hepatitis B virus. The term encompasses various HBV antigens, including core proteins such as "hepatitis E antigen," "HBeAg," or "HBeAG," and envelope proteins such as "HBV surface antigen" or "HBsAg."

[0123] "HBV surface antigen" or "HBsAg" or "HBsAG" is the envelope protein of infectious HBV virions, but is also secreted as non-infectious particles at serum levels 1000 times higher than HBV virions. Serum levels of HBsAg in infected humans or animals can be as high as 1000 ng / mL (Kann and Gehrlich (1998) Topley & Wilson's Microbiology and Microbial Infections, 9th ed., 745). In acute HBV infection, serum or serum levels of HBsAg are often high. ％The half-life of HBsAg in the blood is 8.3 days (Chulanov et al. (2003) "Journal of Medical Virology (J.Med.Virol.)" 69:313). The internalization of HBsAg in myeloid dendritic cells inhibits the increase of costimulatory molecules (i.e., B7) and inhibits T cell stimulation ability (den Brouw et al. (2008) "Immunology (Immunology)" 126:280), and dendritic cells from patients with chronic infection also show the expression of costimulatory molecules, the secretion of IL-12 and the defect of T cell stimulation in the presence of HBsAg (Zheng et al. (2004) "Journal of Viral Hepatitis (J.Viral Hepatitis)" 11:217). HBsAg-specific CD8 cells from CHB patients show altered tetramer binding. These CD8 cells are not anergic, but may have a TCR topology that confers partial tolerance or ignorance (Reignat et al (2002) J. Exp. Med. 195: 1089). In addition, a >1 log decrease in serum HBsAg at week 24 has a high predictive value (92%) for a sustained virological response (SVR-defined as undetectable HBV DNA by PCR 1 year after treatment) during Peg-IFNa2a therapy (Moucari et al (2009) Hepatology 49: 1151).

[0124] "Hepatitis B-related condition" or "HBV-related condition" means any disease, biological condition, medical condition, or event that is exacerbated by, caused by, associated with, related to, or traceable to infection, exposure, or disease with hepatitis B. The term hepatitis B-related condition includes chronic HBV infection, inflammation, fibrosis, cirrhosis, liver cancer, serum hepatitis, jaundice, liver cancer, liver inflammation, liver fibrosis, cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, transplant-related liver disease, and conditions with symptoms that may include any or all of the following: flu-like illness, weakness, pain, headache, fever, loss of appetite, diarrhea, nausea and vomiting, pain in the liver area of ​​the body, clay-colored or gray stools, generalized itching, and dark urine, accompanied by a positive test for the presence of hepatitis B virus, hepatitis B virus antigens, or a positive test for the presence of antibodies specific for hepatitis B virus antigens.

[0125] "Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense oligonucleotides and nucleic acid targets.

[0126] As used herein, the term "IC50" or "IC50 The "IC" is the concentration of the agent that reduces cell viability by half. Therefore, the IC 50 It is a measure of the effectiveness of an agent in inhibiting a biological process.

[0127] "Identifying an animal with HBV infection" means identifying an animal that has been diagnosed with HBV; or identifying an animal with any symptoms of HBV infection, including but not limited to chronic HBV infection, inflammation, fibrosis, cirrhosis, liver cancer, serum hepatitis, jaundice, liver cancer, liver inflammation, liver fibrosis, cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, transplant-related liver disease, and a condition with symptoms that may include any or all of the following: flu-like illness, weakness, pain, headache, fever, loss of appetite, diarrhea, nausea and vomiting, pain in the liver area of ​​the body, clay-colored or gray stools, general itching and dark urine, accompanied by a positive test for the presence of hepatitis B virus, hepatitis B virus antigens, or a positive test for the presence of antibodies specific for hepatitis B virus antigens, accompanied by a positive test for the presence of hepatitis B virus, hepatitis B virus antigens, or a positive test for the presence of antibodies specific for hepatitis B virus antigens.

[0128] "Immediately adjacent" means that there are no intervening elements between the immediately adjacent elements.

[0129] "Subject" means a human or non-human animal selected for treatment or therapy.

[0130] "Individual adherence behavior" means an individual's compliance with a recommended or prescribed therapy.

[0131] "Induce", "inhibit", "enhance", "elevate", "increase", "reduce" and the like generally indicate a quantitative difference between two states. Such terms may refer to a statistically significant difference between two states. For example, "effectively inhibiting the activity or expression of HBV" means that the activity or expression level of HBV in the treated sample will be quantitatively different from the activity or expression level of HBV in untreated cells, and may be statistically significant. Such terms apply to, for example, expression levels and activity levels. As used herein, the term "inhibit" or "reduce" or grammatical variants thereof refers to a reduction or reduction in a specified level or activity by at least about 5%, about 10%, about 15%, about 25%, about 35%, about 40%, about 50%, about 60%, about 75%, about 80%, about 90%, about 95% or more. In some embodiments, the inhibition or reduction results in little detectable activity, or substantially no detectable activity (at most, an insignificant amount, e.g., less than about 10% or even 5%).

[0132] "Inhibiting HBV" means reducing the level or expression of HBV mRNA, DNA, and / or protein. In certain embodiments, HBV is inhibited in the presence of an antisense compound targeting HBV, including an antisense oligonucleotide targeting HBV, compared to the expression of HBV mRNA, DNA, and / or protein levels in the absence of an HBV antisense compound such as an antisense oligonucleotide.

[0133] "Inhibiting expression or activity" refers to a decrease, blocking of expression or activity, and does not necessarily indicate complete elimination of expression or activity.

[0134] An "injection site reaction" refers to inflammation or unusual redness of a subject's skin at the site of an injection.

[0135] "Internucleoside linkage" refers to the chemical bond between nucleosides.

[0136] "Intraperitoneal administration" means administration by infusion or injection into the peritoneum.

[0137] "Intravenous administration" means administration into a vein.

[0138] "Extended" antisense oligonucleotides are antisense oligonucleotides that have one or more additional nucleosides relative to the antisense oligonucleotides disclosed herein.

[0139] "Linked deoxynucleosides" means deoxyribonucleic acid bases (A, G, C, T, U) linked by phosphates to form a nucleotide.

[0140] "Linked nucleosides" means adjacent nucleosides linked together by an internucleoside bond. Examples of linked nucleosides are linked nucleotides where the bond involves a phosphate group atom, e.g., a phosphodiester bond.

[0141] "Locked nucleic acid" or "LNA" or "LNA nucleoside" means a nucleic acid monomer having a bridge connecting the two carbon atoms between the 4' and 2' positions of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugars include, but are not limited to: (A) α-L-methyleneoxy (4'-CH2-O-2') LNA; (B) β-D-methyleneoxy (4'-CH2-O-2')-LNA; (C) ethyleneoxy (4'-(CH2)2-O-2') LNA; (D) aminooxy (4'-CH2-ON(R)-2') LNA; and (E) oxyamino (4'-CH2-N(R)-O-2') LNA; as described below.

[0142]

[0143] As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and 2' positions of the sugar, wherein each of the bridges independently comprises 1 or 2 to 4 linked groups independently selected from: -[C(R 1 )(R 2 )]n-、-C(R 1 )=C(R 2 )-、-C(R 1 )=N-、-C(=NR 1 )-, -C(=O)-, -C(=S)-, -O-, -Si(R 1 )2-、-S(=O) x -and-N(R 1 )-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R 1 and R 2 are independently H, a protecting group, a hydroxyl group, a C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ 1 、NJ I J 2 、SJ 1 、N3、COOJ 1 , acyl (C (= O) -H), substituted acyl, CN, sulfonyl (S (= O) 2 -J 1 ), or sulfoxide (S(=O)-J 1 ); and each J 1 and J 2 are independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C (= O) -H), substituted acyl, heterocyclic, substituted heterocyclic, C1-C 12Aminoalkyl, substituted C1-C 12 aminoalkyl or a protecting group.

[0144] Examples of 4'-2' bridging groups encompassed within the definition of LNA include, but are not limited to, one of the following formulae: - [C(R 1 )(R 2 )] n -、-[C(R 1 )(R 2 )] n -O-、-C(R 1 )(R 2 )-N(R 1 )-O-or—C(R 1 )(R 2 )-ON(R 1 )-. In addition, other bridging groups encompassed by the definition of LNA are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R 1 )-2' and 4'-CH2-N(R 1 )-O-2'-bridge, wherein each R 1 and R 2 are independently H, a protecting group or a C1-C 12 alkyl.

[0145] Also comprise LNA according to the definition of LNA of the present invention, wherein the 2 '-hydroxyl of ribosyl sugar ring is connected with 4 ' carbon atom of sugar ring, forms methylene oxygen base (4 '-CH thus -O-2 ') bridge to form dicyclo sugar moiety.Bridge can also be the methylene (-CH connecting 2 ' oxygen atom and 4 ' carbon atom -) group, for described group, use term methylene oxygen base (4 '-CH -O-2 ') LNA.In addition, in the case of the dicyclo sugar moiety with the ethylene bridging group in this position, use term ethylene oxygen base (4 '-CH CH -O-2 ') LNA.As used herein, α-L-methylene oxygen base (4 '-CH -O-2 '), i.e. the isomer of methylene oxygen base (4 '-CH -O-2 ') LNA is also encompassed in the definition of LNA.

[0146] “Maximum plasma concentration” or “C max " refers to the maximum concentration of a drug in plasma after a dose of the drug is administered to a subject. Methods for measuring drug concentration are known to those of ordinary skill in the art and include, among others, liquid chromatography and tandem mass spectrometry.

[0147] "Mismatch" or "non-complementary nucleobase" refers to a situation where a nucleobase of a first nucleic acid is unable to pair with the corresponding nucleobase of a second or target nucleic acid.

[0148] "Modified internucleoside linkage" refers to a substitution or any change in a naturally occurring internucleoside linkage (ie, a phosphodiester internucleoside linkage).

[0149] "Modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. "Unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0150] "Modified nucleoside" means a nucleoside that independently has a modified sugar moiety and / or a modified nucleobase.

[0151] "Modified nucleotide" means a nucleotide that independently has a modified sugar moiety, a modified internucleoside linkage, or a modified nucleobase.

[0152] "Modified oligonucleotide" means an oligonucleotide that includes at least one modified internucleoside linkage, modified sugar, and / or modified nucleobase.

[0153] "Modified sugar" means the substitution and / or any alteration of a natural sugar moiety.

[0154] "Monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, naturally occurring or modified nucleosides and nucleotides.

[0155] "Motif" means the pattern of unmodified and modified nucleosides in an antisense compound. "Natural sugar moiety" means a sugar moiety found in DNA (2'-H) or RNA (2'-OH). "Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester bond.

[0156] "Non-complementary nucleobases" refers to a pair of nucleobases that do not hydrogen bond with each other or otherwise support hybridization.

[0157] "Nucleic acid" refers to a molecule comprising monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, small interfering ribonucleic acid (siRNA), and microRNA (miRNA).

[0158] "Nucleobase" means a heterocyclic moiety capable of base pairing with another nucleic acid.

[0159] "Nucleobase complementarity" refers to a nucleobase that can base pair with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobases refer to nucleobases of an antisense compound that can base pair with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of the antisense compound can hydrogen bond with a nucleobase at a certain position of the target nucleic acid, the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at the nucleobase pair.

[0160] "Nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, linkage and / or nucleobase modifications.

[0161] "Nucleoside" means a nucleobase linked to a sugar. Nucleosides include deoxynucleosides, for example, deoxyribonucleosides.

[0162] "Nucleoside mimetics" include those structures that are used to replace sugars or sugars and bases, and are not necessarily connected at one or more positions of an oligomeric compound, such as nucleoside mimetics with morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclic or tricyclic sugar mimetics, for example, non-furanose sugar units. Nucleotide mimetics include those structures that are used to replace the bonds at one or more positions of a nucleoside and an oligomeric compound, such as peptide nucleic acids or morpholino (morpholino connected by -N(H)-C(=O)-O- or other non-phosphodiester bonds). Sugar surrogates overlap with the slightly broader term nucleoside mimetics, but are only intended to indicate the replacement of a sugar unit (furanose ring). The tetrahydropyranyl ring provided herein illustrates examples of sugar surrogates in which the furanose glycosyl group has been replaced by a tetrahydropyranyl ring system. "Mimetic" refers to a group substituted with a sugar, a core base and / or a nucleoside bond. Typically, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to the selected target.

[0163] "Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0164] "Off-target effects" refer to undesirable or deleterious biological effects associated with the modulation of RNA or protein expression of genes other than the intended target nucleic acid.

[0165] "Oligomeric compound" means a polymer of linked monomeric subunits capable of hybridizing to at least a region of a nucleic acid molecule.

[0166] "Oligonucleotide" means an oligonucleotide in which the internucleoside linkages do not contain a phosphorus atom.

[0167] "Oligonucleotide" means a polymer of linked nucleosides, each of which, independently of the others, may be modified or unmodified.

[0168] "Parenteral administration" means administration by injection (eg, bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal or intracerebroventricular administration.

[0169] "Peptide" means a molecule formed by linking at least two amino acids via an amide bond. Without limitation, as used herein, "peptide" refers to polypeptides and proteins.

[0170] "Pharmaceutically acceptable carrier" means a medium or diluent that does not interfere with the structure of the oligonucleotide. Certain such carriers enable the pharmaceutical composition to be formulated into, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject.

[0171] "Pharmaceutically acceptable derivatives" encompass pharmaceutically acceptable salts, conjugates, prodrugs, or isomers of the compounds described herein.

[0172] "Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, ie, salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesirable toxicological effects thereto.

[0173] "Pharmaceutical agent" means a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide targeting HBV is a pharmaceutical agent.

[0174] "Pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an antisense oligonucleotide and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition shows activity in certain cell lines in a free uptake assay.

[0175] "Phosphorothioate linkage" means a linkage between nucleosides in which the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

[0176] "Portion" means a continuous (i.e., connected) core base of a defined number of nucleic acids. In certain embodiments, a portion is a defined number of continuous core bases of a target nucleic acid. In certain embodiments, a portion is a defined number of continuous core bases of an antisense compound.

[0177] "Prevention" or "preventing" refers to delaying or arresting the onset or development of a condition or disease for a period of hours to days, preferably weeks to months.

[0178] "Prodrug" means a therapeutic agent prepared in an inactive form that is converted to an active form (ie, drug) within the body or its cells by the action of endogenous enzymes or other chemicals and / or conditions.

[0179] A "prophylactically effective amount" refers to an amount of an agent that provides a prophylactic or preventative benefit to an animal.

[0180] "Recommended Therapy" means a treatment recommended by a healthcare professional to cure, improve or prevent a disease.

[0181] A "region" is defined as a portion of a target nucleic acid having at least one identifiable structure, function, or characteristic property.

[0182] "Ribonucleotide" means a nucleotide having a hydroxyl group at the 2' position of the sugar portion of the nucleotide. Ribonucleotides can be modified with any of a variety of substituents.

[0183] "Salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, ie, salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesirable toxicological effects thereto.

[0184] A "segment" is defined as a smaller or sub-portion of a region within a target nucleic acid.

[0185] A "spacer" is a segment or region that separates two gap regions and is positioned between the two gap regions in a chimeric antisense compound. A spacer segment may have one or more nucleosides, wherein the nucleosides are chemically different from the nucleosides comprising the gap. A spacer segment includes nucleosides that are modified to impart properties such as enhanced inhibitory activity, increased binding affinity to the target nucleic acid, reduced in vivo toxicity, or resistance to degradation by nucleases in vivo. A chimeric antisense compound may include one or more spacer segments. A spacer may be referred to as a "spacer," "spacer region," or "spacer segment." Exemplary chimeric antisense compounds of the present disclosure include one, two, three, four, five, or six spacer segments.

[0186] If HBeAg is monitored as the determinant of seroconversion, "seroconversion" is defined as the absence of serum HBeAg plus the presence of serum HBeAb, or if HBsAg is monitored as the determinant of seroconversion, seroconversion is defined as the absence of serum HBsAg, as determined by the currently available detection limits of commercial ELISA systems.

[0187] "Shortened" or "truncated" versions of the antisense oligonucleotides taught herein have one, two, or more nucleosides deleted.

[0188] "Side effect" means a physiological response attributable to a treatment other than the desired effect. In certain embodiments, side effects include, but are not limited to, injection site reactions, abnormal liver function tests, abnormal renal function, liver toxicity, nephrotoxicity, central nervous system abnormalities, and myopathy. For example, an increase in serum aminotransferase levels can indicate liver toxicity or liver dysfunction. For example, increased bilirubin can indicate liver toxicity or liver dysfunction.

[0189] As used herein, "significantly" means a measurable or observable result, eg, a noticeable result, such as a significant improvement or a significant reduction, generally refers to a measurable or observable result, such as a measurable or observable improvement or reduction.

[0190] As used herein, a "site" is defined as a unique nucleobase position within a target nucleic acid.

[0191] "Slowing progression" means reducing the development of the disease.

[0192] "Specifically hybridizable" refers to antisense compounds that have a sufficient degree of complementarity between the antisense oligonucleotide and the target nucleic acid to induce the desired effect, while exhibiting minimal or no effect on non-target nucleic acids under conditions where specific binding is desired, i.e., physiological conditions in the context of in vivo assays and therapeutic treatments. "Stringent hybridization conditions" or "stringent conditions" refers to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimum number of other sequences.

[0193] As used herein, "statistically significant" means a measurable or observable parameter that is unlikely to occur by chance.

[0194] "Subcutaneous administration" means administration just beneath the skin. "Subject" means a human or non-human animal selected for treatment or therapy.

[0195] "Target" refers to a protein whose regulation is desired.

[0196] "Target gene" refers to a gene encoding a target.

[0197] "Targeting" refers to the process of designing and selecting antisense compounds that will specifically hybridize to a target nucleic acid and induce a desired effect.

[0198] "Target nucleic acid," "target RNA," "target RNA transcript," and "nucleic acid target" all mean a nucleic acid capable of being targeted by an antisense compound.

[0199] "Target region" means a portion of a target nucleic acid to which one or more antisense compounds are targeted.

[0200] "Target segment" means the sequence of nucleotides of the target nucleic acid of the antisense compound. "5' target site" refers to the 5'most nucleotide of the target segment. "3' target site" refers to the 3'most nucleotide of the target segment.

[0201] "Therapeutically effective amount" means an amount of an agent that provides a therapeutic benefit to an individual.

[0202] "Treatment" refers to the administration of a composition to effect an alteration or improvement of a disease or condition.

[0203] By "unmodified" nucleobases are meant the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0204] "Unmodified nucleotides" means nucleotides comprising naturally occurring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, the unmodified nucleotides are RNA nucleotides (i.e., 3-D-ribonucleosides) or DNA nucleotides (i.e., 3-D-deoxyribonucleosides).

[0205] A "validated target segment" is defined as at least an 8 nucleobase portion of the target region of a targeting active oligomeric compound (ie, 8 contiguous nucleobases).

[0206] A "wing" is a terminal segment of a chimeric antisense oligonucleotide that has been modified to confer properties on the oligonucleotide, such as enhanced inhibitory activity, increased binding affinity for the target nucleic acid, reduced in vivo toxicity, or resistance to degradation by nucleases in vivo. A wing may be referred to as a "wing," a "wing region," or a "wing segment." As used herein, a wing comprises at least two linked nucleosides; a subset of the linked nucleosides may include one or more deoxynucleosides, but the entire wing cannot consist solely of deoxynucleosides.

[0207] The chimeric antisense compounds of the present disclosure include a 5' wing segment (W1) located at the 5' end of the chimeric antisense oligonucleotide, and the residue at the 3' end of W1 cannot be a deoxynucleoside. The chimeric antisense compounds of the present disclosure also include a 3' wing segment (W2) located at the 3' end of the chimeric antisense oligonucleotide, and the 5' terminal residue of W2 cannot be a deoxynucleoside.

[0208] The 5' wing (W1) begins at the 5' end of the chimeric antisense oligonucleotide extending in the 5' to 3' direction and ends at the first nucleoside that is not directly linked to the deoxynucleoside of the first gap, indicating the 3' end of W1 and the 5' end of the first gap (G1).

[0209] The 3' wing (W2) begins at the 3' end of the chimeric antisense oligonucleotide extending in the 3' to 5' direction and ends at the first nucleoside that is not directly linked to a deoxynucleoside of a gap, thereby indicating the 3' and 5' ends of the last gap of W2.

[0210] Exemplary Chimeric Antisense Oligonucleotides

[0211] The present disclosure provides at least the following exemplary chimeric antisense oligonucleotides.

[0212] In one aspect, a modified oligonucleotide is provided, wherein the modified oligonucleotide comprises from 5' to 3': 5'W1-G1-S1-G2-W2 3' (Formula I)

[0213] in:

[0214] W1 is the 5′ wing segment;

[0215] W2 is the 3′ wing segment;

[0216] G1 is the first gap segment;

[0217] S1 is the first separated sub-segment;

[0218] G2 is the second gap segment;

[0219] - is an internucleoside bond; and

[0220] At least one nucleoside of the oligonucleotide is modified.

[0221] In some embodiments, the modified oligonucleotide comprises from 5' to 3': 5'W1-G1-S1-G2-S2-G3-W2 3' (Formula II)

[0222] in:

[0223] S2 is the second separated sub-segment; and

[0224] G3 is the third gap segment.

[0225] In some embodiments, the modified oligonucleotide comprises from 5' to 3': 5'W1-G1-S1-G2-S2-G3-S3-G4-W2 3' (Formula III)

[0226] in:

[0227] S3 is the third separated sub-segment; and

[0228] G4 is the fourth gap segment.

[0229] In some embodiments, the modified oligonucleotide comprises from 5' to 3': 5'W1-G1-S1-G2-S2-G3-S3-G4-S4-G5-W2 3' (Formula IV)

[0230] in:

[0231] S4 is the fourth separated sub-segment; and

[0232] G5 is the fifth gap segment.

[0233] In some embodiments, the modified oligonucleotide comprises from 5' to 3': 5'W1-G1-S1-G2-S2-G3-S3-G4-S4-G5-S5-G6-W2 3' (Formula V)

[0234] in:

[0235] S5 is the fifth separated sub-segment; and

[0236] G6 is the sixth gap segment.

[0237] In some embodiments, the modified oligonucleotide comprises from 5' to 3': 5'W1-G1-S1-G2-S2-G3-S3-G4-S4-G5-S5-G6-S6-G7-W23' (Formula VI)

[0238] in:

[0239] S6 is the sixth separating sub-segment; and

[0240] G7 is the seventh gap segment.

[0241] In some embodiments, W1 comprises 2 to 25 linked nucleosides. In some embodiments, W1 comprises one or more linked deoxynucleosides.

[0242] In some embodiments, W2 comprises 2 to 35 linked nucleosides. In some embodiments, W2 comprises one or more linked deoxynucleosides.

[0243] In some embodiments, any one or more of G1, G2, G3, G4, G5, G6, and / or G7 include 1 to 10 linked deoxynucleosides.

[0244] In some embodiments, any one or more of S1, S2, S3, S4, S5, and / or S6 comprises 1, 2, 3, 4, or 5 linked deoxynucleosides.

[0245] In some embodiments, the length of the modified oligonucleotide is 18-50 nucleobases. In some embodiments, the length of the modified oligonucleotide is at least 20 nucleobases. In some embodiments, the length of the modified oligonucleotide is 20 nucleobases.

[0246] In some embodiments, the modified oligonucleotide has Formula I, and W1 comprises 4-6 linked nucleosides, G1 comprises 1-6 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 1-6 linked deoxynucleosides, and W2 comprises 4-6 linked nucleosides.

[0247] In some embodiments, the modified oligonucleotide has Formula I, and W1 comprises 4-6 linked nucleosides, G1 comprises 5 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 5 linked deoxynucleosides, and W2 comprises 4-6 linked nucleosides.

[0248] In some embodiments, the modified oligonucleotide has Formula I, and W1 comprises 4 linked nucleosides, G1 comprises 5 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 5 linked deoxynucleosides, and W2 comprises 5 linked nucleosides.

[0249] In some embodiments, the modified oligonucleotide has Formula I, and G1-S1-G2 is between 8 and 12 nucleobases in length.

