Molecular breeding method of silkworm variety resistant to pyrethroid pesticides

Abstract

The application discloses a silkworm variety molecular breeding method against pyrethroid pesticides, and adopts a strategy of combining genetic breeding with molecular marker assisted breeding, and has the following advantages: (1) the molecular marker breeding method has the advantages that genetic traits of the silkworm variety of Su Hao and Zhong Ye against pyrethroid pesticides are stable, and the silkworm variety is obtained by combining molecular markers, hybridization, backcrossing, single moth directional breeding and other methods and production practice; (2) the silkworm variety of Su Hao and Zhong Ye against pyrethroid pesticides obtained by the method has obvious economic benefits in subsequent production practice, and the genetic traits are stable; (3) the method can be popularized to the introduction of pyrethroid pesticide resistance traits of other practical silkworm varieties.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology and relates to the introduction of pyrethroid pesticide resistance traits into the silkworm economic variety "Suhao × Zhongye", specifically a molecular breeding method for silkworm varieties resistant to pyrethroid pesticides. Background Technology

[0002] The quality of silkworm cocoons is crucial to their economic value. In the process of breeding silkworm varieties, it is necessary to consider both cocoon quality and the robustness of the silkworms to ensure that the selected varieties have stable economic benefits. In actual production and management, silkworm farmers frequently encounter situations where silkworms fail to spin cocoons due to trace amounts of pesticide poisoning. Pyrethroid insecticides, due to their long residual effect, are one of the main culprits of pesticide pollution in mulberry orchards, leading to silkworms failing to spin cocoons or spinning thin-skinned cocoons.

[0003] Previous research by our group has found that the F7 silkworm variety has extremely high tolerance to pyrethroid insecticides, which is a dominant trait. Compared with conventional varieties, its tolerance to pyrethroid insecticides can reach 100-120 times, making it an ideal material for breeding pyrethroid-resistant silkworm varieties.

[0004] In molecular breeding of plants and animals, marker-assisted breeding (MABB) is widely used due to its ease of operation and short breeding cycle. However, whether MABB can successfully improve varietal traits while preserving the original superior traits is a practical challenge. Furthermore, the selection of molecular markers and the use of specific amplification primers for detecting these markers are crucial for improving the efficiency of MABB. Currently, there are numerous molecular markers associated with desirable traits in model organisms, but very few are actually applied in production, and the stability and reproducibility between different varieties of the same model organism are poor. Summary of the Invention

[0005] Technical problem to be solved: In order to overcome the shortcomings of the existing technology, the present invention adopts a strategy that combines genetic breeding with molecular marker-assisted breeding, and in combination with production practice, obtains the genetically stable silkworm variety "Suhao × Zhongye" with resistance to pyrethroid pesticides through methods such as molecular marker-assisted breeding, hybridization, backcrossing, and single moth directional selection; in view of this, the present invention provides a molecular breeding method for silkworm varieties resistant to pyrethroid pesticides.

[0006] Technical Solution: A molecular breeding method for silkworm varieties resistant to pyrethroid pesticides. The method uses the silkworm variety "Suhao × Zhongye" as the female parent and the silkworm F7 variety as the male parent to obtain the G1 generation through hybridization. Subsequently, through self-pollination, backcrossing, molecular marker screening, and pyrethroid pesticide-directed screening, the pyrethroid pesticide-resistant trait of the silkworm F7 variety is introduced into the female parent "Suhao × Zhongye" to cultivate a silkworm variety resistant to pyrethroid pesticides.

[0007] Preferably, the method specifically includes:

[0008] S1. Using the silkworm variety "Suhao × Zhongye" as the female parent and the silkworm F7 variety as the male parent, the G1 generation was obtained by crossbreeding, and then the silkworms were raised normally.

[0009] S2 and G1 generations were self-pollinated to obtain G2 generation. G2 generation was raised in single-pile enclosures. When the silkworms were in their third instar, they were fed 0.1 mg / L deltamethrin. The surviving individuals continued to be raised. At the same time, 30-40 silkworm eggs were taken from each G2 generation enclosure, and their genomes were extracted. Specific primers for molecular markers against pyrethroid pesticides were used for detection. Enclosures with dominant homozygous molecular markers were selected as G3 generation.

[0010] The S3 and G3 generations were raised using the same method as the G2 generation. The female moths of the G3 generation were mated with the male moths of "Suhao × Zhongye" to produce seeds and obtain the G4 generation.

[0011] S4 and G4 generations were fed normally, and 0.1 mg / L deltamethrin was added to their diet when they were raised from the third instar. They were then backcrossed with the "Suhao × Zhongye" female parent to produce the G5 generation.