[0250] The following examples relate to any one of Formula I-VI: In some embodiments, G1, G2, G3, G4, G5, G6 and G7 may include nucleosides comprising modifications to 2'-deoxynucleosides. In certain embodiments, any one or more of G1, G2, G3, G4, G5, G6 and G7 include nucleosides comprising 2'-deoxy 5-methylcytidine sugar modifications. In certain embodiments, S1, S2, S3, S4, S5 and / or S6 include nucleosides comprising 2'-O-methoxyethyl sugar modifications. In certain embodiments, S1, S2, S3, S4, S5 and / or S6 include nucleosides comprising 5-methylcytidine. In certain embodiments, S1, S2, S3, S4, S5 and / or S6 include nucleosides comprising 2'-O-methyl sugar modifications. In certain embodiments, S1, S2, S3, S4, S5 and / or S6 include nucleosides comprising 2'-OH sugar modifications. In certain embodiments, S1, S2, S3, S4, S5 and / or S6 include nucleosides comprising 2'-fluoro sugar modifications. In certain embodiments, S1, S2, S3, S4, S5 and / or S6 include nucleosides comprising 2'-fluoro-arabinoic acid (2'-fluoro-ANA) sugar modifications. In certain embodiments, S1, S2, S3, S4, S5 and / or S6 include ethylene glycol nucleic acid (GNA). In certain embodiments, S1, S2, S3, S4, S5 and / or S6 include LNA. In certain embodiments, W1 includes nucleosides comprising 2'-deoxy sugar modifications (for example, wherein the 2'-deoxy sugar modifications are positioned at position 2 and / or 5 of the sequence corresponding to SEQ ID NO: 2). In certain embodiments, W1 includes nucleosides comprising 2'-O-methoxyethyl sugar modifications (for example, wherein the 2'-O-methoxyethyl sugar modifications are positioned at position 1, 2, 3, 4 and / or 5 of the sequence corresponding to SEQ ID NO: 2). In some embodiments, W1 includes 2'-O-methoxyethyl 5-methylcytidine at position 2 of the sequence corresponding to SEQ ID NO:2. In some embodiments, W1 includes nucleosides comprising 2'-O-methyl sugar modifications (e.g., wherein the 2'-O-methyl sugar modifications are located at position 1, 2, 3, 4, and / or 5 of the sequence corresponding to SEQ ID NO:2). In some embodiments, W1 includes 2'-O-methyl 5-methylcytidine at position 2 of the sequence corresponding to SEQ ID NO:2. In some embodiments, W1 includes nucleosides comprising 2'-fluoro sugar modifications. In some embodiments, W1 includes nucleosides comprising 2'-fluoro-arabinoic acid (2'-fluoro-ANA) modifications. In some embodiments, W1 includes glycol nucleic acid (GNA) (e.g., wherein the GNA is located at position 2 of the sequence corresponding to SEQ ID NO:2).In some embodiments, W1 comprises a modified nucleoside, and wherein the modified nucleoside is a locked nucleic acid (LNA) (e.g., wherein the LNA is located at position 1 and / or 3 of the sequence corresponding to SEQ ID NO: 2). In some embodiments, W2 comprises a nucleoside comprising a 2'-deoxy sugar modification (e.g., wherein the 2'-deoxy sugar modification is located at position 15 and / or 16 of the sequence corresponding to SEQ ID NO: 2). In some embodiments, W2 comprises a nucleoside comprising a 2'-O-methoxyethyl sugar modification (e.g., wherein the 2'-O-methoxyethyl sugar modification is located at position 15, 16, 17, 18, 19, and / or 20 of the sequence corresponding to SEQ ID NO: 2). In some embodiments, W2 comprises a nucleoside comprising a 2'-O-methyl sugar modification (e.g., wherein the 2'-O-methyl sugar modification is located at position 15, 16, 17, 18, 19, and / or 20 of the sequence corresponding to SEQ ID NO: 2). In some embodiments, W2 comprises a nucleoside comprising a 2'-fluoro sugar modification. In some embodiments, W2 comprises a nucleoside comprising a 2'-fluoro-arabinoic acid (2'-fluoro-ANA) modification. In some embodiments, W2 comprises a modified nucleoside, and wherein the modified nucleoside is a glycol nucleic acid (GNA). In some embodiments, W2 comprises a modified nucleoside, and wherein the modified nucleoside is a locked nucleic acid (LNA) (e.g., wherein the LNA is located at position 16, 17, 18, 19, and / or 20 of the sequence corresponding to SEQ ID NO: 2).

[0251] Exemplary target sequences and exemplary modified oligonucleotides

[0252] Certain embodiments provide methods, compounds, and compositions for inhibiting HBV mRNA expression.

[0253] Certain embodiments provide antisense compounds targeting HBV nucleic acid sequences. Exemplary HBV nucleic acid sequences include, but are not limited to, those shown in Table 1.

[0254] Table 1 Exemplary HBV sequences

[0255] HBV genotype Accession number SEQ ID NO: GTD (HepG2.2.15 cells) U95551.1 SEQ ID NO:3 GTA AJ309369.1 SEQ ID NO:667 GTB D00330.1 SEQ ID NO:668 GTC AB033550.1 SEQ ID NO:669 GTD KX470733.1 SEQ ID NO:670 GTE KX186584 SEQ ID NO:671 GTF KP718112 SEQ ID NO:672 GTG KX264500 SEQ ID NO:673 GTH KX264501 SEQ ID NO:674

[0256] In certain embodiments, the HBV nucleic acid is the sequence set forth in GENBANK Accession No. U95551.1 (incorporated herein as SEQ ID NO: 3). In some embodiments, the antisense compound targets the sequence recited in SEQ ID NO: 3 or a portion thereof. In some embodiments, the antisense compound targets the sequence at positions 1583-1602 of SEQ ID NO: 3.

[0257] Exemplary HBV nucleic acid target sequences include, but are not limited to, those shown in Table 2.

[0258] Table 2. Exemplary HBV target sequences

[0259]

[0260]

[0261]

[0262]

[0263]

[0264] In some embodiments, the HBV target comprises a sequence of SEQ ID NOs: 1, 4, 675-838. In some embodiments, the HBV target comprises a sequence of CTTGG TCATG GGCCA TCAG (SEQ ID NO: 1). In some embodiments, the HBV target comprises a sequence of GCACT TCGCT TCACC TCTGC (SEQ ID NO: 4).

[0265] In certain embodiments, the compounds provided herein include modified oligonucleotides. In certain embodiments, the compounds include modified oligonucleotides and conjugates as described herein. In certain embodiments, the modified oligonucleotides are pharmaceutically acceptable derivatives.

[0266] In certain embodiments, the HBV target comprises the sequence recited in SEQ ID NO: 3, or a portion thereof, or a variant thereof. In certain embodiments, the modified oligonucleotide is at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or 100% complementary to the HBV nucleic acid.

[0267] In certain embodiments, the HBV target comprises the sequence recited in SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide is at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or 100% complementary to SEQ ID NO: 1.

[0268] In certain embodiments, the HBV target comprises the sequence recited in SEQ ID NO: 4. In certain embodiments, the modified oligonucleotide is at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or 100% complementary to SEQ ID NO: 4.

[0269] In some embodiments, the compound or composition comprises a modified oligonucleotide of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 linked nucleosides in length that bind to an HBV target sequence. In certain embodiments, the compound or composition comprises a modified oligonucleotide of 20 linked nucleosides that bind to an HBV target sequence.

[0270] In certain embodiments, the modified oligonucleotide of 20 linked nucleosides has a nucleobase sequence of GCAGA GGTGAAGCGAAGTGC (SEQ ID NO: 2). A diagram showing the nucleobase positions of SEQ ID NO: 2 is shown below:

[0271]

[0272] In certain embodiments, the modified oligonucleotide of 20 linked nucleosides has a nucleobase sequence of GTGAAGCGAAGTGCACACGG (SEQ ID NO: 5). A diagram showing the nucleobase positions of SEQ ID NO: 5 is shown below:

[0273]

[0274] In certain embodiments, the compound comprises a modified oligonucleotide as described herein. Exemplary modified oligonucleotides include, but are not limited to Figure 1-2 In some embodiments, the compound comprises a modified oligonucleotide comprising the sequence of any one of AUS1010 to AUS1714. In some embodiments, the compound comprises a modified oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11 to 666, or a modified oligonucleotide comprising 1, 2, 3, 4, or 5 modifications to the modified oligonucleotide.

[0275] In certain embodiments, the compound comprises a modified oligonucleotide comprising a sequence of any one of: A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, R, S, T, U, V, W, X, Y, Z, AA, AB, AC, AD, AE, AF, AG, AH, AI, AJ, AK, AL, AM, AN, AO, AP, AQ, AR, AS, AT, AU, AV, AW, or AX. Table 3 shows a correspondence table of letter identifiers, AUS identifiers, and SEQ ID NOs corresponding to the sequences of the modified oligonucleotides.

[0276] Table 3. Nomenclature of modified oligonucleotides

[0277]

[0278]

[0279] Characteristics of modified oligonucleotides

[0280] In certain embodiments, a compound includes a modified oligonucleotide of 20 linked nucleosides consisting of: a first gap segment consisting of linked nucleosides; a second gap segment consisting of linked nucleosides; a spacer segment consisting of nucleosides linked to the first gap segment and the second gap segment; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of linked nucleosides; wherein the first gap segment, the spacer segment, and the second gap segment are positioned between the 5' wing segment and the 3' wing segment; wherein the first gap segment is linked to the 5' wing segment and the second gap segment is linked to the 3' wing segment, wherein the first gap segment, the spacer segment, and the second gap segment together consist of 8 or 9 or 10 or 11 or 12 linked nucleosides.

[0281] In certain embodiments, the compound comprises a modified oligonucleotide of 20 linked nucleosides consisting of: a first gap segment consisting of linked nucleosides; a second gap segment consisting of linked nucleosides; a spacer segment consisting of nucleosides linked between the first gap segment and the second gap segment; wherein the first gap segment, the spacer segment, and the second gap segment together consist of 8 or 9 or 10 or 11 or 12 nucleotides; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of wherein the first gap segment, the second gap segment, and the spacer segment are positioned between the 5' wing segment and the 3' wing segment; wherein the first gap segment is linked to the 5' wing segment, and the second gap segment is linked to the 3' wing segment; wherein the first gap segment is linked to the 5' wing segment, and the second gap segment is linked to the 3' wing segment; wherein the first gap segment is linked to the nucleosides having a 2'-deoxy sugar; wherein the second gap segment is linked to the nucleosides having a 2'-deoxy sugar; wherein the spacer segment is linked to a nucleoside that includes a 2'-O(CH2)2-OCH3 sugar or a 2'-OCH3 sugar, wherein the modified oligonucleotide is at least 95% complementary to SEQ ID NO: 1; and wherein the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 2 (GCAGA GGTGA AGCGA AGTGC).

[0282] In certain embodiments, the compound comprises a modified oligonucleotide of 20 linked nucleosides consisting of: a first gap segment consisting of linked nucleosides; a second gap segment consisting of linked nucleosides; a spacer segment consisting of nucleosides linked between the first gap segment and the second gap segment; wherein the first gap segment, the spacer segment, and the second gap segment together consist of 8 or 9 or 10 or 11 or 12 nucleotides; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of linked nucleosides; wherein the first gap segment, the second gap segment, and the spacer segment are positioned at wherein the first gap segment is linked to the 5' wing segment and the second gap segment is linked to the 3' wing segment; wherein the first gap segment consists of linked nucleosides having a 2'-deoxy sugar; wherein the second gap segment consists of linked nucleosides having a 2'-deoxy sugar; wherein the spacer segment consists of a nucleoside that includes a 2'-O(CH2)2-OCH3 sugar or a 2'-OCH3 sugar, wherein at least one of the nucleosides in the 5' wing segment includes a 2'-O(CH2)2-OCH3 sugar; and wherein at least one of the nucleosides in the 3' wing segment includes a 2'-O(CH2)2-OCH3 sugar; wherein the modified oligonucleotide is at least 95% complementary to SEQ ID NO: 1; and wherein the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 2 (GCAGA GGTGA AGCGA AGTGC).

[0283] A. Common 5' wing segment

[0284] In certain embodiments, at least one of the nucleosides in the 5' wing segment includes a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, each of the nucleosides in the 5' wing segment includes a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment includes a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 5' wing segment includes a nucleoside with a 2'-deoxy sugar, and the other nucleosides in the 5' wing segment include a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the nucleoside at position 2 of SEQ ID NO:2 includes a 2'-deoxy sugar. In certain embodiments, the nucleoside at position 3 of SEQ ID NO:2 includes a 2'-deoxy sugar. In certain embodiments, the nucleoside at position 4 of SEQ ID NO:2 includes a 2'-deoxy sugar. In certain embodiments, the 5' wing segment further includes two nucleosides, each of which has a 2'-deoxy sugar. In certain embodiments, the nucleosides at positions 2 and 3 of SEQ ID NO:2 comprise 2'-deoxy sugars. In certain embodiments, the nucleosides at positions 2 and 4 of SEQ ID NO:2 comprise 2'-deoxy sugars. In certain embodiments, the nucleosides at positions 3 and 4 of SEQ ID NO:2 comprise 2'-deoxy sugars. In certain embodiments, the nucleosides at positions 2 and 5 of SEQ ID NO:2 comprise 2'-deoxy sugars.

[0285] In certain embodiments, one, two, three, or four of the nucleosides in the 5' wing segment comprise a sugar modification as described herein. In certain embodiments, one, two, three, or four of the nucleosides in the 5' wing segment comprise a bicyclic sugar. In certain embodiments, one, two, three, or four of the nucleosides in the 5' wing segment comprise a constrained ethyl sugar.

[0286] In certain embodiments, one, two, three, or four of the nucleosides in the 5' wing segment comprise locked nucleic acid. In certain embodiments, one, two, three, or four of the nucleosides in the 5' wing segment comprise 4'-CH2-O-2' sugar. In certain embodiments, two of the nucleosides in the 5' wing segment comprise locked nucleic acid. In certain embodiments, two of the nucleosides in the 5' wing segment comprise 4'-CH2-O-2' sugar. In certain embodiments, the nucleosides at positions 1 and 3 of SEQ ID NO:2 comprise locked nucleic acid. In certain embodiments, the nucleosides at positions 1 and 3 of SEQ ID NO:2 comprise 4'-CH2-O-2' sugar.

[0287] B1. 5' wing segment with 4 linked nucleosides

[0288] In certain embodiments, the 5' wing segment is made up of 4 connected nucleosides. In certain embodiments, the 5' wing segment is made up of 4 connected nucleosides, wherein the nucleosides of each connection in the 4 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment is made up of 4 connected nucleosides, wherein the nucleosides of 3 connections in the 4 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment is made up of 4 connected nucleosides, wherein the nucleosides of 2 connections in the 4 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment is made up of 4 connected nucleosides, wherein the nucleosides of 1 connection in the 4 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar.

[0289] B2. 5' wing segment with 4 linked nucleosides, 2'-deoxy combination

[0290] In certain embodiments, the 5' wing segment is made up of 4 nucleosides connected, and the nucleosides wherein one of the nucleosides connected includes nucleosides with 2'-deoxy sugar. In certain embodiments, the 5' wing segment is made up of 4 nucleosides connected, and the nucleosides wherein two of the nucleosides connected include nucleosides with 2'-deoxy sugar. In certain embodiments, the 5' wing segment is made up of 4 nucleosides connected, and the nucleosides wherein one of the nucleosides connected in the 4 connections includes nucleosides with 2'-deoxy sugar, and the nucleosides of each connection in the nucleosides of other 3 connections include nucleosides with 2'-O (CH2) 2-OCH3 sugared nucleosides. In certain embodiments, the 5' wing segment is made up of 4 nucleosides connected, and the nucleosides wherein one of the nucleosides connected in the 4 connections includes nucleosides with 2'-deoxy sugar, the nucleosides of one of the nucleosides connected in the 4 connections include locked nucleic acid, and the nucleosides of each connection in the nucleosides of other 2 connections include nucleosides with 2'-O (CH2) 2-OCH3 sugared nucleosides. In certain embodiments, the 5'-wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, two of the 4 linked nucleosides comprise locked nucleic acid, and the other linked nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0291] In certain embodiments, the 5' wing segment is composed of 4 connected nucleosides, wherein the nucleoside at position 2 of SEQ ID NO:2 includes 2'-deoxy sugar. In certain embodiments, the 5' wing segment is composed of 4 connected nucleosides, wherein the nucleoside at position 2 of SEQ ID NO:2 includes 2'-deoxy sugar, and the nucleoside of each connection in the other 3 connected nucleosides includes a nucleoside with 2'-O (CH2) 2-OCH3 sugar. In certain embodiments, the 5' wing segment is composed of 4 connected nucleosides, wherein the nucleoside at position 3 of SEQ ID NO:2 includes 2'-deoxy sugar. In certain embodiments, the 5' wing segment is composed of 4 connected nucleosides, wherein the nucleoside at position 3 of SEQ ID NO:2 includes 2'-deoxy sugar. In certain embodiments, the 5'-wing segment consists of 4 linked nucleosides, wherein the nucleoside at position 4 of SEQ ID NO: 2 comprises a 2'-deoxy sugar. In certain embodiments, the 5'-wing segment consists of 4 linked nucleosides, wherein the nucleoside at position 4 of SEQ ID NO: 2 comprises a 2'-deoxy sugar, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0292] In certain embodiments, the 5' wing segment is composed of 4 connected nucleosides, wherein the nucleosides at positions 2 and 3 of SEQ ID NO:2 include 2'-deoxy sugars. In certain embodiments, the 5' wing segment is composed of 4 connected nucleosides, wherein the nucleosides at positions 2 and 3 of SEQ ID NO:2 include 2'-deoxy sugars, and each of the connected nucleosides of the other 2 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugars. In certain embodiments, the 5' wing segment is composed of 4 connected nucleosides, wherein the nucleosides at positions 2 and 4 of SEQ ID NO:2 include 2'-deoxy sugars. In certain embodiments, the 5' wing segment is composed of 4 connected nucleosides, wherein the nucleosides at positions 2 and 4 of SEQ ID NO:2 include 2'-deoxy sugars, and each of the connected nucleosides of the other 2 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugars. In certain embodiments, the 5'-wing segment consists of 4 linked nucleosides, wherein the nucleosides at positions 3 and 4 of SEQ ID NO: 2 include 2'-deoxy sugars. In certain embodiments, the 5'-wing segment consists of 4 linked nucleosides, wherein the nucleosides at positions 3 and 4 of SEQ ID NO: 2 include 2'-deoxy sugars, and each of the other 2 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0293] B3. 5' wing segment with 4 linked nucleosides, 2'-LNA combination

[0294] In certain embodiments, the 5' wing segment consists of 4 connected nucleosides, wherein one of the 4 connected nucleosides connects a locked nucleic acid. In certain embodiments, the 5' wing segment consists of 4 connected nucleosides, wherein two of the 4 connected nucleosides connect a locked nucleic acid. In certain embodiments, the 5' wing segment consists of 4 connected nucleosides, wherein one of the 4 connected nucleosides connects a locked nucleic acid. In certain embodiments, the 5' wing segment consists of 4 connected nucleosides, wherein one of the 4 connected nucleosides connects a 4'-CH2-O-2' sugar. In certain embodiments, the 5' wing segment consists of 4 connected nucleosides, wherein two of the 4 connected nucleosides connect a 4'-CH2-O-2' sugar.

[0295] In certain embodiments, the 5' wing segment is made up of 4 connected nucleosides, wherein the nucleoside that one of the 4 connected nucleosides is connected comprises a locked nucleic acid, and the nucleoside that each of the other 3 connected nucleosides is connected comprises a nucleoside with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment is made up of 4 connected nucleosides, wherein the nucleoside that two of the 4 connected nucleosides are connected comprises a locked nucleic acid, and the nucleoside that each of the other 2 connected nucleosides is connected comprises a nucleoside with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment is made up of 4 connected nucleosides, wherein the nucleoside that one of the 4 connected nucleosides is connected comprises a 4'-CH2-O-2' sugar, and the nucleoside that each of the other 3 connected nucleosides is connected comprises a nucleoside with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5'-wing segment consists of 4 linked nucleosides, wherein two of the 4 linked nucleosides include a 4'-CH2-O-2' sugar and each of the other 2 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0296] In certain embodiments, the 5'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 1 and 3 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 5'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 1 and 3 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0297] In certain embodiments, the 5' wing segment is composed of 4 connected nucleosides, and the nucleosides at positions 1 and 3 of SEQ ID NO:2 include locked nucleic acid, and the nucleosides of each connection in the other 2 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugars. In certain embodiments, the 5' wing segment is composed of 4 connected nucleosides, and the nucleosides at positions 1 and 3 of SEQ ID NO:2 include 4'-CH2-O-2' sugars, and the nucleosides of each connection in the other 2 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugars.

[0298] C1. 5' wing segment with 5 linked nucleosides

[0299] In certain embodiments, the 5' wing segment is made up of 5 connected nucleosides. In certain embodiments, the 5' wing segment is made up of 5 connected nucleosides, wherein the nucleosides of each connection in the 5 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment is made up of 5 connected nucleosides, wherein the nucleosides of 4 connections in the 5 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment is made up of 5 connected nucleosides, wherein the nucleosides of 3 connections in the 5 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment is made up of 5 connected nucleosides, wherein the nucleosides of 2 connections in the 5 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5'-wing segment consists of 5 linked nucleosides, wherein 1 linked nucleoside of the 5 linked nucleosides comprises a nucleoside having a 2'-O(CH2)2-OCH3 sugar.

[0300] C2. 5' wing segment with 5 linked nucleosides, 2'-deoxy combination

[0301] In certain embodiments, the 5' wing segment is made up of 5 nucleosides connected, and the nucleosides wherein one of the nucleosides connected in the nucleosides connected includes nucleosides with 2'-deoxy sugar. In certain embodiments, the 5' wing segment is made up of 5 nucleosides connected, and the nucleosides wherein two of the nucleosides connected in the nucleosides connected include nucleosides with 2'-deoxy sugar. In certain embodiments, the 5' wing segment is made up of 5 nucleosides connected, and the nucleosides wherein one of the nucleosides connected in the 5 nucleosides connected includes nucleosides with 2'-deoxy sugar, and the nucleosides of each connection in the nucleosides of other 4 connections include nucleosides with 2'-O (CH2) 2-OCH3 sugared nucleosides. In certain embodiments, the 5' wing segment is made up of 5 nucleosides connected, and the nucleosides wherein one of the nucleosides connected in the 5 nucleosides connected includes nucleosides with 2'-deoxy sugar, and the nucleosides of each connection in the nucleosides of the 5 connections connected include locked nucleic acid, and the nucleosides of each connection in the nucleosides of other 3 connections include nucleosides with 2'-O (CH2) 2-OCH3 sugared nucleosides. In certain embodiments, the 5'-wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, two of the 5 linked nucleosides comprise locked nucleic acid, and the other 2 linked nucleosides comprise nucleosides with a 2'-O(CH2)2-OCH3 sugar.

[0302] In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, wherein the nucleoside at position 2 of SEQ ID NO:2 includes 2'-deoxy sugar. In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, wherein the nucleoside at position 2 of SEQ ID NO:2 includes 2'-deoxy sugar, and the nucleoside of each connection in the other 4 connected nucleosides includes a nucleoside with 2'-O (CH2) 2-OCH3 sugar. In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, wherein the nucleoside at position 3 of SEQ ID NO:2 includes 2'-deoxy sugar. In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, wherein the nucleoside at position 3 of SEQ ID NO:2 includes 2'-deoxy sugar. In certain embodiments, the 5'-wing segment consists of 5 linked nucleosides, wherein the nucleoside at position 4 of SEQ ID NO: 2 comprises a 2'-deoxy sugar. In certain embodiments, the 5'-wing segment consists of 5 linked nucleosides, wherein the nucleoside at position 4 of SEQ ID NO: 2 comprises a 2'-deoxy sugar, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0303] In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, wherein the nucleosides at positions 2 and 3 of SEQ ID NO:2 include 2'-deoxy sugars. In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, wherein the nucleosides at positions 2 and 3 of SEQ ID NO:2 include 2'-deoxy sugars, and each of the other 3 connected nucleosides includes a nucleoside with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, wherein the nucleosides at positions 2 and 4 of SEQ ID NO:2 include 2'-deoxy sugars. In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, wherein the nucleosides at positions 2 and 4 of SEQ ID NO:2 include 2'-deoxy sugars, and each of the other 3 connected nucleosides includes a nucleoside with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5'-wing segment consists of 5 linked nucleosides, wherein the nucleosides at positions 3 and 4 of SEQ ID NO: 2 include 2'-deoxy sugars. In certain embodiments, the 5'-wing segment consists of 5 linked nucleosides, wherein the nucleosides at positions 3 and 4 of SEQ ID NO: 2 include 2'-deoxy sugars, and each of the other 3 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0304] C3. 5' wing segment with 5 linked nucleosides, 2'-LNA combination

[0305] In certain embodiments, the 5' wing segment consists of 5 connected nucleosides, wherein one of the 5 connected nucleosides connects to a locked nucleic acid. In certain embodiments, the 5' wing segment consists of 5 connected nucleosides, wherein two of the 5 connected nucleosides connect to a locked nucleic acid. In certain embodiments, the 5' wing segment consists of 5 connected nucleosides, wherein one of the 5 connected nucleosides connects to a locked nucleic acid. In certain embodiments, the 5' wing segment consists of 5 connected nucleosides, wherein one of the 5 connected nucleosides connects to a 4'-CH2-O-2' sugar. In certain embodiments, the 5' wing segment consists of 5 connected nucleosides, wherein two of the 5 connected nucleosides connect to a 4'-CH2-O-2' sugar.

[0306] In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, wherein the nucleoside connected in one of the 5 connected nucleosides includes a locked nucleic acid, and the nucleoside of each connection in the other 4 connected nucleosides includes a nucleoside with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, wherein the nucleoside connected in two of the 5 connected nucleosides includes a locked nucleic acid, and the nucleoside of each connection in the other 3 connected nucleosides includes a nucleoside with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, wherein the nucleoside connected in one of the 5 connected nucleosides includes a 4'-CH2-O-2' sugar, and the nucleoside of each connection in the other 4 connected nucleosides includes a nucleoside with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5'-wing segment consists of 5 linked nucleosides, wherein two of the 5 linked nucleosides include a 4'-CH2-O-2' sugar and each of the other 3 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0307] In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 1 and 3 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 1 and 3 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0308] In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, and the nucleosides at positions 1 and 3 of SEQ ID NO:2 include locked nucleic acid, and the nucleosides of each connection in the other 3 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment is composed of 5 connected nucleosides, and the nucleosides at positions 1 and 3 of SEQ ID NO:2 include 4'-CH2-O-2' sugar, and the nucleosides of each connection in the other 3 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar.

[0309] D. General 3' wing segment

[0310] In certain embodiments, at least one of the nucleosides in the 3'-wing segment comprises a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, each of the nucleosides in the 3'-wing segment comprises a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3'-wing segment comprises a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 3'-wing segment comprises a nucleoside with a 2'-deoxy sugar, and the other nucleoside in the 3'-wing segment comprises a 2"-O(CH2)2-OCH3 sugar. In certain embodiments, the 3'-wing segment further comprises two nucleosides, each with a 2'-deoxy sugar.

[0311] In certain embodiments, one, two, three, or four of the nucleosides in the 3' wing segment comprise a sugar modification as described herein. In certain embodiments, one, two, three, or four of the nucleosides in the 3' wing segment comprise a bicyclic sugar. In certain embodiments, one, two, three, or four of the nucleosides in the 3' wing segment comprise a constrained ethyl sugar.

[0312] In certain embodiments, one, two, three, or four of the nucleosides in the 3' wing segment comprise locked nucleic acids. In certain embodiments, one, two, three, or four of the nucleosides in the 3' wing segment comprise 4'-CH2-O-2' sugars. In certain embodiments, two of the nucleosides in the 3' wing segment comprise locked nucleic acids. In certain embodiments, two of the nucleosides in the 3' wing segment comprise 4'-CH2-O-2' sugars. In certain embodiments, three of the nucleosides in the 3' wing segment comprise locked nucleic acids. In certain embodiments, three of the nucleosides in the 3' wing segment comprise 4'-CH2-O-2' sugars.

[0313] In certain embodiments, the nucleosides at positions 16 and 18 of SEQ ID NO: 2 comprise locked nucleic acids. In certain embodiments, the nucleosides at positions 16 and 18 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars. In certain embodiments, the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise locked nucleic acids. In certain embodiments, the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars. In certain embodiments, the nucleosides at positions 16 and 20 of SEQ ID NO: 2 comprise locked nucleic acids. In certain embodiments, the nucleosides at positions 16 and 20 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars. In certain embodiments, the nucleosides at positions 17 and 18 of SEQ ID NO: 2 comprise locked nucleic acids. In certain embodiments, the nucleosides at positions 17 and 18 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars. In certain embodiments, the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise locked nucleic acids. In certain embodiments, the nucleosides at positions 17 and 19 of SEQ ID NO:2 include 4'-CH2-O-2' sugars. In certain embodiments, the nucleosides at positions 17 and 20 of SEQ ID NO:2 include locked nucleic acids. In certain embodiments, the nucleosides at positions 17 and 20 of SEQ ID NO:2 include 4'-CH2-O-2' sugars. In certain embodiments, the nucleosides at positions 18 and 19 of SEQ ID NO:2 include locked nucleic acids. In certain embodiments, the nucleosides at positions 18 and 19 of SEQ ID NO:2 include 4'-CH2-O-2' sugars. In certain embodiments, the nucleosides at positions 18 and 20 of SEQ ID NO:2 include locked nucleic acids. In certain embodiments, the nucleosides at positions 18 and 20 of SEQ ID NO:2 include 4'-CH2-O-2' sugars. In certain embodiments, the nucleosides at positions 19 and 20 of SEQ ID NO:2 include locked nucleic acids. In certain embodiments, the nucleosides at positions 19 and 20 of SEQ ID NO: 2 include a 4'-CH2-O-2' sugar.

[0314] In certain embodiments, the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise locked nucleic acids. In certain embodiments, the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars. In certain embodiments, the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise locked nucleic acids. In certain embodiments, the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars.

[0315] E1. 3' wing segment with 4 linked nucleosides

[0316] In certain embodiments, the 3' wing segment is composed of 4 connected nucleosides. In certain embodiments, the 3' wing segment is composed of 4 connected nucleosides, wherein the nucleosides of each connection in the 4 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is composed of 4 connected nucleosides, wherein the nucleosides of 3 connections in the 4 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is composed of 4 connected nucleosides, wherein the nucleosides of 2 connections in the 4 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is composed of 4 connected nucleosides, wherein the nucleosides of 1 connection in the 4 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar.

[0317] E2. 3' wing segment with 4 linked nucleosides, 2'-deoxy combination

[0318] In certain embodiments, the 3' wing segment is made up of 4 nucleosides connected, and the nucleosides wherein one of the nucleosides connected includes nucleosides with 2'-deoxy sugar. In certain embodiments, the 3' wing segment is made up of 4 nucleosides connected, and the nucleosides wherein two of the nucleosides connected include nucleosides with 2'-deoxy sugar. In certain embodiments, the 3' wing segment is made up of 4 nucleosides connected, and the nucleosides wherein one of the nucleosides connected in the 4 connections includes nucleosides with 2'-deoxy sugar, and the nucleosides of each connection in the nucleosides of other 3 connections include nucleosides with 2'-O (CH2) 2-OCH3 sugared nucleosides. In certain embodiments, the 3' wing segment is made up of 4 nucleosides connected, and the nucleosides wherein one of the nucleosides connected in the 4 connections includes nucleosides with 2'-deoxy sugar, the nucleosides wherein one of the nucleosides connected in the 4 connections includes locked nucleic acid, and the nucleosides of each connection in the nucleosides of other 2 connections include nucleosides with 2'-O (CH2) 2-OCH3 sugared nucleosides. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, two of the 4 linked nucleosides comprise locked nucleic acid, and the other linked nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0319] E3. 3' wing segment with 4 linked nucleosides, 2'-LNA combination

[0320] In certain embodiments, the 3' wing segment consists of 4 connected nucleosides, wherein one of the 4 connected nucleosides is connected and comprises a locked nucleic acid. In certain embodiments, the 3' wing segment consists of 4 connected nucleosides, wherein two of the 4 connected nucleosides are connected and comprise a locked nucleic acid. In certain embodiments, the 3' wing segment consists of 4 connected nucleosides, wherein one of the 4 connected nucleosides is connected and comprises a 4'-CH2-O-2' sugar. In certain embodiments, the 3' wing segment consists of 4 connected nucleosides, wherein two of the 4 connected nucleosides are connected and comprise a 4'-CH2-O-2' sugar.

[0321] In certain embodiments, the 3' wing segment consists of 4 connected nucleosides, wherein one of the 4 connected nucleosides comprises a locked nucleic acid, and the nucleosides of each of the other 3 connected nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 connected nucleosides, wherein two of the 4 connected nucleosides comprise a locked nucleic acid, and the nucleosides of each of the other 2 connected nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 connected nucleosides, wherein three of the 4 connected nucleosides comprise a locked nucleic acid, and the other connected nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is made up of 4 connected nucleosides, wherein the nucleosides of one of the 4 connected nucleosides include 4'-CH2-O-2' sugar, and the nucleosides of each connection in the other 3 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is made up of 4 connected nucleosides, wherein the nucleosides of two of the 4 connected nucleosides include 4'-CH2-O-2' sugar, and the nucleosides of each connection in the other 2 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is made up of 4 connected nucleosides, wherein the nucleosides of three of the 4 connected nucleosides include 4'-CH2-O-2' sugar, and the nucleosides of the other connections include nucleosides with 2'-O(CH2)2-OCH3 sugar.

[0322] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 16 and 18 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 16 and 18 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0323] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 16 and 18 of SEQ ID NO: 2 include locked nucleic acids, and each of the other 2 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 16 and 18 of SEQ ID NO: 2 include 4'-CH2-O-2' sugars, and each of the other 2 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0324] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0325] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 2 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 2 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0326] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 16 and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 16 and 20 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0327] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 16 and 20 of SEQ ID NO: 2 include locked nucleic acids, and each of the other 2 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 16 and 20 of SEQ ID NO: 2 include 4'-CH2-O-2' sugars, and each of the other 2 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0328] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17 and 18 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17 and 18 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0329] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17 and 18 of SEQ ID NO: 2 include locked nucleic acids, and each of the other 2 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17 and 18 of SEQ ID NO: 2 include 4'-CH2-O-2' sugars, and each of the other 2 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0330] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0331] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 2 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 2 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0332] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17 and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17 and 20 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0333] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17 and 20 of SEQ ID NO: 2 include locked nucleic acids, and each of the other 2 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17 and 20 of SEQ ID NO: 2 include 4'-CH2-O-2' sugars, and each of the other 2 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0334] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 18 and 19 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 18 and 19 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0335] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 18 and 19 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 2 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 18 and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 2 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0336] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 18 and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 18 and 20 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0337] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 18 and 20 of SEQ ID NO: 2 include locked nucleic acids, and each of the other 2 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 18 and 20 of SEQ ID NO: 2 include 4'-CH2-O-2' sugars, and each of the other 2 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0338] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 19 and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 19 and 20 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0339] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 19 and 20 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 2 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, and the nucleosides at positions 19 and 20 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 2 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0340] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0341] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise locked nucleic acids, and the other linked nucleosides comprise nucleosides with 2'-O(CH2)2-OCH3 sugars. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and the other linked nucleosides comprise nucleosides with 2'-O(CH2)2-OCH3 sugars.

[0342] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0343] In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise locked nucleic acids, and the other linked nucleosides comprise nucleosides with 2'-O(CH2)2-OCH3 sugars. In certain embodiments, the 3'-wing segment consists of 4 linked nucleosides, and the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and the other linked nucleosides comprise nucleosides with 2'-O(CH2)2-OCH3 sugars.

[0344] F1. 3' wing segment with 5 linked nucleosides

[0345] In certain embodiments, the 3' wing segment is composed of 5 connected nucleosides. In certain embodiments, the 3' wing segment is composed of 5 connected nucleosides, wherein the nucleosides of each connection in the 5 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is composed of 5 connected nucleosides, wherein the nucleosides of 4 connections in the 5 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is composed of 5 connected nucleosides, wherein the nucleosides of 3 connections in the 5 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is composed of 5 connected nucleosides, wherein the nucleosides of 2 connections in the 5 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, wherein 1 linked nucleoside of the 5 linked nucleosides comprises a nucleoside having a 2'-O(CH2)2-OCH3 sugar.

[0346] F2. 3' wing segment with 5 linked nucleosides, 2'-deoxy combination

[0347] In certain embodiments, the 3' wing segment is made up of 5 nucleosides connected, and the nucleosides wherein one of the nucleosides connected includes nucleosides with 2'-deoxy sugar. In certain embodiments, the 3' wing segment is made up of 5 nucleosides connected, and the nucleosides wherein two of the nucleosides connected include nucleosides with 2'-deoxy sugar. In certain embodiments, the 3' wing segment is made up of 5 nucleosides connected, and the nucleosides wherein one of the nucleosides connected in the 5 connections includes nucleosides with 2'-deoxy sugar, and the nucleosides of each connection in the nucleosides of other 4 connections include nucleosides with 2'-O (CH2) 2-OCH3 sugared nucleosides. In certain embodiments, the 3' wing segment is made up of 5 nucleosides connected, and the nucleosides wherein one of the nucleosides connected in the 5 connections includes nucleosides with 2'-deoxy sugar, the nucleosides of one of the nucleosides connected in the 5 connections include locked nucleic acid, and the nucleosides of each connection in the nucleosides of other 3 connections include nucleosides with 2'-O (CH2) 2-OCH3 sugared nucleosides. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, two of the 5 linked nucleosides comprise locked nucleic acid, and the other 2 linked nucleosides comprise nucleosides with a 2'-O(CH2)2-OCH3 sugar.

[0348] F3. 3' wing segment with 5 linked nucleosides, 2'-LNA combination

[0349] In certain embodiments, the 3' wing segment consists of 5 connected nucleosides, wherein one of the 5 connected nucleosides is connected and comprises a locked nucleic acid. In certain embodiments, the 3' wing segment consists of 5 connected nucleosides, wherein two of the 5 connected nucleosides are connected and comprise a locked nucleic acid. In certain embodiments, the 3' wing segment consists of 5 connected nucleosides, wherein one of the 5 connected nucleosides is connected and comprises a 4'-CH2-O-2' sugar. In certain embodiments, the 3' wing segment consists of 5 connected nucleosides, wherein two of the 5 connected nucleosides are connected and comprise a 4'-CH2-O-2' sugar.

[0350] In certain embodiments, the 3' wing segment consists of 5 connected nucleosides, wherein one of the 5 connected nucleosides comprises a locked nucleic acid, and each of the other 4 connected nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 connected nucleosides, wherein two of the 5 connected nucleosides comprise a locked nucleic acid, and each of the other 3 connected nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 connected nucleosides, wherein three of the 5 connected nucleosides comprise a locked nucleic acid, and each of the other 2 connected nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is made up of 5 connected nucleosides, wherein the nucleoside that one of the 5 connected nucleosides connects includes a 4'-CH2-O-2' sugar, and the nucleoside that each of the other 4 connected nucleosides connects includes a nucleoside with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is made up of 5 connected nucleosides, wherein the nucleoside that two of the 5 connected nucleosides connect includes a 4'-CH2-O-2' sugar, and the nucleoside that each of the other 3 connected nucleosides connects includes a nucleoside with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is made up of 5 connected nucleosides, wherein the nucleoside that three of the 5 connected nucleosides connect includes a 4'-CH2-O-2' sugar, and the nucleoside that each of the other 2 connected nucleosides connects includes a nucleoside with 2'-O(CH2)2-OCH3 sugar.

[0351] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 16 and 18 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 16 and 18 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0352] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 16 and 18 of SEQ ID NO: 2 include locked nucleic acids, and each of the other 3 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 16 and 18 of SEQ ID NO: 2 include 4'-CH2-O-2' sugars, and each of the other 3 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0353] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0354] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0355] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 16 and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 16 and 20 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0356] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 16 and 20 of SEQ ID NO: 2 include locked nucleic acids, and each of the other 3 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 16 and 20 of SEQ ID NO: 2 include 4'-CH2-O-2' sugars, and each of the other 3 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0357] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17 and 18 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17 and 18 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0358] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17 and 18 of SEQ ID NO: 2 include locked nucleic acids, and each of the other 3 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17 and 18 of SEQ ID NO: 2 include 4'-CH2-O-2' sugars, and each of the other 3 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0359] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0360] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0361] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17 and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17 and 20 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0362] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17 and 20 of SEQ ID NO: 2 include locked nucleic acids, and each of the other 3 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17 and 20 of SEQ ID NO: 2 include 4'-CH2-O-2' sugars, and each of the other 3 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0363] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 18 and 19 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 18 and 19 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0364] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 18 and 19 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 18 and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0365] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 18 and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 18 and 20 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0366] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 18 and 20 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 18 and 20 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0367] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 19 and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 19 and 20 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0368] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 19 and 20 of SEQ ID NO: 2 comprise locked nucleic acid, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, and the nucleosides at positions 19 and 20 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0369] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0370] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other two linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other two linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0371] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0372] In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise a locked nucleic acid, and each of the other two linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3'-wing segment consists of 5 linked nucleosides, and the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar, and each of the other two linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0373] G1. 3' wing segment with 6 linked nucleosides

[0374] In certain embodiments, the 3' wing segment is made up of 6 connected nucleosides. In certain embodiments, the 3' wing segment is made up of 6 connected nucleosides, wherein the nucleosides of each connection in the 6 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is made up of 6 connected nucleosides, wherein the nucleosides of 5 connections in the 6 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is made up of 6 connected nucleosides, wherein the nucleosides of 4 connections in the 6 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is made up of 6 connected nucleosides, wherein the nucleosides of 3 connections in the 6 connected nucleosides include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein 2 of the 6 linked nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein 1 of the 6 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0375] G2. 3' wing segment with 6 linked nucleosides, 2'-deoxy combination

[0376] In certain embodiments, the 3' wing segment is made up of 6 nucleosides connected, and the nucleosides wherein one of the nucleosides connected includes nucleosides with 2'-deoxy sugar. In certain embodiments, the 3' wing segment is made up of 6 nucleosides connected, and the nucleosides wherein two of the nucleosides connected include nucleosides with 2'-deoxy sugar. In certain embodiments, the 3' wing segment is made up of 6 nucleosides connected, and the nucleosides wherein one of the 6 nucleosides connected includes nucleosides with 2'-deoxy sugar, and the nucleosides of each connection in the nucleosides of other 5 connections include nucleosides with 2'-O (CH2) 2-OCH3 sugared nucleosides. In certain embodiments, the 3' wing segment is made up of 6 nucleosides connected, and the nucleosides wherein one of the 6 nucleosides connected includes nucleosides with 2'-deoxy sugar, the nucleosides of one of the 6 nucleosides connected includes locked nucleic acid, and the nucleosides of each connection in the nucleosides of other 4 connections include nucleosides with 2'-O (CH2) 2-OCH3 sugared nucleosides. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, wherein one of the 5 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, two of the 6 linked nucleosides comprise locked nucleic acid, and the other 3 linked nucleosides comprise nucleosides with 2'-O(CH2)2-OCH3 sugars.

[0377] G3. 3' wing segment with 6 linked nucleosides, 2'-LNA combination

[0378] In certain embodiments, the 3' wing segment consists of 6 connected nucleosides, wherein one of the 6 connected nucleosides comprises a locked nucleic acid. In certain embodiments, the 3' wing segment consists of 6 connected nucleosides, wherein two of the 6 connected nucleosides comprise a locked nucleic acid. In certain embodiments, the 3' wing segment consists of 6 connected nucleosides, wherein one of the 6 connected nucleosides comprises a 4'-CH2-O-2' sugar. In certain embodiments, the 3' wing segment consists of 6 connected nucleosides, wherein two of the 6 connected nucleosides comprise a 4'-CH2-O-2' sugar.

[0379] In certain embodiments, the 3' wing segment consists of 6 connected nucleosides, wherein one of the 6 connected nucleosides comprises a locked nucleic acid, and each of the other 5 connected nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 connected nucleosides, wherein two of the 6 connected nucleosides comprise a locked nucleic acid, and each of the other 4 connected nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 connected nucleosides, wherein three of the 6 connected nucleosides comprise a locked nucleic acid, and each of the other 3 connected nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is made up of 6 nucleosides that are connected, wherein the nucleosides of one of the 6 nucleosides that are connected include 4'-CH2-O-2' sugar, and the nucleosides of each connection in the other 5 nucleosides that are connected include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is made up of 6 nucleosides that are connected, wherein the nucleosides of two of the 6 nucleosides that are connected include 4'-CH2-O-2' sugar, and the nucleosides of each connection in the other 4 nucleosides that are connected include nucleosides with 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment is made up of 6 nucleosides that are connected, wherein the nucleosides of three of the 6 nucleosides that are connected include 4'-CH2-O-2' sugar, and the nucleosides of each connection in the other 3 nucleosides that are connected include nucleosides with 2'-O(CH2)2-OCH3 sugar.

[0380] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 16 and 18 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 16 and 18 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0381] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 16 and 18 of SEQ ID NO: 2 include locked nucleic acids, and each of the other 4 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 16 and 18 of SEQ ID NO: 2 include 4'-CH2-O-2' sugars, and each of the other 4 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0382] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0383] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 16 and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0384] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 16 and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 16 and 20 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0385] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 16 and 20 of SEQ ID NO: 2 include locked nucleic acids, and each of the other 4 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 16 and 20 of SEQ ID NO: 2 include 4'-CH2-O-2' sugars, and each of the other 4 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0386] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17 and 18 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17 and 18 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0387] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17 and 18 of SEQ ID NO: 2 include locked nucleic acids, and each of the other 4 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17 and 18 of SEQ ID NO: 2 include 4'-CH2-O-2' sugars, and each of the other 4 linked nucleosides includes a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0388] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0389] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17 and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0390] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17 and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17 and 20 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0391] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17 and 20 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17 and 20 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0392] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 18 and 19 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 18 and 19 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0393] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 18 and 19 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 18 and 19 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0394] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 18 and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 18 and 20 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0395] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 18 and 20 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 18 and 20 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0396] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 19 and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 19 and 20 of SEQ ID NO: 2 comprise a 4'CH2-O-2' sugar.

[0397] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 19 and 20 of SEQ ID NO: 2 comprise locked nucleic acids, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, and the nucleosides at positions 19 and 20 of SEQ ID NO: 2 comprise 4'-CH2-O-2' sugars, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0398] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0399] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise a locked nucleic acid, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17, 18, and 19 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0400] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise a locked nucleic acid. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar.

[0401] In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise a locked nucleic acid, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3'-wing segment consists of 6 linked nucleosides, and the nucleosides at positions 17, 19, and 20 of SEQ ID NO: 2 comprise a 4'-CH2-O-2' sugar, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.

[0402] H-0. Gap segment

[0403] In some embodiments, the modified oligonucleotide includes at least one gap segment or consists of it. In some embodiments, the modified oligonucleotide includes at least two gap segments or consists of it. In some embodiments, the modified oligonucleotide includes 1, 2, 3, 4, 5, 6, 7, 8 or 9 or 10 gap segments. The gap segments refer to the first gap segment, the second gap segment, the third gap segment, the fourth gap segment, the fifth gap segment, the sixth gap segment, the seventh gap segment, the eighth gap segment, the ninth gap segment or the tenth gap segment respectively and continuously, wherein the first gap segment is closest to the 5' end of the modified oligonucleotide and the last gap segment is closest to the 3' end of the modified oligonucleotide. In some embodiments, the modified oligonucleotide includes 2 gap segments or consists of it. In some embodiments, the modified oligonucleotide includes 3 gap segments or consists of it. In some embodiments, the modified oligonucleotide includes 4 gap segments or consists of it. In some embodiments, the modified oligonucleotide includes 5 gap segments or consists of it. In some embodiments, the modified oligonucleotide comprises or consists of 6 gap segments. In some embodiments, the modified oligonucleotide comprises or consists of 7 gap segments.

[0404] In some embodiments, the gap segment comprises or consists of 1 to 20 connected nucleosides. In some embodiments, the gap segment consists of 1 nucleoside. In some embodiments, the gap segment consists of 2 connected nucleosides. In some embodiments, the gap segment consists of 23 connected nucleosides. In some embodiments, the gap segment consists of 4 connected nucleosides. In some embodiments, the gap segment consists of 5 connected nucleosides. In some embodiments, the gap segment consists of 6 connected nucleosides. In some embodiments, the gap segment consists of 7 connected nucleosides. In some embodiments, the gap segment consists of 8 connected nucleosides. In some embodiments, the gap segment consists of 9 connected nucleosides. In some embodiments, the gap segment consists of 10 connected nucleosides.

[0405] H. First gap section

[0406] In certain embodiments, the first gap segment comprises or consists of 1, 2, 3, 4, 5, 6, 7, or 8 linked nucleosides. In certain embodiments, the first gap segment comprises or consists of 4 or 5 linked nucleosides. In certain embodiments, the first gap segment comprises or consists of 4 linked nucleosides. In certain embodiments, the first gap segment comprises or consists of 5 linked nucleosides.