[0012] S5 and G5 generations were reared normally. When the silkworms were in their third instar, they were fed 0.1 mg / L deltamethrin. They were then backcrossed with male moths of the "Suhao × Zhongye" line to produce the G6 generation. The G6 generation was reared in the same way as the G5 generation. They were then backcrossed with male moths of the "Suhao × Zhongye" line to produce the G7 generation. The G7 generation was self-pollinated to produce the G8 generation. 30-40 silkworm eggs from each moth enclosure of the G8 generation were taken, and their genomes were extracted. Specific primers for molecular markers of pyrethroid pesticide resistance were used for detection. Moth enclosures with dominant homozygous molecular markers were selected and reared in single-moth areas. When the silkworms were in their third instar, they were fed 0.1 mg / L deltamethrin. Their resistance was evaluated using the method of indirect pesticide supplementation. Rearing areas with excellent resistance were selected. After verifying economic traits, they were self-pollinated to produce the G9 generation. The indirect pesticide supplementation involved randomly selecting a portion of silkworm larvae from the rearing area and feeding them the pesticide.

[0013] In S6 and S5, the G8 and G9 generations were raised by collecting ants from a single moth area in multiple samples. When the silkworms were raised to the third instar, 0.1 mg / L deltamethrin was added to their diet by indirectly adding pesticides to evaluate and identify their ability to resist pyrethroid pesticides, and their economic traits were selected in a targeted manner.

[0014] S7. Through identification and selection in S6, a silkworm variety was obtained that simultaneously possesses the economic traits of the parent silkworm variety "Suhao × Zhongye" and the resistance to pyrethroid pesticides of the F7 silkworm variety.

[0015] Furthermore, the pyrethroid-resistant pesticide molecular marker is SEQ ID NO:1, and its specific amplification primers are SEQ ID NO:2-3. Specifically, the pyrethroid-resistant pesticide molecular marker is the upstream regulatory sequence of the BmCarE-6 gene in the F7 silkworm variety, and SEQ ID NO:1 is as follows:

[0016] TCCATGCACTAATCATAACCACAAGTACCACACGTGGAATCAACTAGTTCTCTATAGCA

[0017] AATAATTTTATTAAATACTAGCTGACCCGGCAGACTTCGTAGTGCCTTAATCTATAAAT

[0018] AAAATACCGAAACTTTTGTACAAAATAAACTTAAAACAAACAAAAGGAATCCGTCCGA

[0019] CGTCCGGGGACACATCAAAGGAAAAACAAAATTGTTATTTTTATTTAATTCCGAGCATT

[0020] TTCATATTTATCTACCTTTTAAACCTTCTCTGGACTTCCACAAATAATTCAAGACCAAA

[0021] ATTAGCCAAATCGGTCCAGCCGTTCTCGAGTTTTAACGAGACTAACGAACAGCAATTC

[0022] ATTTTTATATAGACATTGTTGAATTTTGTTAAAATTTGCACAGTTGTCCAGAGAATA

[0023] TTGAAAAACTGTGTGCTTCGTACGAATTTTTTTTTTTTTACGTTTTCGATAATATATAAG

[0024] TTAGCTGAAATTTGTATGGAGTTGGAACGTTTTCCTACGTTTGCGCTGGGGGTGCTGTT

[0025] CCAACTTTTACATTATCGAGAACTTAAAAAAACTCGCGCTAAGCACACTGGAGACTTG

[0026] AGCATTCGGTTGTTGTTAATGTCTACAATGTCTTTTATAAATCTATCCGAAATATTTTGT

[0027] CTTTCAACGGCCGTCTGGTGTAGTGGTAAGTGACATTGTCACTACCTAAGGGGGTCGCG

[0028] GGTTCGAATCCCGCCAAGGGAAGATATTTGTATGATAAATTAATATAAAATGTCTTTTC

[0029] CAGGGTTATGGATGTATATTAAATATATTATGTATGTGTATAATAAAAATCTTACATTT

[0030] ATTTCCGTTATCCGGTACCTTTAACACAAGTTCTTTACGATATTATCACGGATCAGTT

[0031] AACGTGGCGTGATTGTTAGTAAATATTTATTTATTATTTATTTTACTCTTATCTTTCACA

[0032] CTGAGACGCAGTCCGTTCTAGAATAACTTAGTCATCCGTGACCATGAAACTTGTAATGC

[0033] ATTCGAACCGTCGGAAAAAAGAAAAAAATGGACGTGATATTAAACAGTAAAATGAATTT

[0034] TATTCGATTATAAATTATGAACGCGAATCCGTATGAACGTCGAAAAATAGAACAATTA

[0035] CGAAACTAAAATTCTTAATTACAAATTAAATTAAAACTCCTTAGACTTATCAAGAAATT

[0036] AGAAACATCATTTGAATTAGTTAATTAGAAAATAAACGGAACACGGCATTTTAATTCTT

[0037] AAACATTTCAGTGACATTGCTATAAATATATATATCGACACTTGAAAGGCAAAAGTGA

[0038] CTAAGCGGCAATAACTGATTTGTACATAAATGATAGGCAATAACCATATTAGATGCGC

[0039] AAAAAAATATATTTCTAGGTCTATTAAAATCATTTCAATCCTACAGCTACACTAGAATCTA.

[0040] SEQ ID NO:2 is the forward primer for amplifying the sequence of SEQ ID NO:1, specifically: 5'-TCCATGCACTAATCATAACCA-3'; SEQ ID NO:3 is the reverse primer for amplifying the sequence of SEQ ID NO:1, specifically: 5'-TAGATTCTAGTGTAGCTGTAGGA-3'.

[0041] Furthermore, the pyrethroid-resistant pesticide molecular marker is SEQ ID NO:4, and its specific amplification primers are SEQ ID NO:5-6. Specifically, the pyrethroid-resistant pesticide molecular marker is the upstream regulatory sequence of the BmGST-2 gene in the F7 silkworm variety, and SEQ ID NO:4 is as follows:

[0042] GTGTAGAACAAGGATTCCCCAAGGTGATTGTCCAGAGATCAACTTAATCGAAAATTGA

[0043] TTTTGTGTGTCGACGAGGTCTAAAAATCTGAGGTATCAAATTATTTTGGAAAAGGAGTC

[0044] TTTTACCCAAAATGATTTGGGAATCCCTGATGTCGATTCTACAGACTTTTGGAATTGCT

[0045] TGTGTAGGCTTTAATATTACTGTGCAATGCAGAAACTGACGAACATGTAAATTTGACCA

[0046] TATCATCGTAACGTAGTGTTTATATACATTCTATTTAACTCTCTCGCTTGTTTTACAGAA

[0047] CCGCTGGCTCCAAGTACGTCAATAAAGATTCATTCAGTCAATCAAAATGGAACGTGTA

[0048] GACCGAACGTAGAACATTAAAAATATGTGAAGAAGTGAACCTCACCACTCCAAGATGA

[0049] ATGAACAATAAGAGCAAATTAAAATTACATGTCATAGATAATAAATACATGTATTTTA

[0050] TTTATTGAATGCGTAGATATGTAACGAAATTTTAATAAAAACATGATAACTTCCACTGTAAGTCTGGCCATGCACCTAATATATTCGTCGTTTCAAGGTGTTCGAGTTATCAGTC.

[0051] SEQ ID NO:5 is the forward primer for amplifying the sequence of SEQ ID NO:4, specifically: 5'-GTGTAGAACAAGGATTCCCC-3'; SEQ ID NO:6 is the reverse primer for amplifying the sequence of SEQ ID NO:4, specifically: 5'-GACTGATAACTCGAACACCTT-3'.

[0052] Furthermore, the pyrethroid-resistant pesticide molecular marker is SEQ ID NO:7, and its specific amplification primers are SEQ ID NO:8-9. Specifically, the pyrethroid-resistant pesticide molecular marker is the upstream regulatory sequence of the BmCXE-26 gene in the F7 silkworm variety, and SEQ ID NO:7 is as follows:

[0053] GAAAGAAAACGGAGCTCTAACCTGGGACGATGCTAACACTAGCCCTAGCAAGAGCAG

[0054] CGCTTCTCAGATGAGAACAAAGATACACTGAAAGGCTTTATATACGAATTGCGCTAAC

[0055] AAAATTATGACTAAACATAATCTTCAGCTGTGAAGGCCGGGACAAGAAATGCAGTAAA

[0056] AAAGTACTTAACGCAAAATTGTAAACAGCTTGTATTACAAATTAAAGTTAACCTAAGG

[0057] ATTTTAAATATGCTTGAAGGTCAGTGTAGTAATTAGAACTAAAACGCGAGAAGTAGAC

[0058] GTGTGTGTAATATTGTGTAAAACTATAAAAAATAAAGAAACTTATCAGACATTGTCCG

[0059] AGACTAGGTAAAAGTAACGTTATCTATATATAAATTATCGTGACCTTCGTTTGTATCAA

[0060] CGTGACTAAATTGATCGCTTGACTTTTAAATGCGAGTTAAGTTCATTGCATTTCAAATG

[0061] CAAAGTACCTTAATTGTTTTGTAATAATTACATATTTTTACTGTTTTTTTATTGCTTAGA

[0062] TGAGTGGATGAGCTCACAGCCCACCTGGTGTTAAGTGGTCACTGGAGGCCCATAGACAT

[0063] CTACAACATAAATGCGCCACCCCACCCACCATCAATGTTCATTTGCATTTTTCCTTGTTTG

[0064] TCCTCTGCTTTGTGAGGACTCTCGGTTGGATTTAAAAGAAAGGGTTTAACATAGTACCA

[0065] TCAACTGATGACGCGCGAGTACTTTGAAGAAATCGATGTTTTTCTTACGATTAGCGTTG

[0066] ATCTTATCGGAGTGAGGATCTCACTATTTTTTTTATATTATACATAAACAATAAACTAG

[0067] ATAAAAAACGTCTATCACCCTACATTTATAATATTTGGTAGCCAATACTTTTAAGAGTC

[0068] AGACTTTGTTCAGGTGCACATTTTTAATGAAGTACCTTAACGTCATATTGTTTTATAATT

[0069] TACTATCTACTTCGGTTCCGGTCCAAAGAGTAATACAAAAGCTATTGAGTATATCTTAT

[0070] ACCTCAAGGTGGAAAATAGTACTCACGGTACATTAACAAAAAAATATTTCATATTTGA

[0071] TTCGTTTATCCGTTGTTCTTAAAATTTAACAAAACTGTCTCAGAACATATTGGCCAACTT

[0072] GATCTGAGACCTTGATCAACATTACGTTACAACGAACTAGTATCTTCTGCTAAATTTGG

[0073] CAGATATTACCAACATGTCATTTACAATTTTACAATGTCAAGATCAAGAAACTACCGTTTGGCAAATAACCAATTGATCAAAATCCAGTACACCGTTTGAAAAGCGAATC.

[0074] SEQ ID NO:8 is the forward primer for amplifying the sequence of SEQ ID NO:7, specifically: 5'-GAAAGAAAACGGAGCTCTAAC-3'; SEQ ID NO:9 is the reverse primer for amplifying the sequence of SEQ ID NO:7, specifically: 5'-GATTCGCTTTTCAAACGGTG-3'.

[0075] Furthermore, the pyrethroid-resistant pesticide molecular marker is SEQ ID NO:10, and its specific amplification primers are SEQ ID NO:11-12. Specifically, the pyrethroid-resistant pesticide molecular marker is the upstream regulatory sequence of the BmCYP4C1 gene in the F7 silkworm variety, and SEQ ID NO:10 is as follows:

[0076] TTAACAGTTTCACAGGCGATGTACAGGCCTTTAGTCTTAACAGTAAGCCTCTGATACGC

[0077] CCTTTTCGGTTGCCACTTGGAGGTTGCATCGCCGACTCTTAGGGCCCGCGTTCAGTCAG

[0078] CGGGTGCTCAATGGTTTCATCAGTGCTTTCAACTGCAAGTCGAGGGCGCTCGTCACCCA

[0079] GCTGGAGGACCGGGTCGGGCGAGGGCCTTTCGACCACGTCCCCTACCTGTCCTTCAAT

[0080] AACTTGGAAACTATATGTCGTGAGTATTCATGTTTTTTTTTATTGCTTAGATGAGCGTTC

[0081] AAGCTCATAGCTCACCTGGTGTTAAGTGGTTACTGGAGCCCATAGACATTTACAACGTA

[0082] CCACCCACCTTGAGATGTAAGTTGTAAGGTCTCAGTATAGTTACAACGGCTGCCCCACC

[0083] CTTCGAACCGAAACGCATTACTGCTTCACGGCAGAAACAGGCATGGTGGTGGTACCCA

[0084] CCCGCGCGGACTCACATGAGGTCCCACCACCATGCGCGGCGCTCTCTCGCAGCTTTTTC

[0085] AATTCAGTGCAGTATTGCAGCTATGTTCGTTCGCGTTAAGAATGCAGTTAATTATCATT

[0086] GTTCGCCGCCTCCTAACCAATCAAATCTTTTCAAATTACAAGGTCAAGTTCACAGTGAC

[0087] CAGTTGAAAGCACAGCTTCGAACGCGACGGTTGTGTCCTATAATTGTGTTAACTGATTT

[0088] ATATTTAAAAAAATGAATACCTCACCAATTCGTAAAAATAAAAGTGGTTCGTAATTCA

[0089] CAGTGGGGCAGAAAAGTTACAATGTTTTAAAGTATTTTAAACAGTCTGATTTAAATGTG

[0090] ACTGTGGACAGCATAGGACAAATATTTTATAACGCAATTTGGTTAGCGCTGATCGATG

[0091] GAAGAAATGCCGCGAACCACGTCTTGCAAGAAGAAAATACCATGTGGTGTTTAGATGA

[0092] TGTCATGGAACTCGCTAGTCGGCATCGATGCGCATTTCGACAAAGCGGCACGACACG

[0093] AGAGCCCTTCCATCGTGGCCGTCGGTAACTACATTCCCGATCCTACGGACAGAATGGA

[0094] AAGCAGTCGATGTCGCCCAAAACACGTCATTTCGGATCCTCCCGATCCAATAACGGGG

[0095] CTTTTAGGTACCTCAAGCACCGGTTACCGTTCTCGTCGAACCCGTGCCTTGCGACGAAG

[0096] GGCTCGACGAGTAAATTAACCCTCAGACACAGCCCACTGCGTTTCTCGCCGGATCTTTCT

[0097] CAGTGGGTCGCGTTGCCGGTCCAGTGGTAGATTCTGCGAAGCACTGCTCTTGCTAGGGT

[0098] TCGTGTTAGCAACGTCATCAGGTTTGAGCCCCGCGAGCTCACCTACTAGTTAAGGTTCC

[0099] GCTGGTATAGCCTCTCAAGGCTATCAGCTTAGGTAGGAAAAAAAAGAAAAACTCTTGTG

[0100] CAGAAAATTAATTTATTATAAATACTAACGAGGACACTTTAAGCTCATTAAACTTAATC

[0101] TTTAAGAATATAATTGTTTCAATGTTCACACCACTGTGAAAACACCTTTACCCTTCAGTTGC。

[0102] SEQ ID NO:11 is the forward primer for amplifying the sequence of SEQ ID NO:10, specifically: 5'-TTAACAGTTTCACAGGCGAT-3'; SEQ ID NO:12 is the reverse primer for amplifying the sequence of SEQ ID NO:10, specifically: 5'-GCAACTGAAGGGTAAAGGTG-3'.

[0103] Beneficial effects: (1) The molecular marker breeding method described in this invention, combined with production practice, obtains a silkworm variety with stable genetic traits and resistance to pyrethroid pesticides, namely “Suhao × Zhongye”, through molecular markers, hybridization, backcrossing, and single-moth directional selection; (2) The “Suhao × Zhongye” silkworm variety with pyrethroid pesticide resistance bred by the method described in this invention has significantly increased economic benefits in subsequent production practice, and its genetic traits are stable; (3) The method described in this invention can be extended to the introduction of pyrethroid pesticide resistance traits into other practical silkworm varieties. Attached Figure Description

[0104] Figure 1 This is a flowchart of the molecular breeding method for silkworm varieties resistant to pyrethroid pesticides as described in this invention.

[0105] Figure 2 This is an electrophoretic image of the form in which the molecular marker SEQ ID NO:1 for resisting pyrethroid pesticides exists in silkworm varieties F7 and Dazao; where M is the DL2000 Marker, 1 is F7, and 2 is Dazao.

[0106] Figure 3 This is an electrophoresis image of the form of the pyrethroid pesticide-resistant molecular marker SEQ ID NO:1 in the "Suhao × Zhongye" variety after the introduction of F7 bloodline; where M is DL2000 Marker, 1 is F7, 2 is the Chinese maternal line 1 of "Suhao × Zhongye" with the introduction of F7 bloodline, 3 is the Chinese maternal line 2 of "Suhao × Zhongye" with the introduction of F7 bloodline, 4 is the Japanese maternal line 1 of "Suhao × Zhongye" with the introduction of F7 bloodline, and 5 is the Japanese maternal line 2 of "Suhao × Zhongye" with the introduction of F7 bloodline.

[0107] Figure 4 This is an electrophoresis image of the molecular marker SEQ ID NO:1 for pyrethroid pesticides in F7 and “Suhao × Zhongye”; where M is DL2000 Marker, 1 is F7, 2 is the Chinese maternal species 1 of “Suhao × Zhongye”, 3 is the Chinese maternal species 2 of “Suhao × Zhongye”, 4 is the Japanese maternal species 1 of “Suhao × Zhongye”, and 5 is the Japanese maternal species 2 of “Suhao × Zhongye”.

[0108] Figure 5This is the screening result of the G3 generation molecular marker SEQ ID NO:1; where the red-marked area represents the dominant homozygous offspring.