[0407] In certain embodiments, the first gap segment comprises or consists of 1, 2, 3, 4, 5, 6, 7 or 8 connected nucleosides, each connected nucleoside having a 2'-deoxy sugar. In certain embodiments, the first gap segment comprises or consists of 4 or 5 connected nucleosides, each connected nucleoside having a 2'-deoxy sugar. In certain embodiments, the first gap segment comprises or consists of 4 connected nucleosides, each connected nucleoside having a 2'-deoxy sugar. In certain embodiments, the first gap segment comprises or consists of 5 connected nucleosides, each connected nucleoside having a 2'-deoxy sugar.

[0408] In certain embodiments, the first interstitial segment each having a 2'-deoxy sugar is position 6, 7, 8, and 9 of SEQ ID NO: 2. In certain embodiments, the first interstitial segment each having a 2'-deoxy sugar is position 5, 6, 7, 8, and 9 of SEQ ID NO: 2. In certain embodiments, the first interstitial segment each having a 2'-deoxy sugar is position 6, 7, 8, 9, and 10 of SEQ ID NO: 2.

[0409] I. Second gap section

[0410] In certain embodiments, the second gap segment comprises or consists of 1, 2, 3, 4, 5, 6, 7, or 8 linked nucleosides. In certain embodiments, the second gap segment comprises or consists of 4 or 5 linked nucleosides. In certain embodiments, the first gap segment comprises or consists of 4 linked nucleosides. In certain embodiments, the first gap segment comprises or consists of 5 linked nucleosides.

[0411] In certain embodiments, the second gap segment comprises or consists of 1, 2, 3, 4, 5, 6, 7 or 8 connected nucleosides, each connected nucleoside having a 2'-deoxy sugar. In certain embodiments, the second gap segment comprises or consists of 4 connected nucleosides, each connected nucleoside having a 2'-deoxy sugar. In certain embodiments, the second gap segment comprises or consists of 5 connected nucleosides, each connected nucleoside having a 2'-deoxy sugar. In certain embodiments, the second gap segment comprises or consists of 6 connected nucleosides, each connected nucleoside having a 2'-deoxy sugar.

[0412] In certain embodiments, the second interstitial segment each having a 2'-deoxy sugar is positions 11, 12, 13, and 14 of SEQ ID NO: 2. In certain embodiments, the second interstitial segment each having a 2'-deoxy sugar is positions 11, 12, 13, 14, and 15 of SEQ ID NO: 2. In certain embodiments, the second interstitial segment each having a 2'-deoxy sugar is positions 11, 12, 13, 14, 15, and 16 of SEQ ID NO: 2.

[0413] J. Separate subsections

[0414] In some embodiments, the spacer segment comprises 0, 1, 2, 3, 4, or 5 linked nucleosides. In some embodiments, the spacer segment comprises 1 nucleoside. In some embodiments, the nucleoside comprises a modification. Exemplary modifications of nucleosides include, but are not limited to, 2'methoxyethyl nucleosides, 2'-O-methyl nucleosides, 2'OH nucleosides, 2'fluoro 2'-deoxynucleosides, 2'-F-arabinoic acid (2'-F-ANA), glycol nucleic acid (GNA), or locked nucleic acid (LNA).

[0415] In certain embodiments, the spacer segment consists of one nucleoside comprising a 2'-OCH3 sugar. In certain embodiments, the spacer segment consists of one nucleoside comprising a 2'-O(CH2)2-OCH3 sugar.

[0416] In certain embodiments, the spacer segment is located at position 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 of SEQ ID NO: 2. In certain embodiments, the spacer segment is located at position 9 or 10 or 11 of SEQ ID NO: 2. In certain embodiments, the spacer segment is located at position 10 of SEQ ID NO: 2.

[0417] In certain embodiments, the spacer segment is located at position 10 of SEQ ID NO: 2 and consists of one nucleoside comprising a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the spacer segment consists of one nucleoside comprising a 2'-OCH3 sugar. In certain embodiments, the spacer segment is located at position 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 of SEQ ID NO: 2. In certain embodiments, the spacer segment is located at position 9 or 10 or 11 of SEQ ID NO: 2. In certain embodiments, the spacer segment is located at position 10 of SEQ ID NO: 2.

[0418] In certain embodiments, the spacer segment consists of one nucleoside comprising a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the spacer segment consists of one nucleoside comprising a 2'-OCH3 sugar. In certain embodiments, the spacer segment is located at position 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 of SEQ ID NO:2. In certain embodiments, the spacer segment is located at position 9 or 10 or 11 of SEQ ID NO:2. In certain embodiments, the spacer segment is located at position 10 of SEQ ID NO:2.

[0419] K. Oligonucleotide backbone

[0420] In certain embodiments, the modified oligonucleotide is a single-stranded modified oligonucleotide. In certain embodiments, at least one internucleoside bond is a modified internucleoside bond. In certain embodiments, each internucleoside bond is a phosphorothioate internucleoside bond.

[0421] L. Modified nucleobases

[0422] In certain embodiments, the modified oligonucleotide comprises at least one modified nucleobase. In certain embodiments, wherein the modified oligonucleotide comprises one, two, or three modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, the cytosine at positions 2, 13, and 20 of SEQ ID NO: 2 is each 5-methylcytosine.

[0423] M1. 5-4-1-5-5 modified oligonucleotides

[0424] In certain embodiments, the modified oligonucleotide comprises: a 5' wing segment consisting of 5 linked nucleosides; a first gap segment consisting of 4 linked nucleosides with 2'-deoxy sugars; a spacer segment located at position 10 of SEQ ID NO: 2; a second gap segment consisting of 5 linked nucleosides with 2'-deoxy sugars; and a 3' wing segment consisting of 5 linked nucleosides. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises cytosines at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises an internucleoside bond, wherein each internucleoside bond is a phosphorothioate internucleoside bond. In an exemplary embodiment, the modified oligonucleotide of this paragraph further includes a cytosine at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine, and further includes an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0425] In certain embodiments, the modified oligonucleotide comprises: a 5' wing segment described in Section C1, C2, or C3; a first gap segment consisting of four linked nucleosides with 2'-deoxy sugars; a spacer segment located at position 10 of SEQ ID NO: 2; a second gap segment consisting of five linked nucleosides with 2'-deoxy sugars; and a 3' wing segment described in Section F1, F2, or F3. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises cytosines at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. In an exemplary embodiment, the modified oligonucleotide of this paragraph further includes a cytosine at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine, and further includes an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0426] In certain embodiments, the modified oligonucleotide comprises a sequence that is A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, R, S, T, U, V, W, X, Y, or Z.

[0427] M2. 4-5-1-5-5 modified oligonucleotides

[0428] In certain embodiments, the modified oligonucleotide comprises: a 5' wing segment consisting of 4 linked nucleosides; a first gap segment consisting of 5 linked nucleosides with 2'-deoxy sugars; a spacer segment located at position 10 of SEQ ID NO: 2; a second gap segment consisting of 5 linked nucleosides with 2'-deoxy sugars; and a 3' wing segment consisting of 5 linked nucleosides. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises cytosines at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises an internucleoside bond, wherein each internucleoside bond is a phosphorothioate internucleoside bond. In an exemplary embodiment, the modified oligonucleotide of this paragraph further includes a cytosine at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine, and further includes an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0429] In certain embodiments, the modified oligonucleotide comprises: a 5' wing segment described in Section B1, B2, or B3; a first gap segment consisting of five linked nucleosides with 2'-deoxy sugars; a spacer segment located at position 10 of SEQ ID NO: 2; a second gap segment consisting of five linked nucleosides with 2'-deoxy sugars; and a 3' wing segment described in Section F1, F2, or F3. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises cytosines at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. In an exemplary embodiment, the modified oligonucleotide of this paragraph further includes a cytosine at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine, and further includes an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0430] In certain embodiments, a modified oligonucleotide comprises a sequence that is AA, AB, AC, AD, AE, AF, AG, AH, AI, AJ, AK, AL, AM, AN, or AO.

[0431] An exemplary annotation of the position and segments of AO (AUS1493 or SEQ ID NO: 456) is shown below.

[0432]

[0433] M3. 5-4-1-6-4 modified oligonucleotides

[0434] In certain embodiments, the modified oligonucleotide comprises: a 5' wing segment consisting of 5 linked nucleosides; a first gap segment consisting of 4 linked nucleosides with 2'-deoxy sugars; a spacer segment located at position 10 of SEQ ID NO: 2; a second gap segment consisting of 6 linked nucleosides with 2'-deoxy sugars; and a 3' wing segment consisting of 4 linked nucleosides. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises cytosines at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises an internucleoside bond, wherein each internucleoside bond is a phosphorothioate internucleoside bond. In an exemplary embodiment, the modified oligonucleotide of this paragraph further includes a cytosine at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine, and further includes an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0435] In certain embodiments, the modified oligonucleotide comprises: a 5' wing segment described in Section C1, C2, or C3; a first gap segment consisting of four linked nucleosides with 2'-deoxy sugars; a spacer segment located at position 10 of SEQ ID NO: 2; a second gap segment consisting of six linked nucleosides with 2'-deoxy sugars; and a 3' wing segment described in Section E1, E2, or E3. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises cytosines at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. In an exemplary embodiment, the modified oligonucleotide of this paragraph further includes a cytosine at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine, and further includes an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0436] In certain embodiments, the modified oligonucleotide comprises a sequence that is AP, AQ, AR, or AS.

[0437] M4. 4-5-1-4-6 modified oligonucleotides

[0438] In certain embodiments, the modified oligonucleotide comprises: a 5' wing segment consisting of 4 linked nucleosides; a first gap segment consisting of 5 linked nucleosides with 2'-deoxy sugars; a spacer segment located at position 10 of SEQ ID NO: 2; a second gap segment consisting of 4 linked nucleosides with 2'-deoxy sugars; and a 3' wing segment consisting of 6 linked nucleosides. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises cytosines at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises an internucleoside bond, wherein each internucleoside bond is a phosphorothioate internucleoside bond. In an exemplary embodiment, the modified oligonucleotide of this paragraph further includes a cytosine at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine, and further includes an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0439] In certain embodiments, the modified oligonucleotide comprises: a 5' wing segment described in Section B1, B2, or B3; a first gap segment consisting of five linked nucleosides with 2'-deoxy sugars; a spacer segment located at position 10 of SEQ ID NO: 2; a second gap segment consisting of four linked nucleosides with 2'-deoxy sugars; and a 3' wing segment described in Section G1, G2, or G3. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises cytosines at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. In an exemplary embodiment, the modified oligonucleotide of this paragraph further includes a cytosine at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine, and further includes an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0440] In certain embodiments, a modified oligonucleotide comprises a sequence that is AT or AU.

[0441] M5. 5-4-1-4-6 modified oligonucleotides

[0442] In certain embodiments, the modified oligonucleotide comprises: a 5' wing segment consisting of 5 linked nucleosides; a first gap segment consisting of 4 linked nucleosides with 2'-deoxy sugars; a spacer segment located at position 10 of SEQ ID NO: 2; a second gap segment consisting of 4 linked nucleosides with 2'-deoxy sugars; and a 3' wing segment consisting of 6 linked nucleosides. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises cytosines at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises an internucleoside bond, wherein each internucleoside bond is a phosphorothioate internucleoside bond. In an exemplary embodiment, the modified oligonucleotide of this paragraph further includes a cytosine at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine, and further includes an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0443] In certain embodiments, the modified oligonucleotide comprises: a 5' wing segment described in Section C1, C2, or C3; a first gap segment consisting of four linked nucleosides with 2'-deoxy sugars; a spacer segment located at position 10 of SEQ ID NO: 2; a second gap segment consisting of four linked nucleosides with 2'-deoxy sugars; and a 3' wing segment described in Section G1, G2, or G3. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises cytosines at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. In an exemplary embodiment, the modified oligonucleotide of this paragraph further includes a cytosine at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine, and further includes an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0444] In certain embodiments, the modified oligonucleotide comprises a sequence that is AV or AW.

[0445] M6. 4-5-1-6-4 modified oligonucleotides

[0446] In certain embodiments, the modified oligonucleotide comprises: a 5' wing segment consisting of 4 linked nucleosides; a first gap segment consisting of 5 linked nucleosides with 2'-deoxy sugars; a spacer segment located at position 10 of SEQ ID NO: 2; a second gap segment consisting of 6 linked nucleosides with 2'-deoxy sugars; and a 3' wing segment consisting of 4 linked nucleosides. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises cytosines at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises an internucleoside bond, wherein each internucleoside bond is a phosphorothioate internucleoside bond. In an exemplary embodiment, the modified oligonucleotide of this paragraph further includes a cytosine at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine, and further includes an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0447] In certain embodiments, the modified oligonucleotide comprises: a 5' wing segment described in Section B1, B2, or B3; a first gap segment consisting of five linked nucleosides with 2'-deoxy sugars; a spacer segment located at position 10 of SEQ ID NO: 2; a second gap segment consisting of six linked nucleosides with 2'-deoxy sugars; and a 3' wing segment described in Section E1, E2, or E3. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises cytosines at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine. In one exemplary embodiment, the modified oligonucleotide of this paragraph further comprises internucleoside linkages, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. In an exemplary embodiment, the modified oligonucleotide of this paragraph further includes a cytosine at positions 2, 13, and 20 of SEQ ID NO: 2, each of which is a 5-methylcytosine, and further includes an internucleoside linkage, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0448] In certain embodiments, the modified oligonucleotide comprises a sequence that is AX.

[0449] In certain embodiments, one or more modified nucleosides in the wing segment have a modified sugar. In certain embodiments, the modified sugar is a bicyclic sugar. In certain embodiments, the modified nucleoside is an LNA nucleoside. In certain embodiments, the modified nucleoside is a 2'-substituted nucleoside. In certain embodiments, the 2'-substituted nucleoside comprises a nucleoside modified with a bicyclic sugar. In certain embodiments, the modified nucleoside is a 2'-MOE nucleoside. In certain embodiments, the modified nucleoside is a constrained ethyl (cEt) nucleoside. In certain embodiments, each modified nucleoside in each wing segment is independently a 2'-MOE nucleoside or nucleoside modified with a bicyclic sugar, such as a constrained ethyl (cEt) nucleoside or an LNA nucleoside.

[0450] In certain embodiments, the compound or composition includes a salt of a modified oligonucleotide.

[0451] In certain embodiments, the compound or composition further comprises a pharmaceutically acceptable carrier or diluent.

[0452] In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% complementary to HBV nucleic acid, as measured across the entire modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% complementary to SEQ ID NO: 1, as measured across the entire modified oligonucleotide.

[0453] In certain embodiments, the compound or modified oligonucleotide is single-stranded.

[0454] In certain embodiments, at least one nucleoside of a modified oligonucleotide comprises a modified sugar. In certain embodiments, at least one modified sugar comprises a 2'-O-methoxyethyl (2'-O(CH2)2-OCH3). In certain embodiments, the modified sugar comprises a 2'-O-CH3 group.

[0455] In certain embodiments, at least one modified sugar is a bicyclic sugar. In certain embodiments, at least one modified sugar, i.e., bicyclic sugar includes a 4'-(CH2)-O-2' bridge, wherein n is 1 or 2. In certain embodiments, bicyclic sugar includes a 4'-CH2-O-2' bridge. In certain embodiments, bicyclic sugar includes a 4'-CH(CH3)-O-2' bridge.

[0456] method

[0457] The present disclosure provides a method for treating a subject suffering from HBV infection or suffering from an HBV-related disease, disorder or condition, the method comprising administering a therapeutically effective amount of a modified oligonucleotide as described herein or a pharmaceutical composition comprising the modified oligonucleotide. In certain embodiments, the modified oligonucleotide comprises a sequence of any one of SEQ ID NO: 11-666, or comprises a modified oligonucleotide comprising 1, 2, 3, 4 or 5 modifications to the sequence.

[0458] In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide inhibits HBV mRNA expression in a subject. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide inhibits HBV DNA levels in a subject. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide inhibits HBV protein levels and / or antigen levels in a subject. When administered to a subject, the modified oligonucleotide of the present disclosure can reduce the level of HBV mRNA, DNA, or protein of HBV antigens such as, but not limited to, HBsAg and HbeAg.

[0459] The present disclosure provides a method for treating the HBV related diseases, illness and / or symptoms of illness for a subject, the method comprising administering a therapeutically effective amount of any pharmaceutical composition as described above to a subject in need, so as to treat the HBV related diseases, illness and symptoms. In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a human, and the HBV related diseases, illness and symptoms are hepatitis B virus infections from human hepatitis B virus. More specifically, human hepatitis B virus can be any one of the following human geographic genotypes: A (northwestern Europe, North America, Central America); B (Indonesia, China, Vietnam); C (East Asia, Korea, China, Japan, Polynesia, Vietnam); D (Mediterranean region, Middle East, India); E (Africa); F (Native Americans, Polynesia); G (U.S., France); or H (Central America).

[0460] In certain embodiments, the modified oligonucleotide targets a region of HBV nucleic acid. In certain embodiments, such modified oligonucleotides targeting a region of HBV nucleic acid have a continuous nucleobase portion that is complementary to a nucleobase portion of equal length in the region of HBV nucleic acid. For example, the portion can be at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 continuous nucleobase portions that are complementary to a portion of equal length in the region described herein.

[0461] Certain embodiments provide methods of treating an HBV-related disease, disorder, or condition in a subject, comprising administering to a subject in need thereof a modified oligonucleotide described herein, e.g., a modified oligonucleotide comprising any one of SEQ ID NOs: 11-666, or a modified oligonucleotide comprising 1, 2, 3, 4, or 5 modifications to said modified oligonucleotide, or a pharmaceutical composition.

[0462] Certain embodiments provide a method for reducing HBV expression in a subject, comprising administering to the subject a modified oligonucleotide described herein, e.g., a modified oligonucleotide comprising any one of SEQ ID NOs: 11-666, or a modified oligonucleotide comprising 1, 2, 3, 4, or 5 modifications to the modified oligonucleotide, or a pharmaceutical composition.

[0463] Certain embodiments provide a method for preventing, ameliorating, or treating an HBV-related disease, disorder, or condition in a subject, the method comprising administering to an animal a modified oligonucleotide described herein, such as a modified oligonucleotide comprising any one of SEQ ID NOs: 11-666, or a modified oligonucleotide comprising 1, 2, 3, 4, or 5 modifications to the modified oligonucleotide, or a pharmaceutical composition.

[0464] Examples of HBV-related diseases, disorders, or conditions include, but are not limited to, chronic HBV infection, jaundice, liver cancer, liver inflammation, liver fibrosis, cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, and HBV viremia. HBV-related conditions or disorders may have symptoms including any or all of the following: flu-like illness, weakness, pain, headache, fever, loss of appetite, diarrhea, nausea and vomiting, pain in the liver area of ​​the body, clay-colored or gray stools, general itching, and dark urine, accompanied by a positive test for the presence of hepatitis B virus, hepatitis B virus antigens, or a positive test for the presence of antibodies specific for hepatitis B virus antigens, indicating the presence of an HBV-related condition or disorder.

[0465] Certain embodiments provide a method for reducing HBV mRNA expression in a subject, the method comprising administering to the subject a modified oligonucleotide described herein, such as a modified oligonucleotide comprising any one of SEQ ID NOs: 11-666, or a modified oligonucleotide comprising one, two, three, four, or five modifications to the modified oligonucleotide, or a pharmaceutical composition. In certain embodiments, the reduction in HBV mRNA expression in the subject prevents, improves, or treats an HBV-related disease, disorder, or condition. In certain embodiments, the reduction in HBV mRNA expression in the subject improves or treats HBV infection. In certain embodiments, the reduction in HBV mRNA expression in the subject prevents, improves, or treats liver disease. In certain embodiments, HBV mRNA expression is reduced by at least 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0466] Certain embodiments provide a method for reducing HBV protein levels in a subject, the method comprising administering to the subject a modified oligonucleotide described herein, such as a modified oligonucleotide comprising any one of SEQ ID NOs: 11-666 or a modified oligonucleotide comprising 1, 2, 3, 4, or 5 modifications to the modified oligonucleotide, or a pharmaceutical composition. In certain embodiments, the reduction in HBV protein levels in the subject prevents, improves, or treats HBV-related diseases, disorders, or conditions. In certain embodiments, the reduction in HBV protein levels in the subject improves or treats HBV infection. In certain embodiments, the reduction in HBV protein levels in the subject prevents, improves, or treats liver disease. In certain embodiments, HBV protein levels are reduced by at least 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0467] Certain embodiments provide a method for reducing HBV DNA levels in a subject, the method comprising administering to the subject a modified oligonucleotide as described herein, for example, a modified oligonucleotide comprising any one of SEQ ID NOs: 11-666 or a modified oligonucleotide comprising 1, 2, 3, 4 or 5 modifications to the modified oligonucleotide, or a pharmaceutical composition. In certain embodiments, the reduction in HBV DNA levels in the subject prevents, improves or treats HBV-related diseases, disorders or conditions. In certain embodiments, the subject may be a mammal, such as a human, and the hepatitis B virus may be a human hepatitis B virus. More specifically, the human hepatitis B virus may be any one of the following human geographic genotypes: A (northwestern Europe, North America, Central America); B (Indonesia, China, Vietnam); C (East Asia, South Korea, China, Japan, Polynesia, Vietnam); D (Mediterranean region, Middle East, India); E (Africa); F (Native Americans, Polynesia); G (United States, France); or H (Central America). In certain embodiments, the reduction in HBV DNA levels in a subject improves or treats HBV infection. In certain embodiments, the reduction in HBV DNA levels in a subject prevents, improves, or treats liver disease. In certain embodiments, the reduction in HBV DNA levels in a subject reduces HBV DNA levels by at least 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0468] Certain embodiments provide a method for reducing HBV antigen levels in a subject, the method comprising administering to the subject a modified oligonucleotide described herein, such as a modified oligonucleotide comprising any one of SEQ ID NOs: 11-666, or a modified oligonucleotide comprising one, two, three, four, or five modifications to the modified oligonucleotide, or a pharmaceutical composition. In certain embodiments, the antigen is HBsAg or HBeAG. In certain embodiments, the reduction in HBV antigen levels in a subject prevents, improves, or treats an HBV-related disease, disorder, or condition. In certain embodiments, the reduction in HBV antigen levels in a subject prevents, improves, or treats liver disease. In certain embodiments, the HBV antigen level is reduced by at least 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0469] Certain embodiments provide a method of reducing HBV DNA and HBV antigen in a subject infected with hepatitis B virus, the method comprising administering to the subject a modified oligonucleotide as described herein, for example, a modified oligonucleotide comprising any one of SEQ ID NOs: 11-666 or a modified oligonucleotide comprising 1, 2, 3, 4 or 5 modifications to the modified oligonucleotide, or a pharmaceutical composition. In certain embodiments, the antigen is HBsAg or HBeAg. In certain embodiments, if HBeAg is monitored as a determinant of seroconversion, the amount of HBV antigen can be sufficiently reduced to produce seroconversion, the seroconversion being defined as the absence of serum HBeAg plus the presence of serum HBeAb, or if HBsAg is monitored as a determinant of seroconversion, the seroconversion being defined as the absence of serum HBsAg, as determined by the currently available detection limit of a commercial ELISA system.

[0470] Certain embodiments provide a method for treating a subject suffering from an HBV related disease, illness or condition, comprising: a) identifying the subject suffering from the HBV related disease, illness or condition, and b) administering a therapeutically effective amount of a modified oligonucleotide or pharmaceutical composition as described herein to the subject. In certain embodiments, the therapeutically effective amount of the modified oligonucleotide or pharmaceutical composition administered to the subject treats or reduces the subject's HBV related disease, illness or condition or its symptom. In certain embodiments, the HBV related disease, illness or condition is liver disease. In certain embodiments, the related disease, illness or condition is chronic HBV infection, jaundice, liver cancer, such as hepatocellular carcinoma, liver inflammation, liver fibrosis, cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, liver disease associated with transplantation, or any combination thereof.

[0471] Certain embodiments provide a method for treating a subject suffering from HBV related diseases, illness or condition, comprising: a) identifying the subject suffering from the HBV related diseases, illness or condition, and b) administering a therapeutically effective amount of a modified oligonucleotide or pharmaceutical composition as described herein to the subject. In certain embodiments, the therapeutically effective amount of the modified oligonucleotide or pharmaceutical composition administered to the subject treats or reduces the subject's HBV related diseases, illness or condition or its symptoms. In certain embodiments, HBV related diseases, illness or condition are liver diseases. In certain embodiments, related diseases, illness or condition are chronic HBV infection, jaundice, liver cancer, liver inflammation, liver fibrosis, cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia or liver diseases associated with transplantation.

[0472] In certain embodiments, the HBV has the sequence shown in GenBank Accession No. U95551.1 (SEQ ID NO: 3) or any variant or fragment thereof. In certain embodiments, the HBV has the sequence shown in SEQ ID NO: 667-674.

[0473] In certain embodiments, the subject is a human.

[0474] In certain embodiments, the subject is a monkey, such as a cynomolgus monkey.

[0475] In certain embodiments, the subject is a rodent, such as a mouse or rat.

[0476] In certain embodiments, modified oligonucleotide or pharmaceutical composition is designated as the first medicament. In certain embodiments, the method comprises administering the first medicament and one or more second medicaments. In certain embodiments, the first medicament and one or more second medicaments are co-administered. In certain embodiments, the first medicament and one or more second medicaments are sequentially or concomitantly co-administered. In certain embodiments, the first medicament and one or more second medicaments are not co-administered.

[0477] In certain embodiments, one or more second agents are also compounds or compositions described herein. In certain embodiments, one or more second agents are different from compounds or compositions described herein. The example of one or more second agents includes but is not limited to anti-inflammatory agents, chemotherapeutic agents or anti-infective agents. In a specific embodiment, the disease includes liver cancer, and the one or more second agents include chemotherapeutic agents, such as gemcitabine (Gemcitabine) (Gemzar), oxaliplatin (Eloxatin), cisplatin (Cisplatin), doxorubicin (Doxorubicin), 5-fluorouracil, capecitabine (Capecitabine) (Xeloda) or mitoxantrone (Mitoxantrone) (Novantrone). In a specific embodiment, the disease includes liver disease, and the one or more second agents include corticosteroids, diuretics, beta blockers or combinations thereof.

[0478] The modified oligonucleotides of the present disclosure and pharmaceutical compositions comprising the modified oligonucleotides can be administered to a subject by any suitable route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), intraperitoneal (into a body cavity), and transmucosal administration.

[0479] In certain embodiments, administration comprises parenteral administration. In certain embodiments, administration comprises subcutaneous administration. In certain embodiments, administration comprises intravenous injection or infusion.

[0480] Certain embodiments provide a method for reducing the amount of HBV mRNA, DNA, protein, and / or HBV antigen in a subject infected with hepatitis B virus, the method comprising administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition as described above, so as to reduce hepatitis B virus infection and hepatitis B antigens compared to the amount of HBV mRNA, protein, and HBV antigen in the subject before treatment. In some embodiments, the subject can be a human, and the hepatitis B virus can be a human hepatitis B virus. More specifically, the human hepatitis B virus can be any one of the following human geographic genotypes: A (Northwestern Europe, North America, Central America); B (Indonesia, China, Vietnam); C (East Asia, South Korea, China, Japan, Polynesia, Vietnam); D (Mediterranean region, Middle East, India); E (Africa); F (Native Americans, Polynesia); G (United States, France); or H (Central America).

[0481] The present disclosure provides a method for reducing the amount of HBV mRNA, DNA, protein and / or HBV antigen in a subject infected with hepatitis B virus, or a combination thereof, the method comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide as described above or a pharmaceutical composition comprising the modified oligonucleotide, so as to reduce hepatitis B virus infection and hepatitis B antigens compared to the amount of HBV mRNA, protein and / or HBV antigen in the subject before treatment. In certain embodiments, the amount of mRNA is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% compared to the amount before administration of the modified antisense oligonucleotide or pharmaceutical composition. In certain embodiments, the amount of mRNA is reduced by at least 50% compared to the amount before administration of the modified antisense oligonucleotide or pharmaceutical composition. In certain embodiments, the amount of mRNA is reduced by at least 60% compared to the amount before administration of the modified antisense oligonucleotide or pharmaceutical composition. In certain embodiments, the amount of mRNA is reduced by at least 70% compared to the amount before administration of the modified antisense oligonucleotide or pharmaceutical composition. In certain embodiments, the amount of mRNA is reduced by at least 80% compared to the amount before administration of the modified antisense oligonucleotide or pharmaceutical composition. In certain embodiments, the amount of mRNA is reduced by at least 90% compared to the amount before administration of the modified antisense oligonucleotide or pharmaceutical composition.

[0482] The present disclosure provides a method for reducing the amount of HBV mRNA, DNA, protein and / or HBV antigen in a subject infected with hepatitis B virus, the method comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide or pharmaceutical composition as described above, so as to reduce hepatitis B virus infection and hepatitis B antigen compared to the amount of HBV virus, mRNA, DNA, protein and / or HBV antigen in the subject before treatment, wherein the amount of mRNA is reduced by at least 75% compared to the amount before administration of the modified oligonucleotide or pharmaceutical composition. In certain embodiments, the method reduces the amount of HBV virus, mRNA, DNA, protein and / or HBV antigen in a subject infected with hepatitis B virus, the method comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide or pharmaceutical composition as described above, so as to reduce hepatitis B virus infection and hepatitis B antigen compared to the amount of hepatitis B virus and HBV antigen in the subject before treatment, wherein the amount of mRNA is reduced by at least 80% compared to the amount before administration of the modified oligonucleotide or pharmaceutical composition. In certain embodiments, the method reduces the amount of HBV virus, mRNA, DNA, protein and / or the amount of HBV antigen in a subject infected with hepatitis B virus, comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide or pharmaceutical composition as described above to reduce hepatitis B virus infection and hepatitis B antigen compared to the amount of HBV virus, mRNA, DNA protein and / or the amount of HBV antigen in the subject before treatment, wherein the amount of mRNA is reduced by at least 85% compared to the amount before administration of the modified oligonucleotide or pharmaceutical composition. In certain embodiments, the method is a method for reducing the amount of HBV virus, mRNA, DNA, protein and / or the amount of HBV antigen in a subject infected with hepatitis B virus, the method comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide or pharmaceutical composition as described above to reduce hepatitis B virus infection and hepatitis B antigens compared to the amount of HBV virus, mRNA, DNA, protein and / or the amount of HBV antigen in the subject before treatment, wherein the amount of mRNA is reduced by at least 90% compared to the amount before administration of the modified oligonucleotide or pharmaceutical composition.In certain embodiments, the method reduces the amount of HBV virus, mRNA, DNA, protein, and / or HBV antigen in a subject infected with hepatitis B virus, the method comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide or pharmaceutical composition as described above, such that the hepatitis B virus infection, mRNA, protein, and / or hepatitis B antigen are reduced compared to the amount of HBV mRNA, protein, and / or HBV antigen in the subject before treatment, wherein the amount of mRNA is reduced by at least 95% compared to the amount before administration of the modified oligonucleotide or pharmaceutical composition. In related methods, the HBV antigen can be HBsAg or can be HBeAg, and more specifically, if HBeAg is monitored as a determinant of seroconversion, the amount of HBV antigen can be sufficiently reduced to produce seroconversion, wherein seroconversion is defined as the absence of serum HBeAg plus the presence of serum HBeAb, or if HBsAg is monitored as a determinant of seroconversion, the seroconversion is defined as the absence of serum HBsAg, as determined by the currently available detection limit of a commercial ELISA system.

[0483] The present disclosure provides a method for promoting seroconversion of hepatitis B virus in a mammal infected with HBV, the method comprising administering a therapeutically effective amount of a modified oligonucleotide as described above, e.g., a modified oligonucleotide comprising any one of SEQ ID NOs: 11-666, or a modified oligonucleotide comprising 1, 2, 3, 4, or 5 modifications to the modified oligonucleotide, or a pharmaceutical composition, to a subject infected with hepatitis B; monitoring a serum sample of the subject for the presence of HBeAg plus HBeAb if HBeAg is monitored as a determinant of seroconversion, or monitoring a serum sample of the subject for the presence of HBsAg such that the absence of HBeAg plus the presence of HBeAb in the serum sample, or the absence of HBsAg in the serum sample if HBsAg is monitored as a determinant of seroconversion, as determined by the current detection limit of a commercial ELISA system, is indicative of seroconversion in the subject.

[0484] Certain embodiments provide the use of a modified oligonucleotide or pharmaceutical composition as described herein for preventing, ameliorating or treating a liver disease or a symptom thereof in a subject, wherein the modified oligonucleotide, for example, comprises a modified oligonucleotide of any one of SEQ ID NOs: 11-666 or comprises 1, 2, 3, 4 or 5 modifications to the modified oligonucleotide.

[0485] In some embodiments, the EC of cells treated with modified oligonucleotides (eg, SEQ ID NOs: 11-666) 50In some embodiments, EC 50 In some embodiments, EC 50 Less than 250nM, less than 200nM, less than 150nM, less than 100nM, less than 90nM, less than 80nM, less than 70nM, less than 65nM, less than 60nM, less than 55nM, less than 50nM, less than 49nM, less than 47nM, less than 46nM, less than 45nM, less than 44nM, less than 43nM, less than 42nM, less than 41nM, less than 40nM, less than 39nM, less than 38nM, less than 37nM, less than 36nM, less than 35nM, less than 34nM, less than 33nM, less than 32nM, less than 31nM, less than 30nM, less than 29nM, less than 28nM, less than 27nM, less than 26nM less than 1 nM, less than 25 nM, less than 24 nM, less than 23 nM, less than 22 nM, less than 21 nM, less than 20 nM, less than 19 nM, less than 18 nM, less than 17 nM, less than 16 nM, less than 15 nM, less than 14 nM, less than 13 nM, less than 12 nM, less than 11 nM, less than 10 nM, less than 9 nM, less than 8 nM, less than 7 nM, less than 6 nM, less than 5 nM, less than 4 nM, less than 3 nM, less than 2 nM, less than 1 nM, less than 0.9 nM, less than 0.8 nM, less than 0.7 nM, less than 0.6 nM, less than 0.5 nM, less than 0.4 nM, less than 0.3 nM, less than 0.2 nM or less than 0.1 nM.

[0486] In some embodiments, the EC of cells treated with modified oligonucleotides (e.g., SEQ ID NOs: 11-666) is calculated. 50 In some embodiments, the ratio of the EC50 of cells treated with a reference oligonucleotide (e.g., SEQ ID NO: 10) to the EC50 of cells treated with a reference oligonucleotide (e.g., SEQ ID NO: 10) is used as a measure of efficacy in reducing HBsAg levels. In some embodiments, the ratio is from about 0.05 to about 250. In some embodiments, the EC50 of cells treated with a reference oligonucleotide (e.g., SEQ ID NO: 10) is from about 0.05 to about 250. 50Ratio less than 250, less than 150, less than 100, less than 90, less than 80, less than 70, less than 65, less than 60, less than 55, less than 50, less than 49, less than 47, less than 46, less than 45, less than 44, less than 43, less than 42, less than 41, less than 40, less than 39, less than 38, less than 37, less than 36, less than 35, less than 34, less than 33, less than 32, less than 31, less than 30, less than 29, less than 28, less than 27, less than 26, Less than 25, less than 24, less than 23, less than 22, less than 21, less than 20, less than 19, less than 18, less than 17, less than 16, less than 15, less than 14, less than 13, less than 12, less than 11, less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3, less than 2, less than 1, less than 0.9, less than 0.8, less than 0.7, less than 0.6, less than 0.5, less than 0.4, less than 0.3, less than 0.2, or less than 0.1.

[0487] In certain embodiments, the compounds or compositions described herein are effective when delivered to HepG2.2.1 cells because their in vitro IC 50 At least one of is less than 250nM, less than 200nM, less than 150nM, less than 100nM, less than 90nM, less than 80nM, less than 70nM, less than 65nM, less than 60nM, less than 55nM, less than 50nM, less than 49nM, less than 47nM, less than 46nM.

[0488] In certain embodiments, the compounds or compositions described herein are effective when delivered to HepG2.2.1 cells because their in vitro IC 50 At least one of is less than 250nM, less than 200nM, less than 100nM, less than 90nM, less than 80nM, less than 70nM, less than 60nM, less than 50nM, less than 40nM, less than 35nM, less than 34nM, less than 33nM, less than 32nM, less than 31nM.

[0489] In certain embodiments, the compounds or compositions described herein are effective when delivered to HepG2.2.1 cells as described herein because their in vitro IC 50 At least one of is less than 20 μM, less than 10 μM, less than 9.5 μM, less than 9.0 μM, less than 8.5 μM, less than 8.0 μM, less than 7.5 μM, less than 7.0 μM, less than 6.5 μM, less than 6.0 μM, less than 5.5 μM, less than 5.0 μM, less than 4.5 μM, less than 4.0 μM, less than 3.5 μM, less than 3.0 μM, less than 2.5 μM.

[0490] In some embodiments, the MTT CC25 value (nM) is used as a measure of cytotoxicity. In some embodiments, the MTT CC25 of cells treated with a modified oligonucleotide described herein is from about 10 nM to about 250 nM. In some embodiments, the MTT CC25 is greater than 10 nM, greater than 15 nM, greater than 20 nM, greater than 25 nM, greater than 30 nM, greater than 35 nM, greater than 40 nM, greater than 45 nM, greater than 50 nM, greater than 55 nM, greater than 60 nM, greater than 65 nM, greater than 70 nM, greater than 75 nM, greater than 80 nM, greater than 85 nM, greater than 90 nM, greater than 95 nM, greater than 100 nM, greater than 110 nM, greater than 120 nM, greater than 130 nM, greater than 140 nM, greater than 150 nM, greater than 160 nM, greater than 170 nM, greater than 180 nM, greater than 190 nM, greater than 200 nM, greater than 210 nM, greater than 220 nM, greater than 230 nM, greater than 240 nM, or greater than 250 nM.

[0491] In some embodiments, CCK8 CC30 (nM) is used as a measure of cytotoxicity. In some embodiments, cells treated with a modified oligonucleotide described herein have a CCK8 CC30 of about 10 nM to about 250 nM. In some embodiments, CCK8 CC30 is greater than 10 nM, greater than 15 nM, greater than 20 nM, greater than 25 nM, greater than 30 nM, greater than 35 nM, greater than 40 nM, greater than 45 nM, greater than 50 nM, greater than 55 nM, greater than 60 nM, greater than 65 nM, greater than 70 nM, greater than 75 nM, greater than 80 nM, greater than 85 nM, greater than 90 nM, greater than 95 nM, greater than 100 nM, greater than 110 nM, greater than 120 nM, greater than 130 nM, greater than 140 nM, greater than 150 nM, greater than 160 nM, greater than 170 nM, greater than 180 nM, greater than 190 nM, greater than 200 nM, greater than 210 nM, greater than 220 nM, greater than 230 nM, greater than 240 nM, or greater than 250 nM.

[0492] In some embodiments, the "C / E ratio" is used as a measure of efficacy in reducing HBsAg levels relative to cytotoxicity. In some embodiments, the C / E ratio is measured by taking the ratio of the MTT CC25 (nM) of the modified oligonucleotide / the MTT CC25 (nM) of the reference oligonucleotide (e.g., SEQ ID NO: 10) and dividing it by the HBsAg EC25 of the modified oligonucleotide (e.g., SEQ ID NO: 11-666). 50The C / E ratio is calculated by taking the ratio of the CCK8 CC25 (nM) of the modified oligonucleotide / the CCK8 CC25 (nM) of the reference oligonucleotide (e.g., SEQ ID NO: 10) and dividing it by the HBsAg EC50 of the modified oligonucleotide (e.g., SEQ ID NO: 11-666). 50 In some embodiments, the C / E ratio is calculated by comparing the C / E ratio of the HBsAg EC50 of the oligonucleotide to the reference oligonucleotide (e.g., SEQ ID NO: 10). In some embodiments, the C / E ratio is between about 0.01 and about 50. In some embodiments, the C / E ratio is greater than 1, greater than 1.1, greater than 1.2, greater than 1.3, greater than 1.4, greater than 1.5, greater than 1.6, greater than 1.7, greater than 1.8, greater than 1.9, greater than 2.0, greater than 2.1, greater than 2.2, greater than 2.3, greater than 2.4, greater than 2.5, greater than 2.6, greater than 2.7, greater than 2.8, greater than 2.9, greater than 3.0, greater than 10, greater than 11, greater than 12, greater than 13, greater than 14, greater than 15, greater than 16, greater than 17, greater than 18, greater than 19, greater than 20, greater than 21, greater than 22, greater than 23, greater than 24, greater than 25, greater than 30, greater than 35, greater than 40, greater than 45, or greater than 50.

[0493] In certain embodiments, the compounds or compositions described herein are well tolerated as evidenced by at least one of an increase in ALT or AST values ​​of no more than 4-fold, 3-fold, or 2-fold, or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2%, compared to saline-treated animals. In certain embodiments, the compounds or compositions described herein are well tolerated as evidenced by no increase in ALT or AST compared to saline-treated animals. In certain embodiments, the compounds or compositions described herein are well tolerated as evidenced by no increase in liver, spleen, or kidney weight compared to saline-treated animals.

[0494] In some embodiments, the ALT levels of animals treated with a compound or composition comprising a modified oligonucleotide (e.g., SEQ ID NOs: 11-666) are reduced to about 10 to about 1.1 times the ALT levels of animals treated with a reference compound (e.g., SEQ ID NO: 10). In some embodiments, the ALT levels of animals treated with a compound or composition comprising a modified oligonucleotide (e.g., SEQ ID NOs: 11-666) are reduced to at least 1.25 times the ALT levels of animals treated with a reference compound (e.g., SEQ ID NO: 10). In some embodiments, the ALT levels of animals treated with a compound or composition comprising a modified oligonucleotide (e.g., SEQ ID NOs: 11-666) are reduced to about 1.1 times the ALT levels of animals treated with a reference compound (e.g., SEQ ID NO: 10). The ALT levels of animals treated with NO: 10) were 1 / 1.1, 1 / 1.2, 1 / 1.3, 1 / 1.4, 1 / 1.5, 1 / 1.6, 1 / 1.7, 1 / 1.8, 1 / 1.9, 1 / 2.0, 1 / 2.1, 1 / 2.2, 1 / 2.3, 1 / 2.4, 1 / 2.5, 1 / 2.6, 1 / 2.7, 1 / 2.8, 1 / 2.9, 1 / 3.0, 1 / 3.1, 1 / 3.2, 1 / 3.3, 1 / 3.4, 1 / 3.5, 1 / 3.6, 1 / 3.7, 1 / 3.8, 1 / 3.9, 1 / 4.0, 1 / 4.1, 1 / 4.2, 1 / 4.3, 1 / 4.4, 1 / 4.5, 1 / 4.6, 1 / 4.7, 1 / 4.8, 1 / 4.9 or 1 / 5.0.

[0495] In some embodiments, the AST levels of animals treated with a compound or composition comprising a modified oligonucleotide (e.g., SEQ ID NO: 11-666) are reduced to about 1 / 10 to about 1 / 1.1 of the AST levels of animals treated with a reference compound (e.g., SEQ ID NO: 10). In some embodiments, the AST levels of animals treated with a compound or composition comprising a modified oligonucleotide (e.g., SEQ ID NO: 11-666) are reduced to at least 1 / 1.25 of the AST levels of animals treated with a reference compound (e.g., SEQ ID NO: 10). In some embodiments, the AST levels of animals treated with a compound or composition comprising a modified oligonucleotide (e.g., SEQ ID NO: 11-666) are reduced to at least 1 / 1.25 of the AST levels of animals treated with a reference compound (e.g., SEQ ID NO: 10). The AST levels of animals treated with NO: 10) were 1 / 1.1, 1 / 1.2, 1 / 1.3, 1 / 1.4, 1 / 1.5, 1 / 1.6, 1 / 1.7, 1 / 1.8, 1 / 1.9, 1 / 2.0, 1 / 2.1, 1 / 2.2, 1 / 2.3, 1 / 2.4, 1 / 2.5, 1 / 2.6, 1 / 2.7, 1 / 2.8, 1 / 2.9, 1 / 3.0, 1 / 3.1, 1 / 3.2, 1 / 3.3, 1 / 3.4, 1 / 3.5, 1 / 3.6, 1 / 3.7, 1 / 3.8, 1 / 3.9, 1 / 4.0, 1 / 4.1, 1 / 4.2, 1 / 4.3, 1 / 4.4, 1 / 4.5, 1 / 4.6, 1 / 4.7, 1 / 4.8, 1 / 4.9 or 1 / 5.0.

[0496] Certain embodiments provide the use of a modified oligonucleotide or pharmaceutical composition as described herein for the preparation of a medicament for treating, ameliorating, delaying or preventing an HBV-related disease, disorder or condition in an animal, wherein the modified oligonucleotide, for example, includes a modified oligonucleotide of any one of SEQ ID NOs: 11-666.

[0497] Certain embodiments provide the use of a modified oligonucleotide or pharmaceutical composition as described herein for preparing a medicament for treating, ameliorating, delaying or preventing liver disease in an animal, wherein the modified oligonucleotide, for example, comprises a modified oligonucleotide of any one of SEQ ID NOs: 11-666.

[0498] Kits and Products

[0499] The present disclosure provides a kit comprising a modified oligonucleotide as described herein and a pharmaceutical composition comprising the modified oligonucleotide. In some embodiments, the modified oligonucleotide comprises a sequence of any one of SEQ ID NOs: 11-666, or a modified oligonucleotide comprising 1, 2, 3, 4, or 5 modifications to the sequence.

[0500] Certain embodiments provide a kit for treating, preventing, or ameliorating HBV-related diseases, disorders, or conditions, or symptoms thereof, as described herein, wherein the kit comprises: a) a compound or composition as described herein, for example, a modified oligonucleotide comprising a sequence of any one of SEQ ID NOs: 11-666 or a composition comprising 1, 2, 3, 4, or 5 modified oligonucleotides of the modified oligonucleotide; and optionally b) another agent or therapy as described herein. The kit may further comprise instructions or labels for using the kit to treat, prevent, or improve HBV-related diseases, disorders, or conditions.

[0501] Compositions comprising modified oligonucleotides can be lyophilized before packaging in a kit, or can be provided in a solution containing a pharmaceutically acceptable carrier, excipient or diluent.

[0502] In certain embodiments, the kit further comprises at least one additional agent to treat an HBV-related disease, disorder, or condition.

[0503] Dosing and administration

[0504] The present disclosure provides methods comprising administering to a subject in need thereof a therapeutically effective dose of a modified oligonucleotide, e.g., a modified oligonucleotide comprising any one of SEQ ID NOs: 11-666, or a modified oligonucleotide comprising 1, 2, 3, 4, or 5 modifications to the modified oligonucleotide, or a pharmaceutical composition comprising the modified oligonucleotide.

[0505] In certain embodiments, for example, a therapeutically effective dose of a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide includes a dose at which a maximum log10 serum HBsAg reduction of at least -0.2, at least -0.3, at least -0.4, at least -0.5, at least -0.7, at least -1.0, at least -1.5, at least -2.0, at least -2.5, at least -3.0, at least -3.5, at least at least -4.0, or at least -4.5 is observed. In some embodiments, the maximum log10 reduction in serum HBsAg is observed 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, or 35 days after administration of the therapeutically effective dose.

[0506] In certain embodiments, for example, a therapeutically effective dose of a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide comprises a dose that reduces the HBsAg level in the serum of a subject by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. In some embodiments, a decrease in serum HBsAg is observed 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, or 35 days after administration of the therapeutically effective dose.

[0507] In certain embodiments, for example, therapeutically effective doses of modified oligonucleotides or pharmaceutical compositions comprising the same include doses at which a maximum log10 serum HBeAg reduction of at least -0.2, at least -0.3, at least -0.4, at least -0.5, at least -0.7, at least -1.0, at least -1.5, at least -2.0, at least -2.5, at least -3.0, at least -3.5, at least at least -4.0, or at least -4.5 is observed. In some embodiments, the maximum logio decrease in serum HBeAg is observed 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, or 35 days after administration of the therapeutically effective dose.

[0508] In certain embodiments, a therapeutically effective dose of, for example, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide comprises a dose that reduces HBeAg levels in the serum of a subject by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. In some embodiments, a reduction in serum HBeAg is observed 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, or 35 days after administration of the therapeutically effective dose.