[0109] Figure 6 This is the screening result of the G8 generation molecular marker SEQ ID NO:1; where the red-marked area represents the dominant homozygous offspring.

[0110] Figure 7 This is an electrophoretic image of the form in which the molecular marker SEQ ID NO:4 for pyrethroid insecticides exists in silkworm F7 and Dazao varieties; where M is the DL2000 Marker, 1 is F7, and 2 is Dazao.

[0111] Figure 8 This is an electrophoresis image of the pyrethroid insecticide molecular marker SEQ ID NO:4 in the "Soho × Zhongye" variety after the introduction of F7 bloodline; where M is DL2000 Marker, 1 is F7, 2 is the Chinese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, 3 is the Chinese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline, 4 is the Japanese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, and 5 is the Japanese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline.

[0112] Figure 9 This is an electrophoretic image of the form in which the molecular marker SEQ ID NO:7 for pyrethroid insecticides exists in the F7 and Dazao silkworm varieties; where M is the DL2000 Marker, 1 is F7, and 2 is Dazao.

[0113] Figure 10 This is an electrophoresis image of the pyrethroid insecticide molecular marker SEQ ID NO:7 in the "Soho × Zhongye" variety after the introduction of F7 bloodline; where M is the DL2000 Marker, 1 is F7, 2 is the Chinese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, 3 is the Chinese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline, 4 is the Japanese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, and 5 is the Japanese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline.

[0114] Figure 11 This is an electrophoretic image of the form in which the molecular marker SEQ ID NO:10 for pyrethroid insecticides exists in silkworm F7 and Dazao varieties; where M is the DL2000 Marker, 1 is F7, and 2 is Dazao.

[0115] Figure 12This is an electrophoresis image of the pyrethroid insecticide molecular marker SEQ ID NO:10 in the "Soho × Zhongye" variety after the introduction of F7 bloodline; where M is DL2000 Marker, 1 is F7, 2 is the Chinese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, 3 is the Chinese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline, 4 is the Japanese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, and 5 is the Japanese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline. Detailed Implementation

[0116] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Modifications and substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are all within the scope of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0117] Example 1: Identification and application of the molecular marker SEQ ID NO:1 for pyrethroid pesticide resistance in silkworm F7 variety

[0118] In the F7 silkworm variety, the expression of the BmCarE-6 gene was significantly upregulated by feeding it 0.1 mg / L deltamethrin (dried leaf method). Therefore, the upstream regulatory sequence of the BmCarE-6 gene in the F7 silkworm variety (SEQ ID NO:1) was cloned and analyzed. The specific amplification primers were SEQ ID NO:2-3. Using the F7 silkworm egg genome as the amplification template, the PCR reaction conditions were: 94℃ pre-denaturation for 4 min, followed by 94℃ denaturation for 40 s, 58℃ annealing for 40 s, and 72℃ extension for 1 min 40 s, for a total of 35 cycles, and a final extension at 72℃ for 10 min. The PCR product was recovered and ligated into the pMD19-T vector according to the TA cloning method, and then transformed into DH5α competent cells according to the procedure. Positive clones verified by bacterial PCR were sent to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing. The upstream regulatory sequence (1414 bp) of BmCarE-6 in the F7 silkworm variety was obtained by sequencing. Bioinformatics analysis showed that the upstream regulatory sequence of the silkworm F7 variety BmCarE-6 had a continuous deletion of 683 bp compared with that of the Dazao variety. Figure 2 Analysis of the pyrethroid insecticide resistance mechanism in silkworm F7 revealed that F7 silkworms develop resistance to pyrethroid insecticides through the upregulation of detoxification enzyme genes, and this resistance is dominantly inherited. Therefore, the upstream regulatory sequence of the silkworm F7 variety BmCarE-6 is suitable as a molecular marker for resistance breeding.

[0119] The pyrethroid insecticide resistance of the F7 silkworm variety was introduced into the maternal parent of the economically important silkworm variety "Suhao × Zhongye" through hybridization. Molecular biological analysis of the hybrid silkworm eggs showed that all genomic molecular markers existed in heterozygous form (i.e., both complete large fragments and missing small fragments). Figure 3 In the original work of "Su Hao × Zhong Ye", it exists as a complete large fragment. Figure 4 ).

[0120] Example 2: Molecular breeding method for silkworm varieties resistant to pyrethroid pesticides

[0121] like Figure 1 As shown, the method includes the following steps:

[0122] S1. Using the silkworm variety "Suhao × Zhongye" as the female parent and the silkworm F7 variety as the male parent, the G1 generation was obtained by crossbreeding, and then the silkworms were raised normally.