[0509] In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dose of the modified oligonucleotide in the range of 10 mg to 1500 mg, 10 mg to 1000 mg, 10 mg to 900 mg, 10 mg to 800 mg, 10 mg to 700 mg, 10 mg to 600 mg, 10 mg to 500 mg, 10 mg to 400 mg, 10 mg to 300 mg. mg, 10mg to 200mg, 10mg to 100mg, 50mg to 1500mg, 50mg to 1000mg, 50mg to 900mg, 50mg to 800mg, 50mg to 700mg, 50mg to 600mg, 50mg to 500mg, 50mg to 400mg, 50mg to 300mg, 50mg to 200mg, 50mg to 100mg, 100mg to 1500mg g, 100mg to 1000mg, 100mg to 900mg, 100mg to 800mg, 100mg to 700mg, 100mg to 600mg, 100mg to 500mg, 100mg to 400mg, 100mg to 300mg, 100mg to 200mg, 200mg to 1500mg, 200mg to 1000mg, 200mg to 900mg, 200mg to 800mg In certain embodiments, the dosage of the modified oligonucleotide in the range of 50mg to 1500mg or the pharmaceutical composition comprising the modified oligonucleotide is administered to a subject. In certain embodiments, the dosage of the modified oligonucleotide in the range of 50mg to 1000mg or the pharmaceutical composition comprising the modified oligonucleotide is administered to a subject. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dosage of the modified oligonucleotide in the range of 50 mg to 700 mg. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dosage of the modified oligonucleotide in the range of 50 mg to 500 mg. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dosage of the modified oligonucleotide in the range of 50 mg to 450 mg.In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dosage of 50mg to 300mg of a modified oligonucleotide. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dosage of 50mg to 200mg of a modified oligonucleotide. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dosage of 100mg to 1500mg of a modified oligonucleotide. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dosage of 100mg to 1000mg of a modified oligonucleotide. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dosage of 100mg to 700mg of a modified oligonucleotide. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dosage of the modified oligonucleotide within the range of 100mg to 500mg. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dosage of the modified oligonucleotide within the range of 100mg to 450mg. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dosage of the modified oligonucleotide within the range of 100mg to 300mg. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject at a dosage of the modified oligonucleotide within the range of 100mg to 200mg.

[0510] In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at a dose of the modified oligonucleotide in the following ranges: 0.01 mg / kg to 30.0 mg / kg, 0.01 mg / kg to 27.0 mg / kg, 0.01 mg / kg to 25.0 mg / kg, 0.01 mg / kg to 22.0 mg / kg, 0.01 mg / kg to 20.0 mg / kg, 0.010.01 mg / kg to 15.0 mg / kg, 0.01 mg / kg to 10.0 mg / kg, 0.01 mg / kg to 8.0 mg / kg, 0.01 mg / kg to 5.0 mg / kg, 0.01 mg / kg to 4.0 mg / kg, 0.01 mg / kg to 3.0 mg / kg, 0.01 mg / kg to 2.0 mg / kg, 0.01 mg / kg to 1.0 mg / kg, 0.01 mg / kg to 0.5 mg / kg, 0.01 mg / kg to 0.1 mg / kg, 0.1 mg / kg to 30.0 mg / kg, 0.1 mg / kg to 27.0 mg / kg, 0.1 mg / kg to 25.0 mg / kg, 0.1 mg / kg to 22.0 mg / kg, 0.1 mg / kg to 20.0 mg / kg, 0.1 mg / kg to 18.0 mg / kg, 0.1 mg / kg to 15.0 mg / kg, 0.1 mg / kg to 12.0 mg / kg, 0.1 mg / kg to 10.0 mg / kg, 0.1 mg / kg to 8.0 mg / kg, 0.1 mg / kg to 5.0 mg / kg, 0.1 mg / kg to 4.0 mg / kg, 0.1 mg / kg to 3.0 mg / kg, 0.1 mg / kg to 2.0 mg / kg, 0.1 mg / kg to 1.0 mg / kg, 0.1 mg / kg to 0.5 mg / kg, 1.0 mg / kg to 30.0 mg / kg, 1.0 mg / kg to 27.0 mg / kg, 1.0 mg / kg to 25.0 mg / kg, 1.0 mg / kg to 22.0 mg / kg, 1.0 mg / kg to 20.0 mg / kg, 1.0 mg / kg to g / kg to 18.0 mg / kg, 1.0 mg / kg to 15.0 mg / kg, 1.0 mg / kg to 12.0 mg / kg, 1.0 mg / kg to 10.0 mg / kg, 1.0 mg / kg to 8.0 mg / kg, 1.0 mg / kg to 5.0 mg / kg, 1.0 mg / kg to 4.0 mg / kg, 1.0 mg / kg to 3.0 mg / kg, 1.0 mg / kg to 2.0 mg / kg, 5.0 mg / kg to 30.0 mg / kg, 5.0 mg / kg to 27.0 mg / kg, 5.0 mg / kg to 25.0 mg / kg, 5.0 mg / kg to 22.0 mg / kg, 5.0 mg / kg to 20.0mg / kg, 5.0mg / kg to 18.0mg / kg, 5.0mg / kg to 15.0mg / kg, 5.0mg / kg to 10.0mg / kg, 5.0mg / kg to 7.0mg / kg, 10.0mg / kg to 30.0mg / kg, 10.0mg / kg to 27.0mg / kg, 10.0mg / kg to 25.0mg / kg, 10.0mg / kg to 22.0m In certain embodiments, the modified oligonucleotide or the pharmaceutical composition comprising the modified oligonucleotide is administered at a dosage of the modified oligonucleotide in the range of 0.01mg / kg to 30mg / kg. In certain embodiments, the modified oligonucleotide or the pharmaceutical composition comprising the modified oligonucleotide is administered at a dosage of the modified oligonucleotide in the range of 0.1mg / kg to 25mg / kg. In certain embodiments, the modified oligonucleotide or the pharmaceutical composition comprising the modified oligonucleotide is administered at a dose of the modified oligonucleotide in the range of 1.0 mg / kg to 20 mg / kg. In certain embodiments, the modified oligonucleotide or the pharmaceutical composition comprising the modified oligonucleotide is administered at a dose of the modified oligonucleotide in the range of 5.0 mg / kg to 20 mg / kg. In certain embodiments, the modified oligonucleotide or the pharmaceutical composition comprising the modified oligonucleotide is administered at a dose of the modified oligonucleotide in the range of 1.0 mg / kg to 15 mg / kg. In certain embodiments, the modified oligonucleotide or the pharmaceutical composition comprising the modified oligonucleotide is administered at a dose of the modified oligonucleotide in the range of 1.0 mg / kg to 5.0 mg / kg.

[0511] In certain embodiments, a modified oligonucleotide, or a pharmaceutical composition comprising the same, is administered to a subject daily, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every 8 days, every 9 days, every 10 days, every 11 days, every 12 days, every 13 days, every 2 weeks, every 3 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, every 10 weeks, every 11 weeks, every 12 weeks, every 13 weeks, every 2 months, every 3 months, or every 4 months.

[0512] In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject daily, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every 8 days, every 9 days, every 10 days, every two weeks, every three weeks, or monthly.

[0513] In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject for at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 1 year, at least 1.5 years, at least 2 years, at least 3 years, at least 4 years, or at least 5 years.

[0514] In certain embodiments, the modified oligonucleotide, or a pharmaceutical composition comprising the modified oligonucleotide, is administered to a subject until a specific result is achieved, such as a decrease in the level of HBsAg and / or HbeAg in the subject's serum. In certain embodiments, the modified oligonucleotide, or a pharmaceutical composition comprising the modified oligonucleotide, is continued to be administered to a subject until the HBsAg and / or HbeAg in the subject's serum is reduced by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% compared to before the administration of the modified oligonucleotide, or a pharmaceutical composition comprising the modified oligonucleotide.

[0515] In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject once a day, twice a day, three times a day, or four times a day.

[0516] In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every day. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every two days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every three days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every four days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every five days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every six days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every seven days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every eight days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every nine days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every ten days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every eleven days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every twelve days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every thirteen days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every two weeks. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every three weeks. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every month. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every two months. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every three months. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every 4 months. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every 5 months. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject every 6 months.In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject twice or more per year. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject twice or more every two years. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to the subject twice or more every two years.

[0517] In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject once every 1-30 days. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject once every 1-22 days. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject once every 1-15 days. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject once every 1-8 days. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject once every 1-5 days. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject once every 1-4 days. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject once every 1-3 days. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject once every 10-20 days. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject every 5-15 days. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject every 15-30 days.

[0518] In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 36 hours. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 48 hours. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 60 hours. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 72 hours. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 84 hours. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 96 hours. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 5 days. In certain embodiments, a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 6 days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 7 days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 8-10 days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 10-12 days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 12-15 days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 15-25 days. In certain embodiments, the modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered at least once every 20-30 days.

[0519] In certain embodiments, the pharmaceutical composition comprising the modified oligonucleotide or the modified oligonucleotide is administered to the subject for a dosing holiday. For example, the modified oligonucleotide or the modified oligonucleotide is administered to the subject every three days, followed by not administering for one week, two weeks, three weeks, or one month, and then resuming administration. It will be understood by those skilled in the art that this dosing holiday is exemplary. Other dosing holidays of duration and frequency are contemplated to be within the scope of the present disclosure. As another example, the modified oligonucleotide or the modified oligonucleotide may be administered to the subject until the HBsAg or HbeAg levels detected in the subject drop below a certain threshold or do not infect with HBV, followed by a dosing holiday, and if the HBsAg or HbeAg in the subject's serum are detected again, administration is resumed.

[0520] In certain embodiments, a single, disposable dose of a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide is administered to a subject. In other embodiments, multiple doses of a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide are administered to a subject.

[0521] In certain embodiments, administering the modified oligonucleotide or the pharmaceutical composition including the modified oligonucleotide may include a dosing schedule in which the modified oligonucleotide or the pharmaceutical composition including the modified oligonucleotide is initially administered more frequently, followed by less frequent administration. The advantage of this type of dosing schedule is that it can be used to maintain the steady-state liver concentration of the modified oligonucleotide described herein. For example, if the liver half-life of the modified oligonucleotide is 3-4 weeks, the steady-state liver concentration of the modified oligonucleotide of the present disclosure may be achieved using an initial dosing schedule comprising a loading dose on the 1st and 4th day, followed by a weekly (e.g., day 8, day 15, day 22, etc.) maintenance dose starting on the 8th day.

[0522] In certain embodiments, administration of a modified oligonucleotide or a pharmaceutical composition comprising the modified oligonucleotide comprises a loading dose followed by a loading maintenance dose.

[0523] The term "loading dose" refers to a modified oligonucleotide or pharmaceutical composition that is administered in addition to a dosage regimen or that is higher than one or more dosages of the remaining dosage in the dosage regimen. As used herein, a "loading dose" may refer to a modified oligonucleotide or pharmaceutical composition administered as a part of a dosage regimen (if administered in place of a conventional dosage regimen) or a dosage of the same concentration or lower concentration (if administered in addition to a conventional dosage regimen) or higher concentrations. In a dosage regimen, a loading dose may also be administered more frequently than a maintenance dose.

[0524] As used herein, the term "maintenance dose" refers to repeated, regular administration of a therapeutic agent. As used herein, a maintenance dose does not include a loading dose, which in some embodiments may be administered additionally, for example, prior to a maintenance dose.

[0525] In the exemplary dosage regimen comprising a loading dose and a maintenance dose, modified oligonucleotide or pharmaceutical composition are used with a higher loading dose and subsequently with a lower maintenance dose. For example, a loading dose can be approximately 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2.0 times, 2.1 times, 2.2 times, 2.3 times, 2.4 times, 2.5 times, 3.0 times, 3.5 times, 4.0 times, 4.5 times or 5 times of a maintenance dose. Alternatively or in addition, a loading dose can be used more frequently than a maintenance dose. For example, a loading dose can be used every day, every 2 days, every 3 days, every 4 days or every 5 days, at least 1, 2, 3, 4 or 5 dosages, and then weekly, every 10 days, every 14 days etc. use a maintenance dose. Technicians will appreciate that, if desired, the subject administered according to the maintenance dosing schedule can be administered again with one or more loading doses. As another exemplary dosing schedule, the subject can be administered a loading dose on Days 1 and 4, followed by a weekly maintenance dose on Day 8.

[0526] Antisense compounds

[0527] Oligomeric compounds include but are not limited to oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides and siRNA. The oligomeric compound can be "antisense" to the target nucleic acid, which means capable of hybridizing to the target nucleic acid through hydrogen bonding.

[0528] In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of the target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of the target nucleic acid to which it is targeted.

[0529] In certain embodiments, the antisense oligonucleotide targeting HBV nucleic acid can be shortened or truncated. For example, a single subunit can be missing from the 5' end (5' truncation) or alternatively from the 3' end (3' truncation). The shortened or truncated antisense compound targeting HBV nucleic acid can have two subunits missing from the 5' end of the antisense compound, or alternatively can have two subunits missing from the 3' end. Alternatively, the missing nucleoside can be dispersed throughout the antisense compound, for example, dispersed in an antisense compound having a nucleoside missing from the 5' end and a nucleoside missing from the 3' end.

[0530] When a single additional subunit is present in an extended antisense compound, the additional subunit can be located at the 5' or 3' end of the antisense compound. When there are two or more additional subunits, the added subunits can be adjacent to each other, such as in an antisense compound with two subunits, the two subunits are added to the 5' end of the antisense compound (5' addition), or alternatively are added to the 3' end (3' addition). Alternatively, the added subunits can be dispersed throughout the antisense compound, such as in an antisense compound with one subunit added to the 5' end and one subunit added to the 3' end.

[0531] It is possible to increase or decrease the length of antisense compounds such as antisense oligonucleotides, and / or introduce mismatched bases without eliminating activity. For example, the ability of the antisense oligonucleotides of a series of lengths of 13-25 core bases to induce target RNA cutting in oocyte injection model was tested in the people such as Woolf (Proc. Natl. Acad. Sci. USA, 89: 7305-7309, 1992). The antisense oligonucleotides with a length of 25 core bases having 8 or 11 mismatched bases near the end of the antisense oligonucleotide can guide the specific cutting of target mRNA, although its degree is less than the antisense oligonucleotides without mismatching. Similarly, target specific cutting is realized using 13 core base antisense oligonucleotides (comprising oligonucleotides with 1 or 3 mismatches).

[0532] Gautschi et al. (Natl. Cancer Inst., 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA was able to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, the oligonucleotide exhibited potent antitumor activity in vivo.

[0533] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem 14 nucleobase antisense oligonucleotides and 28 and 42 nucleobase antisense oligonucleotides containing sequences of two or three of the tandem antisense oligonucleotides, respectively, to inhibit translation of human DHFR in a rabbit reticulocyte assay. Only each of the three 14 nucleobase antisense oligonucleotides was able to inhibit translation, although at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

[0534] Antisense compound motif

[0535] In certain embodiments, antisense compounds targeting HBV nucleic acids have chemically modified subunits arranged in a pattern or motif to impart properties to the antisense compound such as enhanced inhibitory activity, increased binding affinity for the target nucleic acid, or resistance to degradation by nucleases in vivo.

[0536] Chimeric antisense compounds typically contain at least one modified region to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity to the target nucleic acid, and / or increased inhibitory activity. The second region of the chimeric antisense compound can optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of the RNA:DNA duplex.

[0537] Antisense compounds with gapmer motif are considered to be chimeric antisense compounds.In gapmer, the inner region with multiple nucleotides supporting RNA enzyme H cutting is positioned between the outer region with multiple nucleotides, and the multiple nucleotides are chemically different from the nucleosides in the inner region.In the case of the antisense oligonucleotides with gapmer motif, the gap segment usually serves as the substrate for endonuclease cutting, and the wing segment includes modified nucleosides.In certain embodiments, the district of gapmer is distinguished by the type of sugar moiety including each different district.In certain embodiments, the type of sugar moiety in the district for distinguishing gapmer can include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides can include 2'-MOE and 2'-O-CH3 etc.) and dicyclo sugar-modified nucleosides (such dicyclo sugar-modified nucleosides can include dicyclo sugar-modified nucleosides with constraint ethyl).In certain embodiments, the nucleosides in wing can include some modified sugar moieties, including for example 2'-MOE and dicyclo sugar moiety, such as constraint ethyl or LNA. In certain embodiments, the wings may comprise several modified and unmodified sugar moieties.In certain embodiments, the wings may comprise various combinations of 2'-MOE nucleosides, bicyclic sugar moieties such as constrained ethyl nucleosides or LNA nucleosides, and 2'-deoxynucleosides.

[0538] Each different region can include a uniform sugar moiety, a variant, or an alternating sugar moiety. The wing-gap-wing motif is often described as "XYZ," where "X" represents the length of the 5' wing, "Y" represents the length of the gap, and "Z" represents the length of the 3' wing. "X" and "Z" can include uniform, variant, or alternating sugar moieties. In certain embodiments, "X" and "Y" can include one or more 2'-deoxynucleosides. "Y" can include a 2'-deoxynucleoside. As used herein, a gapmer described as "XYZ" has a configuration such that the gap is positioned adjacent to each of the 5' wing and the 3' wing. Therefore, there is no intermediate nucleotide between the 5' wing and the gap or between the gap and the 3' wing. Any antisense compound in the antisense compounds described herein can have a gapmer motif. In certain embodiments, "X" and "Z" are identical; in other embodiments, they are different. In certain embodiments, "Y" is between 8 and 15 nucleosides. X, Y or Z can be any nucleotide of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleosides.

[0539] Target nucleic acids, target regions, and nucleotide sequences

[0540] In certain embodiments, the nucleotide sequence encoding HBV includes, but is not limited to, the following: GENBANK Accession No. U95551.1 (incorporated herein as SEQ ID NO: 1).

[0541] It should be understood that the sequence shown in each SEQ ID NO in the examples contained herein is independent of any modifications to the sugar moiety, internucleoside linkage or nucleobase. Thus, the antisense compound defined by the SEQ ID NO may independently include one or more modifications to the sugar moiety, internucleoside linkage or nucleobase.

[0542] In certain embodiments, the target region is a structurally defined region of the target nucleic acid. For example, the target region may encompass a 3'UTR, a 5'UTR, an exon, an intron, an exon / intron junction, a coding region, a translation initiation region, a translation termination region, or other defined nucleic acid regions. The structurally defined regions of HBV can be obtained from sequence databases such as NCBI by accession number, and such information is incorporated herein by reference. In certain embodiments, the target region may encompass the sequence from the 5' target site of a target segment within the target region to the 3' target site of another target segment within the same target region.

[0543] Targeting comprises determining at least one target segment to which an antisense compound hybridizes so as to cause a desired effect. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is a reduction in protein levels encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

[0544] The target area can contain one or more target segments. Multiple target segments within the target area can be overlapping. Alternatively, they can be non-overlapping. In certain embodiments, the target segments within the target area are separated by no more than about 300 nucleotides. In certain embodiments, the target segments within the target area are separated by multiple nucleotides on the target nucleic acid, and the nucleotides are, are about, no more than, no more than about 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20 or 10 target nucleic acids, or are a range defined by any two of the aforementioned values. In certain embodiments, the target segments within the target area are separated by no more than or no more than about 5 nucleotides on the target nucleic acid. In certain embodiments, the target segments are continuous. It is envisioned that the target area is defined by a range with a starting nucleic acid, and the starting nucleic acid is any one of the 5' target site or 3' target site listed herein.

[0545] Suitable target segments can be found in the 5'UTR, coding region, 3'UTR, intron, exon or exon / intron junction. Target segments containing start codons or stop codons are also suitable target segments. Suitable target segments can specifically exclude a structurally defined region, such as a start codon or stop codon.

[0546] The determination of a suitable target segment can comprise comparing the sequence of the target nucleic acid with other sequences in the entire genome. For example, the BLAST algorithm can be used to identify regions of similarity between different nucleic acids. This comparison can prevent the selection of antisense compound sequences (i.e., non-target or off-target sequences) that can hybridize with sequences other than the selected target nucleic acid in a non-specific manner.

[0547] The activity of the antisense compound in the active target area (for example, as defined by the percentage reduction of the target nucleic acid level) may vary. In certain embodiments, the reduction in HBV mRNA levels indicates the inhibition of HBV expression. The reduction in HBV protein levels also indicates the inhibition of target mRNA expression. Further, phenotypic changes indicate the inhibition of HBV expression. In certain embodiments, fatigue is reduced, flu-like symptoms are reduced, appetite is increased, nausea is reduced, joint pain is reduced, jaundice is reduced, abdominal pain is reduced, weakness is reduced, weight loss is reduced, male breast enlargement is reduced, palm rash is reduced, coagulation difficulties are reduced, cirrhosis is reduced, spider blood vessels in the skin are reduced, vitamin A and D absorption is increased, tumor growth is reduced, tumor volume is reduced, headache is reduced, fever is reduced, diarrhea is reduced, pain in the liver area of ​​the body is reduced, clay or gray stools are reduced, itching is reduced, dark urine is reduced, nausea and vomiting are reduced and can indicate the inhibition of HBV expression. In certain embodiments, improving the symptoms related to HBV-related conditions, diseases and disorders can indicate the inhibition of HBV expression. In certain embodiments, the reduction of cirrhosis indicates the inhibition of HBV expression. In certain embodiments, a reduction in liver cancer markers may indicate inhibition of HBV expression.

[0548] hybridization

[0549] In some embodiments, hybridization occurs between an antisense compound disclosed herein and an HBV nucleic acid.The most common hybridization mechanism involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

[0550] Hybridization can occur under different conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

[0551] Methods for determining whether a sequence can specifically hybridize to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein can specifically hybridize to HBV nucleic acid.

[0552] Complementarity

[0553] The antisense compound and target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with corresponding nucleobases of the target nucleic acid such that the desired effect (eg, antisense inhibition of a target nucleic acid such as HBV nucleic acid) will occur.

[0554] The non-complementary nucleobases between the antisense compound and the HBV nucleic acid can be tolerated, provided that the antisense compound is still able to specifically hybridize with the target nucleic acid. In addition, the antisense compound can hybridize on one or more sections of the HBV nucleic acid so that the middle or adjacent sections do not involve hybridization events (e.g., loop structures, mispairings, or hairpin structures).

[0555] In certain embodiments, the antisense compounds provided herein or its designated portion are complementary to HBV nucleic acid, target region, target segment or its designated portion or at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary. The complementarity percentage of the antisense compounds and the target nucleic acid can be measured using conventional methods.

[0556] For example, wherein 18 of the 20 core bases of the antisense compound are complementary to the target region and therefore the antisense compound of specific hybridization will represent 90% complementarity. In this example, the remaining non-complementary core bases can be clustered or interspersed with the complementary core bases and do not have to be adjacent to each other or adjacent to the complementary core bases. Therefore, an antisense compound with a length of 18 core bases has four non-complementary core bases, and the non-complementary core bases are flanked by two regions with complete complementarity to the target nucleic acid, and the non-complementary core bases have an overall complementarity of 77.8% with the target nucleic acid, and therefore will fall within the scope of the present invention. The percentage of complementarity between an antisense compound and a region of a target nucleic acid can be determined routinely using the BLAST program (Basic Local Alignment Search Tool) and the PowerBLAST program known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Homology, sequence identity, or complementarity can be determined, for example, by the Gap program (University Research Park, Madison Wis., Genetics Computer Group, Unix Version 8, Wisconsin Sequence Analysis Package), using default settings, using the Smith and Waterman algorithm (Adv. Appl. Math., 1981, 2, 482-489).

[0557] In certain embodiments, the antisense compounds provided herein or their designated portions are fully complementary to the target nucleic acid or its designated portion (i.e., 100% complementary). For example, the antisense compounds can be fully complementary to HBV nucleic acid or its target region or target segment or target sequence. As used herein, "fully complementary" means that each core base of the antisense compound can accurately base pair with the corresponding core base of the target nucleic acid. For example, a 20 core base antisense compound is fully complementary to a target sequence 400 core bases long, as long as the corresponding 20 core bases of the target nucleic acid are partially complementary to the antisense compound. Full complementarity can also be used with reference to the designated portion of the first and / or second nucleic acid. For example, the 20 core bases of a 30 core base antisense compound can be "fully complementary" to a target sequence 400 core bases long. If the target sequence has a corresponding 20 core base portion, the 20 core bases of the 30 core base oligonucleotide are fully complementary to the target sequence, wherein each core base is partially complementary to the 20 core bases of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

[0558] The position of non-complementary core base can be positioned at 5 ' end or 3 ' end of antisense compound.Alternatively, non-complementary core base and core base can be at the internal position of antisense compound.When there are two or more non-complementary core bases, described core base can be continuous (that is, connected) or non-continuous.In one embodiment, non-complementary core base is positioned in the wing section of gapmer antisense oligonucleotide.

[0559] In certain embodiments, the antisense compounds are 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length or at most comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase relative to a target nucleic acid (e.g., an HBV nucleic acid or a specified portion thereof). In certain embodiments, the antisense compounds are 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length or at most comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase relative to a target nucleic acid (e.g., an HBV nucleic acid or a specified portion thereof).

[0560] The antisense compounds provided also include antisense compounds that are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to the limited number of continuous (i.e., connected) core bases in a region or segment of a target nucleic acid. "Portion" can also refer to the continuous core bases of a limited number of antisense compounds. In certain embodiments, antisense compounds are partially complementary to at least 8 core bases of a target segment. In certain embodiments, antisense compounds are partially complementary to at least 9 core bases of a target segment. In certain embodiments, antisense compounds are partially complementary to at least 10 core bases of a target segment. In certain embodiments, antisense compounds are partially complementary to at least 11 core bases of a target segment. In certain embodiments, antisense compounds are partially complementary to at least 12 core bases of a target segment. In certain embodiments, antisense compounds are partially complementary to at least 13 core bases of a target segment. In certain embodiments, antisense compounds are partially complementary to at least 14 core bases of a target segment. In certain embodiments, antisense compounds are partially complementary to at least 15 core bases of a target segment. Also contemplated are antisense compounds that are complementary to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobase portions of a target segment, or ranges bounded by any two of these values.

[0561] Identity

[0562] The antisense compounds provided herein can also have a limited percent identity with a specific nucleotide sequence, SEQ ID NO or compound or portion thereof. As used herein, if the antisense compound has the same base pairing ability, then the antisense compound is identical to the sequence disclosed herein. For example, an RNA containing uracil instead of thymidine in the disclosed DNA sequence would be considered identical to the DNA sequence because both uracil and thymidine pair with adenine. It is also contemplated that the antisense compounds described herein and shortened and extended forms of compounds having different bases relative to the antisense compounds provided herein are present. Different bases can be adjacent to each other or dispersed throughout the antisense compound. The percent identity of the antisense compound is calculated based on the number of bases that have the same base pairing relative to the sequence being compared.

[0563] As used herein, a "complementary" polynucleotide is one that is capable of base pairing according to the standard Watson-Crick complementarity rules. Specifically, purines will base pair with pyrimidines to form combinations of guanine and cytosine (G:C) and, in the case of DNA, adenine and thymine (A:T), or, in the case of RNA, adenine and uracil (A:U). For example, the sequence "AGT" binds to the complementary sequence "TCA." It will be understood that even if two polynucleotides are not completely complementary to each other, they can hybridize to each other provided that each polynucleotide has at least one region that is substantially complementary to each other.

[0564] As used herein, the term "substantially complementary" or "partially complementary" means that two nucleic acid sequences are complementary to each other at least about 50%, 60%, 70%, 80% or 90% of their nucleotides.

[0565] In some embodiments, at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of the nucleotides of the two nucleic acid sequences can be complementary. In some embodiments, the two nucleic acid sequences can be 60% to 100% complementary, 70% to 100% complementary, 80% to 100% complementary, 90% to 100% complementary, 60% to 90% complementary, 60% to 80% complementary, 60% to 70% complementary, 70% to 90% complementary, 70% to 80% complementary, 80% to 100% complementary, or 80% to 90% complementary.

[0566] The terms "substantially complementary" and "partially complementary" can also mean that two nucleic acid sequences can hybridize under high stringency conditions, and such conditions are well known in the art.

[0567] As used herein, the term "identity" means that sequences are compared to each other as follows. In order to determine the percent identity of two nucleic acid sequences, sequences can first be compared relative to each other so that the comparison of these sequences can be made possible subsequently. For this reason, for example, a gap can be inserted into the sequence of the first nucleic acid sequence, and nucleotides can be compared with the corresponding positions of the second nucleic acid sequence. If the position in the first nucleic acid sequence is occupied by the same nucleotides as those in the position in the second sequence, the two sequences are identical at this position. The percent identity between the two sequences is the function of the quantity of the same positions divided by the quantity of all positions compared in the sequence under investigation.

[0568] The "percent identity" of an aligned segment of a test and reference sequence is the percentage of identical components shared by the two aligned sequences divided by the total number of components in the segment of the reference sequence, either the entire reference sequence or a smaller defined portion of the reference sequence.

[0569] The percent identity of two sequences can be determined with the aid of a mathematical algorithm. A preferred but non-limiting example of a mathematical algorithm that can be used to compare two sequences is the algorithm of Karlin et al. (1993), Proceedings of the National Academy of Sciences of the United States of America, 90: 5873-5877. Such an algorithm is integrated into the NBLAST program, which can be used to identify sequences with the desired identity to the sequences of the present invention. To obtain a gapped alignment, as described herein, a "gapped BLAST" program can be used, such as described in Altschul et al. (1997), Nucleic Acids Research, 25: 3389-3402. If BLAST and gapped BLAST programs are used, the preset parameters of the specific program (e.g., NBLAST) can be used. Sequences can be further aligned using the GAP (Global Alignment Program) version 9 of the "Genetic Computing Group" using a preset (BLOSUM62) matrix (values ​​-4 to +11), with a gap opening penalty of -12 (for the first zero in a gap) and a gap extension penalty of -4 (for each additional consecutive zero in a gap). After alignment, the percent identity is calculated by expressing the number of identical sequences as a percentage of the nucleic acid content in the claimed sequence. If necessary, the described method for determining the percent identity of two nucleic acid sequences can also be used correspondingly on the encoded amino acid sequence.

[0570] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego (1994), and in Carillo, H. and Lipton, D., (Applied Math 48:1073 (1988). More specifically, preferred computer programs for determining sequence identity include, but are not limited to, the Basic Local Alignment Search Tool (BLAST) program, available from the National Center Biotechnology Information (NCBI), National Library of Medicine, National Institute of Health, Bethesda, Md., 20894; see BLAST Manual (Altschul et al., NCBI, NLM, NIH; Altschul et al., J. Mol. Biol. 215:403-410 (1990)); version 2.0 or later of the BLAST program allows for the introduction of gaps (deletions and insertions) into the alignment; for peptide sequences, sequence identity can be determined using BLASTX; and for polynucleotide sequences, sequence identity can be determined using BLASTN. The percent identity can be 70% identity or greater, e.g., at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity.

[0571] Modification

[0572] Nucleoside is a base-sugar combination. The core base (also referred to as base) portion of a nucleoside is typically a heterocyclic base portion. Nucleotide is a nucleoside that further comprises a phosphate group covalently attached to the sugar portion of the nucleoside. For those nucleosides comprising pentofuranosyl sugars, the phosphate group can be attached to the 2', 3' or 5' hydroxyl portion of the sugar. Oligonucleotides are formed by covalent bonds between adjacent nucleosides to form linear polymer oligonucleotides. Within the oligonucleotide structure, the phosphate group is generally referred to as the internucleoside bond that forms the oligonucleotide.

[0573] Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are generally preferred over native forms because of desirable properties such as enhanced cellular uptake, enhanced affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased inhibitory activity.

[0574] Chemically modified nucleosides can also be used to increase the binding affinity of shortened or truncated antisense oligonucleotides to their target nucleic acids. Thus, comparable results can often be obtained with shorter antisense compounds having such chemically modified nucleosides.

[0575] Modified internucleoside linkages

[0576] The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester bond. Antisense compounds having one or more modified, i.e., non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as enhanced cellular uptake, enhanced affinity for the target nucleic acid, and increased stability in the presence of nucleases.

[0577] Oligonucleotides with modified internucleoside bonds include internucleoside bonds that retain phosphorus atoms as well as internucleoside bonds that do not have phosphorus atoms. Representative phosphorus-containing internucleoside bonds include, but are not limited to, phosphodiester, phosphotriester, methylphosphonate, amino acid phosphoester, and phosphorothioate. Methods for preparing phosphorus-containing and non-phosphorus-containing bonds are well known.

[0578] In certain embodiments, the antisense compounds targeting HBV nucleic acid include one or more modified internucleoside bonds. In certain embodiments, the modified internucleoside bond is a phosphorothioate bond. In certain embodiments, each internucleoside bond of the antisense compounds is a phosphorothioate internucleoside bond.

[0579] Modified sugar moieties

[0580] The antisense compounds provided herein may optionally contain one or more nucleosides in which the sugar group has been modified. Such sugar-modified nucleosides can impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological properties to the antisense compounds. In certain embodiments, the nucleosides include chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include, but are not limited to, the addition of substituent groups (including 5' and / or 2' substituent groups; bridging non-geminal ring atoms to form bicyclic nucleic acids (BNAs); using S, N (R) or C (R) 1 )(R 2 )(R=H、C1-C 12alkyl or protecting group) to replace the ribosyl ring oxygen atom; And combinations thereof. Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleosides (for other disclosed 5', 2'-disubstituted nucleosides, see PCT International Application WO 2008 / 101157 published on August 21, 2008), replacing the ribosyl ring oxygen atom with S, and further replacing it at the 2' position (see U.S. Patent Application US2005 / 0130923 published on June 16, 2005), or alternatively, 5'-substitution of BNA (see PCT International Application WO 2007 / 134181 published on November 22, 2007, wherein LNA is substituted by, for example, 5'-methyl or 5'-vinyl).

[0581] Examples of nucleosides with modified sugar moieties include, but are not limited to, nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH3, and 2'-O(CH2)2OCH3 substituent groups. The substituent at the 2' position may also be selected from the following: allyl, amino, azido, thio, O-allyl, O-C1-C 10 Alkyl, OCF3, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n ) and O-CH2-C(=O)-N(R m )(R n ), where each R m and R n are independently H or substituted or unsubstituted C1-C 10 alkyl.

[0582] As used herein, "bicyclic nucleoside" refers to a modified nucleoside comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include, but are not limited to, nucleosides comprising a bridge between 4' and 2' ribosyl ring atoms. In certain embodiments, the antisense compounds provided herein comprise one or more bicyclic nucleosides, wherein the bridge comprises a 4' to 2' bicyclic nucleoside. Examples of such 4' to 2' bicyclic nucleosides include, but are not limited to, one of the following formulae: 4'-(CH2)-O-2'(LNA); 4'-(CH2)-S-2; 4'-(CH2)2-O-2'(ENA); 4'-CH(CH3)-O-2'(cEt) and 4'-CH(CH2OCH3)-O-2' and analogs thereof (see U.S. Patent No. 7,399,845, issued on July 15, 2008); 4'-C(CH3)(CH3)-O-2' and analogs thereof (see U.S. Patent No. 200800103); 2' (see published PCT International Application WO2009 / 006478, published on January 8, 2009); 4'-CH2-N(OCH3)-2' and its analogs (see published PCT International Application WO2008 / 150729, published on December 11, 2008); 4'-CH2-ON(CH3)-2' (see published U.S. Patent Application US2004 / 0171570, published on September 2, 2004); 4'-CH2-N(R)-O-2', wherein R is H, C1-C 12alkyl or protecting groups (see U.S. Pat. No. 7,427,672, issued Sep. 23, 2008); 4'-CH2-C(H)(CH3)-2' (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C(=CH2)-2' and analogs thereof (see published PCT International Application No. WO 2008 / 154401, published Dec. 8, 2008).See also, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proceedings of the National Academy of Sciences of the United States of America, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., Journal of Organic Chemistry, 19 98, 63, 10035-10039; Srivastava et al., Journal of the American Chemical Society (J.Am.Chem.Soc.), 129(26) 8362-8379 (July 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Journal of Chemical Biology (Chem.Biol.), 2001, 8, 1-7; Orum et al., Curr. Opinion Invens. Drugs, Mol. Ther.), 2001, 3, 239-243; U.S. Patent Nos. 6,670,461, 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 7,399,845; Published PCT International Applications WO 2004 / 106356, WO 94 / 14226, WO 2005 / 021570, and WO 2007 / 134181; U.S. Patent Publication Nos. US2004 / 0171570, US2007 / 0287831, and US2008 / 0039618; and U.S. Patent Serial Nos. 12 / 129,154, 60 / 989,574, 61 / 026,995, 61 / 026,998, 61 / 056,564, 61 / 086,231, 61 / 097,787, and 61 / 099,844; and PCT International Application Nos. PCT / US2008 / 064591, PCT / US2008 / 066154, and PCT / US2008 / 068922. Each of the foregoing bicyclic nucleosides can be prepared with one or more stereochemical sugar configurations including, for example, α-L-ribofuranose and β-D-ribofuranose (see PCT International Application No. PCT / DK98 / 00393, published on March 25, 1999 as WO 99 / 14226).

[0583] In certain embodiments, the bicyclic sugar moiety of the BNA nucleoside includes, but is not limited to, compounds having at least one bridge between the 4' and 2' positions of the pentofuranosyl sugar moiety, wherein such bridge independently comprises 1 or 2 to 4 linked groups independently selected from: -[C(R a )(R b )] n -、-C(R a )=C(R b )-、-C(R a )=N-、-C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-、-S(=O) x -and-N(R a )-;

[0584] in:

[0585] x is 0, 1, or 2;

[0586] n is 1, 2, 3, or 4;

[0587] Each R a and R b are independently H, a protecting group, a hydroxyl group, a C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl C5-C 20 Aryl, substituted C5-C 20 Aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ 1 、NJ 1 J 2 、SJ 1 、N3、COOJ 1 , acyl (C (= O) -H), substituted acyl, CN, sulfonyl (S (= O) 2 -J 1 ) or synergistic sulfone (S(=O)-J 1 );and

[0588] Each J 1 and J 2 are independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C (= O) -H), substituted acyl, heterocyclic, substituted heterocyclic, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl or a protecting group.

[0589] In certain embodiments, the bridge of the bicyclic sugar moiety is -[C(R a )(R b )] n -、-[C(R a )(R b )] n -O-、-C(R a )(R b )-N(R)-O- or—C(R a )(R b In certain embodiments, the bridge is 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2'-, wherein each R is independently H, a protecting group, or a C1-C 12 alkyl.

[0590] In certain embodiments, bicyclic nucleosides are further defined by isomeric configurations. For example, nucleosides comprising a 4'-2' methylene-oxy bridge can be in an α-L configuration or a β-D configuration. Previously, α-L-methyleneoxy (4'-CH2-O-2') BNAs have been incorporated into antisense oligonucleotides showing antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 63 6563 72).

[0591] In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) α-L-methyleneoxy (4'-CH2-O-2') BNA, (B) β-D-methyleneoxy (4'-CH2-O-2') BNA, (C) vinyloxy (4'-(CH2)2-O-2') BNA, (D) aminooxy (4'-CH2-ON(R)-2') BNA, (E) oxyamino (4'-CH2-N(R)-O-2') BNA, )BNA, (F) methyl(methyleneoxy) (4'-CH(CH3)-O-2')BNA, (G) methylene-thio (4'-CH2-S-2')BNA, (H) methylene-amino (4'-CH2-N(R)-2')BNA, (I) methylcarbocycle (4'-CH2-CH(CH3)-2')BNA and (J) propylenecarbocycle (4'-(CH2)3-2')BNA, as depicted below.

[0592]

[0593] wherein Bx is a base moiety, and R is independently H, a protecting group or a C1-C 12 alkyl.

[0594] In certain embodiments, the bicyclic nucleoside is according to Formula I:

[0595]

[0596] in:

[0597] Bx is a heterocyclic base moiety;

[0598] -Q a -Q b -Q c -is-CH2-N(R c )-CH2-、-C(=O)-N(R c )-CH2-、-CH2-ON(R c )-、-CH2-N(R c )-O-or-N(R c )-O-CH2;

[0599] R c It is C1-C 12 an alkyl or amino protecting group; and

[0600] T a and T b Each is independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent linkage to a support medium.

[0601] In certain embodiments, the bicyclic nucleoside has Formula II:

[0602]

[0603] in:

[0604] Bx is a heterocyclic base moiety;

[0605] T a and T b Each is independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent linkage to a support medium;

[0606] Z a is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol, or substituted thio.

[0607] In one embodiment, each substituted group in the substituted group is independently monosubstituted or polysubstituted with a substituent group independently selected from the group consisting of halogen, oxo, hydroxy, O, c 、NJ c J d 、SJ c 、N3、OC(=X)J c and NJ e C(=X)NJ c J d , where each J c 、J d and J e are independently H, C1-C6 alkyl or substituted C1-C6 alkyl, and X is O or NJ c .

[0608] In certain embodiments, the bicyclic nucleoside has Formula III:

[0609]

[0610] in:

[0611] Bx is a heterocyclic base moiety;

[0612] T a and T b Each is independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent linkage to a support medium;

[0613] Z b It is a C1-C6 alkyl group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, a substituted C1-C6 alkyl group, a substituted C2-C6 alkenyl group, a substituted C2-C6 alkynyl group or a substituted acyl group (C(=O)-).

[0614] In certain embodiments, the bicyclic nucleoside has Formula IV:

[0615]

[0616] in:

[0617] Bx is a heterocyclic base moiety;

[0618] T a and T b Each is independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent linkage to a support medium;

[0619] R d is C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;

[0620] Each q a ,q b ,q c and q d is independently H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, acyl, substituted acyl, C1-C6 aminoalkyl or substituted C1-C6 aminoalkyl;

[0621] In certain embodiments, the bicyclic nucleoside has Formula V:

[0622]

[0623] in:

[0624] Bx is a heterocyclic base moiety;

[0625] T a and T b Each is independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent linkage to a support medium;

[0626] q a ,q b ,q e and q f are independently hydrogen, halogen, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12Alkynyl, substituted C2-C 12 Alkynyl, C1-C 12 Alkoxy, substituted C1-C 12 Alkoxy, OJ j 、SJ j 、SOJ j 、SO2J j 、NJ j J k 、N3、CN、C(=O)OJ j 、C(=O)NJ j J k 、C(=O)J j 、OC(=O)NJ j J k 、N(H)C(=NH)NJ j J k 、N(H)C(=O)NJ j J k or N(H)C(=S)NJ j J k ;

[0627] or q e and q f Together is =C(q g )(q h );

[0628] q g and q h are independently H, halogen, C1-C 12 Alkyl or substituted C1-C 12 alkyl.

[0629] The synthesis and preparation of methyleneoxy (4'-CH2-O-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, as well as their oligomerization and nucleic acid recognition properties, have been described (see, for example, Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and their preparation are also described in WO 98 / 39352 and WO 99 / 14226.

[0630] Analogs of methyleneoxy (4'-CH2-O-2') BNA, methyleneoxy (4'-CH2-O-2') BNA, and 2'-thio-BNA have also been prepared (see, for example, Kumar et al., Bioorganic and Medicinal Chemistry Letters, 1998, 8, 2219-2222). The preparation of locked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (see, for example, Wengel et al., WO 99 / 14226). In addition, the synthesis of 2'-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog, has been described in the art (see, for example, Singh et al., Journal of Organic Chemistry, 1998, 63, 10035-10039). In addition, 2'-amino- and 2'-methylamino-BNAs have been prepared, and their thermal stability with duplexes of complementary RNA and DNA chains has been previously reported.

[0631] In certain embodiments, the bicyclic nucleoside has Formula VI:

[0632]

[0633] in:

[0634] Bx is a heterocyclic base moiety;

[0635] T a and T b Each is independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent linkage to a support medium;

[0636] Each q i ,q j ,q k and q l are independently H, halogen, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C1-C 12 Alkoxy, substituted C1-C 12 Alkoxy, OJ j 、SJ j 、SOJ j 、SO2J j 、NJ j J k 、N3、CN、C(=O)OJ j 、C(=O)NJ j J k、C(=O)J j 、OC(=O)NJ j J k 、N(H)C(=NH)NJ j J k 、N(H)C(=O)NJ j J k or N(H)C(=S)NJ j J k ;and

[0637] q i and q j or q 1 and q k Together is =C(q g )(q h ), where q g and q h are independently H, halogen, C1-C 12 Alkyl or substituted C1-C 12 alkyl.

[0638] A carbocyclic bicyclic nucleoside having a 4'-(CH2)3-2' bridge and an alkenyl analog bridge 4'-CH=CH-CH2-2' has been described (see, for example, Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., Journal of Organic Chemistry, 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides as well as their oligomerization and biochemical studies have also been described (see, for example, Srivastava et al., Journal of the American Chemical Society, 2007, 129(26), 8362-8379).

[0639] As used herein, a "bicyclic nucleoside" refers to a nucleoside that includes a bridge connecting two carbon atoms of a sugar ring, thereby forming a bicyclic sugar moiety. In certain embodiments, the bridge connects the 2' carbon and another carbon of the sugar ring.

[0640] As used herein, "4'-2' bicyclic nucleoside" or "4' to 2' bicyclic nucleoside" refers to a bicyclic nucleoside that includes a furanose ring that includes a bridge connecting the 2' carbon atom and the 4' carbon atom.

[0641] As used herein, a "monocyclic nucleoside" refers to a nucleoside that includes a modified sugar moiety that is not a bicyclic sugar moiety. In certain embodiments, the sugar moiety or sugar moiety analog of a nucleoside can be modified or substituted at any position.

[0642] As used herein, "2'-modified sugar" refers to a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications comprise substituents selected from the group consisting of halides including but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted aminoalkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, the 2' modification is selected from the group consisting of substituents including but not limited to O[(CH2) n O] m CH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, OCH2C(=O)N(H)CH3 and O(CH2) n ON[(CH2) n CH3]2, wherein n and m are 1 to about 10. Other 2'-substituent groups may also be selected from: C1-C 12Alkyl; substituted alkyl; alkenyl; alkynyl; alkaryl; aralkyl; O-alkaryl or O-aralkyl; SH; SCH3; OCN; Cl; Br; CN; CF3; OCF3; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; RNA cleavage group; reporter group, intercalator, group for improving pharmacokinetic properties, and group for improving the pharmacodynamic properties of antisense compounds and other substituents with similar properties. In certain embodiments, the modified nucleoside includes a 2'-MOE side chain (see, e.g., Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitutions have been described as having improved binding affinity compared to unmodified nucleosides and other modified nucleosides such as 2'-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides with 2'-MOE substituents have also been shown to be antisense inhibitors of gene expression with promising characteristics for in vivo use (see, e.g., Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

[0643] As used herein, "modified tetrahydropyranose nucleosides" or "modified THP nucleosides" refers to nucleosides having a six-membered tetrahydropyranose "sugar" substituted for the pentofuranosyl residue in normal nucleosides (sugar surrogate). Modified THP nucleosides include, but are not limited to, nucleosides known in the art as hexitol nucleic acids (HNAs), altritol nucleic acids (ANAs), mannitol nucleic acids (MNAs) (see Leumann, CJ. Bioorg. & Med. Chem. (2002) 10:841-854), fluoro-HNAs (F-HNAs), or those compounds having Formula X:

[0644] wherein for each tetrahydropyranoside analog of the at least one tetrahydropyranoside analog of formula X, independently:

[0645]

[0646] Bx is a heterocyclic base moiety;

[0647] T 3 and T 4 Each independently is an internucleoside linker that connects the tetrahydropyranoside analog to the antisense compound, or T 3 and T 4 One of them is an internucleoside linker that connects the tetrahydropyranoside analog to the antisense compound, and T 3 and T 4 The other of which is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3' terminal group;

[0648] q 1 ,q 2 ,q 3 ,q 4 ,q 5 ,q 6 and q 7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and

[0649] R 1 and R 2 One of them is hydrogen, and the other is selected from the group consisting of halogen, substituted or unsubstituted alkoxy, NJ 1 J 2 、SJ 1 、N3、OC(=X)J 1 、OC(=X)NJ 1 J 2 、NJ 3 C(=X)NJ 1 J 2 and CN, where X is O, S or NJ 1 , and each J 1 、J 2 and J 3 are independently H or C1-C6 alkyl.

[0650] In certain embodiments, a modified THP nucleoside of Formula X is provided, wherein q m ,q n ,q p ,q r ,q s ,q t and q u Each is H. In certain embodiments, q m ,q n ,q p ,q r ,q s ,q t and qu At least one of is not H. In certain embodiments, q m ,q n ,q p ,q r ,q s ,q t and q u In certain embodiments, there is provided a THP nucleoside of formula X, wherein R 1 and R 2 In certain embodiments, one of R 1 is fluorine and R 2 It's H, R 1 is methoxy and R 2 is H, and R 1 is methoxyethoxy and R 2 It’s H.