[0123] S2 and G1 generations were self-pollinated to obtain G2 generation. G2 generation was raised in single-pile enclosures. When the silkworms were in their third instar, they were fed 0.1 mg / L deltamethrin. The surviving individuals continued to be raised. At the same time, 30-40 silkworm eggs were taken from each G2 generation enclosure, and their genomes were extracted. Specific primers for molecular markers against pyrethroid pesticides were used for detection. Enclosures with dominant homozygous molecular markers were selected as G3 generation.

[0124] The S3 and G3 generations were raised using the same method as the G2 generation. The female moths of the G3 generation were mated with the male moths of "Suhao × Zhongye" to produce seeds and obtain the G4 generation.

[0125] S4 and G4 generations were fed normally, and 0.1 mg / L deltamethrin was added to their diet when they were raised from the third instar. They were then backcrossed with the "Suhao × Zhongye" female parent to produce the G5 generation.

[0126] S5 and G5 generations were raised normally. When the silkworms were raised from the third instar, 0.1 mg / L deltamethrin was added to their diet. They were then backcrossed with male moths of "Suhao × Zhongye" to produce the G6 generation. The G6 generation was raised in the same way as the G5 generation. They were then backcrossed with male moths of "Suhao × Zhongye" to produce the G7 generation. The G7 generation was self-pollinated to produce the G8 generation. 30-40 silkworm eggs were taken from each moth enclosure of the G8 generation, and their genomes were extracted. Specific primers for molecular markers of pyrethroid pesticide resistance were used for detection. Moth enclosures with dominant homozygous molecular markers were selected and raised in single-moth areas. When the silkworms were raised from the third instar, 0.1 mg / L deltamethrin was added to their diet. Their resistance was evaluated using the method of indirect pesticide addition (taking a portion of silkworms from the rearing area and adding pesticide). Rearing areas with excellent resistance were selected. After verifying economic traits, they were self-pollinated to produce the G9 generation.

[0127] In S6 and S5, the G8 and G9 generations were raised by collecting ants from a single moth area in multiple samples. When the silkworms were raised to the third instar, 0.1 mg / L deltamethrin was added to their diet by indirectly adding pesticides to evaluate and identify their ability to resist pyrethroid pesticides, and their economic traits were selected in a targeted manner.

[0128] S7. Through identification and selection in S6, a silkworm variety was obtained that simultaneously possesses the economic traits of the parent silkworm variety "Suhao × Zhongye" and the resistance to pyrethroid pesticides of the F7 silkworm variety.

[0129] The molecular marker for the antipyretic pesticide is SEQ ID NO:1, and its specific amplification primers are SEQ ID NO:2-3.

[0130] Example 3: Identification and application of the molecular marker SEQ ID NO:4 for pyrethroid pesticide resistance in silkworm F7 variety

[0131] The difference from Example 1 is that the molecular marker for pyrethroid pesticide resistance is the upstream regulatory sequence of the BmGST-2 gene (SEQ ID NO:4), and the specific primers for amplifying this upstream regulatory sequence are SEQ ID NO:5-6. The experimental results of this example are as follows: Figure 7-8 As shown.

[0132] Example 4

[0133] The difference from Example 2 is that the molecular marker of the antipyretic insecticide is SEQ ID NO:4, and its specific amplification primers are SEQ ID NO:5-6.

[0134] Example 5: Identification and application of the molecular marker SEQ ID NO:7 for pyrethroid pesticide resistance in silkworm F7 variety

[0135] The difference from Example 1 is that the molecular marker for pyrethroid pesticide resistance is the upstream regulatory sequence of the BmCXE-26 gene (SEQ ID NO:7), and the specific primers for amplifying this upstream regulatory sequence are SEQ ID NO:8-9. The experimental results of this example are as follows: Figure 9-10 As shown.

[0136] Example 6

[0137] The difference from Example 2 is that the molecular marker of the antipyretic pesticide is SEQ ID NO:7, and its specific amplification primers are SEQ ID NO:8-9.

[0138] Example 7: Identification and application of the molecular marker SEQ ID NO:10 for pyrethroid pesticide resistance in silkworm F7 variety

[0139] The difference from Example 1 is that the molecular marker for the pyrethroid insecticide is the upstream regulatory sequence of the BmCYP4C1 gene (SEQ ID NO:10), and the specific primers for amplifying this upstream regulatory sequence are SEQ ID NO:11-12. The experimental results of this example are as follows: Figure 11-12 As shown.

[0140] Example 8

[0141] The difference from Example 2 is that the molecular marker of the antipyretic insecticide is SEQ ID NO:10, and its specific amplification primers are SEQ ID NO:11-12.