[0651] As used herein, "2'-modified nucleosides" or "2'-substituted nucleosides" refer to nucleosides that include a sugar that includes a substituent at the 2' position of the furanose ring other than H or OH. 2'-modified nucleosides include, but are not limited to, bicyclic nucleosides in which a bridge connecting two carbon atoms of the sugar ring connects the 2' carbon of the sugar ring and another carbon and nucleosides with non-bridged 2'-substituents, such as allyl, amino, azido, thio, O-allyl, O-C1-C 10 Alkyl, -OCF3, O-(CH2)2-OCH3, 2'-O(CH2)2SCH3, O-(CH2)2-ON(R m )(R n ) or O-CH2-C(=O)-N(R m )(R n ), where each R m and R n are independently H or substituted or unsubstituted C1-C 10 The 2'-modified nucleosides may further include other modifications, such as modifications at other positions of the sugar and / or at the nucleobase.

[0652] As used herein, "2'-F" refers to a sugar that includes a fluorine group at the 2' position.

[0653] As used herein, "2'-OMe" or "2'-OCH3" or "2'-O-methyl" each refers to a nucleoside that includes a sugar that includes an -OCH3 group at the 2' position of the sugar ring.

[0654] As used herein, " oligonucleotide " refers to a compound comprising a plurality of connected nucleosides. In certain embodiments, one or more nucleosides in a plurality of nucleosides are modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).

[0655] Many other bicyclic and tricyclic sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see, for example, a review article: Leumann, JC, Bioorganic and Medicinal Chemistry, 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity.

[0656] Methods for preparing modified sugars are well known to those skilled in the art.

[0657] In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified, or a combination thereof) are maintained for hybridization to the appropriate nucleic acid target.

[0658] In certain embodiments, antisense compounds include one or more nucleotides with a modified sugar moiety. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE modified nucleotides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is cEt. In certain embodiments, the cEt modified nucleotides are arranged in the entire wing of the gapmer motif.

[0659] Compositions and methods for formulating pharmaceutical compositions

[0660] Antisense oligonucleotides can be mixed with pharmaceutically acceptable active or inert substances to prepare pharmaceutical compositions or formulations. The composition and method used to formulate pharmaceutical compositions depend on many criteria, including but not limited to the route of administration, the extent of the disease, or the dose to be administered.

[0661] By combining antisense compounds with suitable pharmaceutically acceptable diluents or carriers, antisense compounds targeting HBV nucleic acids can be used in pharmaceutical compositions. Pharmaceutically acceptable diluents include phosphate buffered saline (PBS). PBS is a diluent suitable for compositions to be delivered parenterally. Therefore, in one embodiment, the pharmaceutical compositions used in the methods described herein include antisense compounds targeting HBV nucleic acids and pharmaceutically acceptable diluents. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compounds are antisense oligonucleotides.

[0662] Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salt, ester, or salt of such ester, or any other oligonucleotide that is capable of providing (directly or indirectly) a biologically active metabolite or residue thereof when administered to an animal, including a human. Thus, for example, the present disclosure is also drawn to pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents of antisense compounds. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0663] Prodrugs may comprise the incorporation of additional nucleosides at one or both termini of the antisense compound, which are cleaved by endogenous nucleases in vivo to form the active antisense compound.

[0664] The present disclosure provides pharmaceutical compositions comprising the modified oligonucleotides of the present disclosure and a pharmaceutically acceptable carrier, diluent or excipient. In some embodiments, the modified oligonucleotides comprise the sequence of any one of SEQ ID NOs: 11-666. In some embodiments, as described herein, the modified oligonucleotides comprise the sequence of any one of SEQ ID NOs: 11-666 and one, two, three, four or five modifications of the modified oligonucleotides.

[0665] The modified oligonucleotides can be mixed with pharmaceutically acceptable active or inert substances to prepare pharmaceutical compositions or formulations. The composition and method for formulating pharmaceutical compositions depends on many criteria, including but not limited to the route of administration, the extent of the disease, or the dose to be administered.

[0666] The pharmaceutical compositions of the present disclosure may optionally include therapeutic agents, pharmaceutical agents, carriers, adjuvants, dispersants, diluents, and the like.

[0667] By combining antisense compounds with suitable pharmaceutically acceptable diluents or carriers, antisense compounds targeting HBV nucleic acids can be used in pharmaceutical compositions. Pharmaceutically acceptable diluents include phosphate buffered saline (PBS). PBS is a diluent suitable for compositions to be delivered parenterally. Therefore, in one embodiment, the pharmaceutical compositions used in the methods described herein include antisense compounds targeting HBV nucleic acids and pharmaceutically acceptable diluents. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compounds are antisense oligonucleotides.

[0668] Pharmaceutical compositions comprising modified oligonucleotides may encompass any pharmaceutically acceptable salt, ester, or salt of such ester, or any other oligonucleotide capable of providing (directly or indirectly) a biologically active metabolite or residue thereof when administered to an animal, including a human. Thus, for example, the present disclosure is also drawn to pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents of antisense compounds. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0669] Modified oligonucleotides formulated as prodrugs are contemplated as being within the scope of the present disclosure.Prodrugs may comprise the incorporation of additional nucleosides at one or both ends of the antisense compound that are cleaved by endogenous nucleases in vivo to form the active antisense compound.

[0670] The pharmaceutical composition may contain any of the agents discussed above, together with one or more pharmaceutically acceptable carriers, diluents, or excipients.

[0671] A "pharmaceutical composition" is a formulation comprising a modified oligonucleotide as described herein in a form suitable for administration to a subject. In certain embodiments, the pharmaceutical composition is in bulk or unit dosage form. A unit dosage form is any of a variety of forms, including, for example, a capsule, IV bag, tablet, disposable syringe, aerosol inhaler, or a single pump on a vial. The amount of active ingredient (e.g., a formulation of a modified oligonucleotide) in a unit dose of the composition is an effective amount and varies depending on the specific treatment involved. Those skilled in the art will appreciate that it is sometimes necessary to make routine changes to the dosage depending on the age and condition of the patient. The dosage will also depend on the route of administration. A variety of routes are envisioned, including oral, pulmonary, rectal, parenteral, transdermal, subcutaneous, intravenous, intramuscular, intraperitoneal, inhalation, oral, sublingual, intrapleural, intrathecal, intranasal, etc. Dosage forms for topical or transdermal administration of the present invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants. In certain embodiments, the modified oligonucleotide is mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants that are required.

[0672] "Pharmaceutically acceptable excipient" means an excipient that can be used to prepare a pharmaceutical composition that is generally safe, non-toxic, and biologically and otherwise desirable, and includes excipients that are acceptable for veterinary use as well as human pharmaceutical use. "Pharmaceutically acceptable excipient" as used in the specification includes both one and more than one such excipient.

[0673] The pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, for example, intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), intraperitoneal (into the body cavity), and transmucosal administration. Solutions or suspensions for parenteral, intradermal, intraperitoneal, or subcutaneous application may include the following components: a sterile diluent, such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerol, propylene glycol, or other synthetic solvents; an antibacterial agent, such as benzyl alcohol or methyl paraben; an antioxidant, such as ascorbic acid or sodium bisulfite; a chelating agent, such as ethylenediaminetetraacetic acid; a buffer, such as acetate, citrate, or phosphate; and an agent for adjusting tension, such as sodium chloride or dextrose. The pH can be adjusted with an acid or base, such as hydrochloric acid or sodium hy...

Claims

1. A compound comprising a modified oligonucleotide, wherein the modified oligonucleotide comprises from 5' to 3': 5'W1-G1-S1-G2-W2 3' (Formula I) in: W1 is the 5′ wing segment; W2 is the 3′ wing segment; G1 is the first gap section; S1 is the first separated sub-segment; G2 is the second gap section; - is an internucleoside bond; and At least one nucleoside of the oligonucleotide is modified.

2. The compound according to claim 1, wherein the modified oligonucleotide comprises from 5' to 3': 5'W1-G1-S1-G2-S2-G3-W2 3'(Formula II) in: S2 is the second separated sub-segment; and G3 is the third gap segment.

3. The compound according to claim 2, wherein the modified oligonucleotide comprises from 5' to 3': 5'W1-G1-S1-G2-S2-G3-S3-G4-W2 3'(Formula III) in: S3 is the third separated sub-segment; and G4 is the fourth gap segment.

4. The compound according to claim 3, wherein the modified oligonucleotide comprises from 5' to 3': 5'W1-G1-S1-G2-S2-G3-S3-G4-S4-G5-W2 3'(Formula IV) in: S4 is the fourth separated sub-segment; and G5 is the fifth gap segment.

5. The compound according to claim 4, wherein the modified oligonucleotide comprises from 5' to 3': 5'W1-G1-S1-G2-S2-G3-S3-G4-S4-G5-S5-G6-W2 3'(Formula V) in: S5 is the fifth separated sub-segment; and G6 is the sixth gap segment.

6. The compound according to claim 5, wherein the modified oligonucleotide comprises from 5' to 3': 5'W1-G1-S1-G2-S2-G3-S3-G4-S4-G5-S5-G6-S6-G7-W23'(Formula VI) in: S6 is the sixth dividing sub-segment; and G7 is the seventh gap segment.

7. A compound according to any one of claims 1 to 6, wherein W1 comprises one or more linked deoxynucleosides.

8. A compound according to any one of claims 1 to 7, wherein W2 comprises one or more linked deoxynucleosides.

9. A compound according to any one of claims 1 to 8, wherein W1 comprises 2 to 25 linked nucleosides.

10. A compound according to any one of claims 1 to 9, wherein W2 comprises 2 to 35 linked nucleosides.

11. The compound according to any one of claims 1 to 10, wherein G1 comprises 1 to 10 linked deoxynucleosides.

12. A compound according to any one of claims 1 to 11, wherein G2 comprises 1 to 10 linked deoxynucleosides.

13. A compound according to any one of claims 1 to 12, wherein S1 comprises 1 to 3 linked nucleosides.

14. A compound according to any one of claims 2 to 13, wherein G3 comprises 1 to 10 linked deoxynucleosides.

15. A compound according to any one of claims 2 to 14, wherein S2 comprises 1 to 3 linked nucleosides.

16. A compound according to any one of claims 3 to 15, wherein G4 comprises 1 to 10 linked deoxynucleosides.

17. A compound according to any one of claims 3 to 16, wherein S3 comprises 1 or 2 linked nucleosides.

18. A compound according to any one of claims 4 to 17, wherein G5 comprises 1 to 10 linked deoxynucleosides.

19. A compound according to any one of claims 4 to 17, wherein S4 comprises 1 to 3 linked nucleosides.

20. A compound according to any one of claims 5 to 19, wherein G6 comprises 1 to 10 linked deoxynucleosides.

21. A compound according to any one of claims 5 to 19, wherein S5 comprises 1 to 3 linked nucleosides.

22. A compound according to any one of claims 6 to 21, wherein G7 comprises 1 to 10 linked deoxynucleosides.

23. A compound according to any one of claims 6 to 22, wherein S6 comprises 1 to 3 linked nucleosides.

24. The compound of any one of claims 1 to 23, wherein the oligonucleotide is 18-50 nucleobases in length.

25. The compound of any one of claims 1 to 23, wherein the oligonucleotide is at least 20 nucleobases in length.

26. The compound of any one of claims 1 to 23, wherein the oligonucleotide is 20 nucleobases in length.

27. The compound of claim 1, wherein the oligonucleotide is 20 linked nucleobases in length.

28. The compound of claim 27, wherein W1 comprises 4 linked nucleosides.

29. The compound of claim 27, wherein W1 comprises 5 linked nucleosides.

30. A compound according to any one of claims 27 to 29, wherein G1 comprises 4 linked deoxynucleosides.

31. A compound according to any one of claims 27 to 29, wherein G1 comprises 5 linked deoxynucleosides.

32. A compound according to any one of claims 27 to 29, wherein G1 comprises 6 linked deoxynucleosides.

33. A compound according to any one of claims 27 to 32, wherein G2 comprises 4 linked deoxynucleosides.

34. A compound according to any one of claims 27 to 32, wherein G2 comprises 5 linked deoxynucleosides.

35. A compound according to any one of claims 27 to 32, wherein G2 comprises 6 linked deoxynucleosides.

36. A compound according to any one of claims 27 to 33, wherein S1 comprises at least one linked nucleoside.

37. A compound according to any one of claims 27 to 35, wherein W2 comprises 5 linked nucleosides.

38. A compound according to any one of claims 27 to 35, wherein W2 comprises 6 linked nucleosides.

39. The compound according to any one of claims 27 to 38, wherein the S1 is located at position 10 of the oligonucleotide.

40. The compound of claim 39, wherein W1 comprises 4 linked nucleosides, G1 comprises 5 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 5 linked deoxynucleosides, and W2 comprises 5 linked nucleosides.

41. The compound of claim 1, wherein W1 comprises 4-6 linked nucleosides.

42. The compound of claim 41, wherein W2 comprises 4-6 linked nucleosides.

43. A compound according to any one of claims 41 to 42, wherein G1 comprises 1-6 linked deoxynucleosides.

44. according to the compound described in any one of claim 41 to 43, wherein G2 comprises 1-6 linked deoxynucleosides.

45. according to the compound described in any one of claim 41 to 44, wherein G3 comprises 1-6 linked deoxynucleosides.

46. ​​A compound according to any one of claims 41 to 45, wherein S1 comprises at least one linked nucleoside.

47. A compound according to any one of claims 41 to 46, wherein the length of the G1-S1-G2 is between 8 and 12 nucleobases.

48. A compound according to any one of claims 1 to 47, wherein any one or more of G1, G2, G3, G4, G5, G6 and G7 comprises a nucleoside comprising a modification to a 2'-deoxynucleoside.

49. The compound of claim 48, wherein any one or more of G1, G2, G3, G4, G5, G6, and G7 comprises a nucleoside comprising a 2'-deoxy 5-methylcytidine sugar modification.

50. A compound according to any one of claims 1 to 49, wherein S1, S2, S3, S4, S5 and / or S6 comprises a nucleoside comprising a 2'-O-methoxyethyl sugar modification.

51. according to the compound described in any one of claims 1 to 49, wherein S1, S2, S3, S4, S5 and / or S6 comprise a nucleoside comprising 5-methylcytidine.

52. A compound according to any one of claims 1 to 49, wherein S1, S2, S3, S4, S5 and / or S6 comprise a nucleoside comprising a 2'-O-methyl sugar modification.

53. A compound according to any one of claims 1 to 52, wherein S1, S2, S3, S4, S5 and / or S6 comprises a nucleoside comprising a 2'-OH sugar modification.

54. A compound according to any one of claims 1 to 53, wherein S1, S2, S3, S4, S5 and / or S6 comprises a nucleoside comprising a 2'-fluoro sugar modification.

55. according to the compound described in any one of claims 1 to 54, wherein S1, S2, S3, S4, S5 and / or S6 comprise 2'-fluoro-arabinonucleic acid (2'-fluoro-ANA) sugar-modified nucleosides.

56. A compound according to any one of claims 1 to 55, wherein S1, S2, S3, S4, S5 and / or S6 comprise glycol nucleic acid (GNA).

57. A compound according to any one of claims 1 to 56, wherein S1, S2, S3, S4, S5 and / or S6 comprises LNA.

58. A compound according to any one of claims 1 to 57, wherein W1 comprises a nucleoside comprising a 2'-deoxy sugar modification.

59. The compound of claim 58, wherein the 2'-deoxy sugar modification is located at position 2 and / or 5 of the sequence corresponding to SEQ ID NO:

2.

60. A compound according to any one of claims 1 to 59, wherein W1 comprises a nucleoside comprising a 2'-O-methoxyethyl sugar modification.

61. The compound of claim 60, wherein the 2'-O-methoxyethyl sugar modification is located at position 1, 2, 3, 4 and / or 5 of the sequence corresponding to SEQ ID NO:

2.

62. A compound according to any one of claims 1 to 61, wherein W1 comprises 2'-O-methoxyethyl 5-methylcytidine at position 2 of the sequence corresponding to SEQ ID NO:

2.

63. A compound according to any one of claims 1 to 62, wherein W1 comprises a nucleoside comprising a 2'-O-methyl sugar modification.

64. The compound of claim 63, wherein the 2'-O-methyl sugar modification is located at position 1, 2, 3, 4 and / or 5 of the sequence corresponding to SEQ ID NO:

2.

65. The compound of claim 63, wherein W1 comprises 2'-O-methyl 5-methylcytidine at position 2 of the sequence corresponding to SEQ ID NO:

2.

66. A compound according to any one of claims 1 to 65, wherein W1 comprises a nucleoside comprising a 2'-fluoro sugar modification.

67. A compound according to any one of claims 1 to 66, wherein W1 comprises a nucleoside modified with 2'-fluoro-arabinoic acid (2'-fluoro-ANA).

68. A compound according to any one of claims 1 to 67, wherein W1 comprises glycol nucleic acid (GNA).

69. A compound according to any one of claims 1 to 67, wherein the GNA is located at position 2 of the sequence corresponding to SEQ ID NO:

2.

70. according to the compound described in any one of claims 1 to 69, wherein W1 comprises a modified nucleoside, and wherein the modified nucleoside is a locked nucleic acid (LNA).

71. The compound according to claim 70, wherein the LNA is located at position 1 and / or 3 of the sequence corresponding to SEQ ID NO:

2.

72. A compound according to any one of claims 1 to 71, wherein W2 comprises a nucleoside comprising a 2'-deoxy sugar modification.

73. The compound of claim 72, wherein the 2'-deoxy sugar modification is located at position 15 and / or 16 of the sequence corresponding to SEQ ID NO:

2.

74. A compound according to any one of claims 1 to 73, wherein W2 comprises a nucleoside comprising a 2'-O-methoxyethyl sugar modification.

75. The compound of claim 74, wherein the 2'-O-methoxyethyl sugar modification is located at position 15, 16, 17, 18, 19 and / or 20 of the sequence corresponding to SEQ ID NO:

2.

76. The compound of claim 74, wherein W2 comprises 2'-O-methoxyethyl 5-methylcytidine at position 20 of the sequence corresponding to SEQ ID NO:

2.

77. A compound according to any one of claims 1 to 76, wherein W2 comprises a nucleoside comprising a 2'-O-methyl sugar modification.

78. The compound of claim 77, wherein the 2'-O-methyl sugar modification is located at position 15, 16, 17, 18, 19 and / or 20 of the sequence corresponding to SEQ ID NO:

2.

79. The compound of claim 77, wherein W2 comprises 2'-O-methyl 5-methylcytidine at position 20 of the sequence corresponding to SEQ ID NO:

2.

80. A compound according to any one of claims 1 to 79, wherein W2 comprises a nucleoside comprising a 2'-fluoro sugar modification.

81. A compound according to any one of claims 1 to 80, wherein W2 comprises a nucleoside modified with 2'-fluoro-arabinoic acid (2'-fluoro-ANA).

82. according to the compound described in any one of claim 1 to 81, wherein W2 comprises modified nucleosides, and wherein said modified nucleosides are ethylene glycol nucleic acid (GNA).

83. according to the compound described in any one of claim 1 to 82, wherein W2 comprises modified nucleosides, and wherein said modified nucleosides are locked nucleic acids (LNA).

84. The compound according to claim 83, wherein the LNA is located at position 16, 17, 18, 19 and / or 20 of the sequence corresponding to SEQ ID NO:

2.

85. according to the compound described in any one of claims 1 to 84, wherein at least one internucleoside bond is a phosphodiester bond.

86. according to the compound described in any one of claim 1 to 85, wherein at least one internucleoside bond is a modified internucleoside bond.

87. The compound of claim 86, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

88. A compound according to any one of claims 1 to 86, wherein the oligonucleotide is complementary to a portion of a polynucleotide sequence of the HBV genome.

89. The compound of claim 88, wherein the HBV genome is the genome of HBV GT-A, GT-B, GT-C, GT-D, GT-E, GT-F, GT-G or GT-H.

90. A compound according to claim 88, wherein the oligonucleotide is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a portion of the polynucleotide sequence of SEQ ID NO: SEQ ID NO 3 and any one of 667-674.

91. The compound of claim 88, wherein the oligonucleotide is complementary to the polynucleotide sequence of any one of SEQ ID NOs: 1, 4, and 675-838.

92. A compound according to any one of claims 1 to 91, wherein the oligonucleotide comprises a nucleobase sequence of a sequence corresponding to SEQ ID NO:

2.

93. A compound comprising a modified oligonucleotide of any one of SEQ ID NOs: 11-666, or an oligonucleotide comprising at least 1, 2, 3, 4 or 5 additional modifications to said modified oligonucleotide.

94. A compound comprising a modified oligonucleotide of any one of SEQ ID NOs: 11-666, or an oligonucleotide having at least 70%, at least 80%, at least 90%, at least 95% or at least 99% sequence identity thereto.

95. A pharmaceutical composition comprising a compound or salt thereof according to any one of claims 1 to 94, and at least one pharmaceutically acceptable carrier or diluent.

96. A formulation comprising about 100 mg / mL, 150 mg / mL or 200 mg / mL of a compound comprising a modified oligonucleotide sequence of SEQ ID NO: 456, or an oligonucleotide comprising at least 1, 2, 3, 4 or 5 additional modifications to the modified oligonucleotide sequence.

97. A method of reducing HBV antigen levels in a subject, the method comprising administering to the subject a compound according to any one of claims 1 to 94, a composition according to claim 95, or a formulation according to claim 96.

98. The method of claim 97, wherein the HBV antigen is HBsAg or HBeAg.

99. The method of claim 97, wherein HBeAg levels are reduced.

100. The method of claim 97, wherein HBsAg levels are reduced.

101. The method of claim 97, wherein: wherein the HBsAg level is reduced to at most about 1 / 1.25 of the HBsAg level of a subject administered with a composition comprising the modified oligonucleotide sequence of SEQ ID NO:

10.

102. The method of claim 97, wherein the HBsAg level is reduced by about 1 / 10 to about 1 / 2 of the HBsAg level of a subject administered a composition comprising the modified oligonucleotide sequence of SEQ ID NO:

10.

103. A method of reducing liver toxicity and / or persistence in a subject having HBV, the method comprising administering to the subject a compound according to any one of claims 1 to 94, a composition according to claim 95, or a formulation according to claim 96.

104. The method of claim 103, wherein ALT, ALP and / or AST levels are optionally reduced to at most about 1 / 1.25 of the ALT, ALP and / or AST levels of a subject administered a composition comprising a modified oligonucleotide sequence of SEQ ID NO:

10.

105. A method for preventing, treating, ameliorating or slowing the progression of an HBV-related disease, disorder or condition, the method comprising administering to a subject a compound according to any one of claims 1 to 94, a composition according to claim 95, or a formulation according to claim 96.

106. The method of any one of claims 97 to 105, wherein at least one, at least 2, at least 3, at least 4, or at least 5 doses of the compound, the composition, or the formulation are administered to the subject.

107. The method of any one of claims 97 to 106, wherein the subject is dosed on Day 1, Day 4, and Day 8.

108. The method of claim 107, wherein the subject is dosed once a week after day 8.

109. The method of any one of claims 97 to 108, wherein the subject is dosed on at least day 1, day 4 and day 8, day 15, and day 22.

110. The method of any one of claims 107 to 109, wherein the amount of each dose is substantially the same amount.

111. The method of any one of claims 97 to 110, wherein the dose is about 30 mg to about 600 mg.

112. The method of any one of claims 97 to 110, wherein the dose is about 100 mg to about 500 mg.

113. The method of any one of claims 97 to 110, wherein the dose is about 100 mg, about 150 mg, about 200 mg, about 250 mg, about 300 mg, about 450 mg, or about 500 mg.

114. The method of any one of claims 97 to 113, wherein the administration to the subject is parenteral.

115. The method of any one of claims 97 to 113, wherein the administration to the subject is subcutaneous.

116. The method of any one of claims 97 to 113, wherein the administration to the subject is transdermal.

117. The method of any one of claims 97 to 113, wherein the administration to the subject is intraocular.

118. The method of any one of claims 97 to 113, wherein the administration to the subject is intramuscular.

119. The method of any one of claims 97 to 113, wherein the administration to the subject is intravenous.

120. The method of any one of claims 97 to 115, wherein the method further comprises administering at least a second agent to the subject.

121. The method of any one of claims 97 to 120, wherein the disease, disorder or condition is a liver disease, disorder or condition.

122. The method of claim 121, wherein the disease, disorder or condition is jaundice, liver inflammation, liver fibrosis, inflammation, cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV infection, HBV viremia or liver disease-related transplantation.

123. The method of claim 121, wherein the disease or condition is a hyperproliferative condition.

124. The method of claim 123, wherein the hyperproliferative condition is liver cancer.

125. The method of any one of claims 97 to 120, wherein the disease, disorder or condition is hepatitis delta virus infection (HDV), wherein the subject is co-infected with HBV.

126. The method of any one of claims 97 to 125, wherein the subject is a human.

Images