[0142] Example 9

[0143] After raising the G10 generation, we investigated its resistance to pyrethroid pesticides and its practical economic traits. F7 and “Suhao × Zhongye” were used as control groups. The results are shown in Table 1-2.

[0144] Table 1. Results of the Economic Traits Survey of Generation G10

[0145]

[0146] Table 2 Results of the resistance survey to G10 generation deltamethrin pesticide

[0147]

Claims

1. A molecular breeding method for silkworm varieties resistant to pyrethroid pesticides, characterized in that, The method uses the silkworm variety "Suhao × Zhongye" as the female parent and the silkworm F7 variety as the male parent to obtain the G1 generation through hybridization. Then, through self-pollination, backcrossing, molecular marker screening and pyrethroid pesticide-oriented screening, the pyrethroid pesticide resistance trait of the silkworm F7 variety is introduced into the female parent "Suhao × Zhongye" to cultivate a silkworm variety with pyrethroid pesticide resistance. The method is specifically as follows: S1. Using the silkworm variety "Suhao × Zhongye" as the female parent and the silkworm F7 variety as the male parent, the G1 generation was obtained by crossbreeding, and then the silkworms were raised normally. S2 and G1 generations were self-pollinated to obtain G2 generation. G2 generation was raised in single-pile enclosures. When the silkworms were in their third instar, they were fed 0.1 mg / L deltamethrin. The surviving individuals continued to be raised. At the same time, 30-40 silkworm eggs were taken from each G2 generation enclosure, and their genomes were extracted. Specific primers for molecular markers against pyrethroid pesticides were used for detection. Enclosures with dominant homozygous molecular markers were selected as G3 generation. The S3 and G3 generations were raised using the same method as the G2 generation. The female moths of the G3 generation were mated with the male moths of "Suhao × Zhongye" to produce seeds and obtain the G4 generation. S4 and G4 generations were fed normally. When the silkworms were raised from the third instar, 0.1 mg / L deltamethrin was added to their diet. They were then backcrossed with the "Suhao × Zhongye" female parent to produce the G5 generation. S5 and G5 generations were raised normally. When the silkworms were raised from the third instar, 0.1 mg / L deltamethrin was added to their diet. They were then backcrossed with male moths of the "Suhao × Zhongye" line to produce the G6 generation. The G6 generation was raised in the same way as the G5 generation. They were then backcrossed with male moths of the "Suhao × Zhongye" line to produce the G7 generation. The G7 generation was self-pollinated to produce the G8 generation. 30-40 silkworm eggs were taken from each moth enclosure of the G8 generation, and their genomes were extracted. Specific primers for molecular markers of pyrethroid pesticide resistance were used for detection. Moth enclosures with dominant homozygous molecular markers were selected and raised in single-moth areas. When the silkworms were raised from the third instar, 0.1 mg / L deltamethrin was added to their diet. Their resistance was evaluated using the method of indirect pesticide addition. Areas with excellent resistance were selected. After verifying economic traits, they were self-pollinated to produce the G9 generation. In S6 and S5, the G8 and G9 generations were raised by collecting ants from a single moth area in multiple samples. When the silkworms were raised to the third instar, 0.1 mg / L deltamethrin was added to their diet by indirectly adding pesticides to evaluate and identify their ability to resist pyrethroid pesticides, and their economic traits were selected in a targeted manner. S7, through identification and selection in S6, obtained a silkworm variety that simultaneously possesses the economic traits of the parent silkworm variety "Suhao × Zhongye" and the resistance to pyrethroid pesticides of the F7 silkworm variety.

2. The molecular breeding method for silkworm varieties resistant to pyrethroid pesticides according to claim 1, characterized in that, The molecular marker for the antipyretic pesticide is SEQ ID NO:1, and its specific amplification primers are SEQ ID NO:2-3.

3. The molecular breeding method for silkworm varieties resistant to pyrethroid pesticides according to claim 1, characterized in that, The molecular marker for the antipyretic pesticide is SEQ ID NO:4, and its specific amplification primers are SEQ ID NO:5-6.

4. The molecular breeding method for silkworm varieties resistant to pyrethroid pesticides according to claim 1, characterized in that, The molecular marker for the antipyretic pesticide is SEQ ID NO:7, and its specific amplification primers are SEQ ID NO:8-9.

5. The molecular breeding method for silkworm varieties resistant to pyrethroid pesticides according to claim 1, characterized in that, The molecular marker for the antipyretic pesticide is SEQ ID NO:10, and its specific amplification primers are SEQ ID NO:11-12.

Images