Application of deubiquitinase inhibitors and nucleic acid molecules in the preparation of drugs for treating autoimmune disorders

Abstract

The present invention discloses the use of deubiquitinase inhibitors and nucleic acid molecules in the preparation of drugs for treating autoimmune disorders, and relates to the field of biomedicine technology. The present invention provides a drug for treating autoimmune disorders, which inhibits the activity of ubiquitinase USP8 by deubiquitinase USP8 inhibitors, degrades MDA5, and thus inhibits antiviral signal transduction and autoimmunity. Inhibition of USP8 by small molecule inhibitors can significantly prolong the survival of mice; in PBMC cells of MDA5-positive dermatomyositis patients, inhibition of USP8 by small molecule inhibitors can significantly inhibit interferon response. Therefore, deubiquitinase inhibitors, nucleic acid molecules, recombinant vectors, and recombinant cells have good application prospects in the treatment of autoimmune disorders.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the use of deubiquitinase inhibitors and nucleic acid molecules in the preparation of drugs for treating autoimmune disorders. Background Art

[0002] Dysregulation of MDA5 can lead to excessive IFN signaling, which in turn triggers autoimmune diseases. Approximately 30 different gain-of-function mutations in the gene IFIH1 encoding MDA5 have been associated with human autoimmune diseases such as AGS, SMS, systemic lupus erythematosus, dermatomyositis, and type 1 diabetes. Known MDA5 mutations can be divided into three categories based on their position in the MDA5 pathogenicity spectrum: RNA binding domain mutations, ATP binding site mutations, and binding site mutations outside of the two. Mutations in the RNA binding domain break immune tolerance by reducing the RNA specificity recognized by MDA5 and stabilizing MDA5-dsRNA fibers (Ahmad et al., 2018; Oda et al., 2014; Rice et al., 2014). In two other cases, the result was a conformational change in MDA5 that limited ATP hydrolysis and ATPase-dependent dissociation from endogenous RNA, while increasing IFNβ transcription (Funabiki et al., 2014; Todd, 2014; Yu et al., 2018). Surprisingly, mice with a mutant of MDA5 with a substitution of glycine for serine at position 821 (G821S) spontaneously developed lupus-like nephritis and systemic autoimmune symptoms even in the absence of viral infection (Funabiki et al., 2014), suggesting that treatment of MDA5-mediated autoimmune diseases is complex and difficult.

[0003] Currently, autoimmune diseases associated with MDA5 dysregulation, such as anti-MDA5-positive dermatomyositis (MDA5+ DM), are autoimmune diseases that are prone to rapidly progressive interstitial lung disease and have a very high mortality rate. Although the etiology and pathogenesis remain unclear, there is increasing evidence that viral infection is a potential trigger for MDA5+ DM (Lu et al., 2024). In East Asia, especially in Japan and China, about 40% of MDA5+ DM patients develop life-threatening rapidly progressive interstitial lung disease (Ye et al., 2022). Due to the lack of specific targets, the current treatment for MDA5+ DM is mainly empirical therapy. Immunosuppressive therapy, including triple therapy (high-dose glucocorticoids, tacrolimus, and intravenous cyclophosphamide) and Janus kinase inhibitor-based therapy, is currently the mainstream treatment for MDA5+ DM, which can significantly improve the survival rate of early patients (Chen et al., 2019). However, the overall mortality rate of advanced patients who are refractory to conventional immunosuppressive therapy remains high, with a one-year mortality rate of up to 50% (Ye et al., 2022). Therefore, in the category of idiopathic inflammatory myopathy (IIM), MDA5+ DM represents the most severe subtype, posing a severe challenge to clinical practice.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The purpose of the present invention is to provide the use of deubiquitinase inhibitors and nucleic acid molecules in the preparation of drugs for treating autoimmune disorders to solve the above technical problems.

[0006] The present invention is achieved in that:

[0007] In a first aspect, the present invention provides a use of a deubiquitinase inhibitor in the preparation of a drug for treating autoimmune disorders.

[0008] In a second aspect, the present invention also provides a use of a nucleic acid molecule in the preparation of a drug or reagent for treating an autoimmune disorder, wherein the nucleic acid molecule reduces the expression of USP8 protein and / or inhibits the level of RNA encoding USP8.

[0009] In a third aspect, the present invention also provides a use of a recombinant vector in the preparation of a drug or reagent for treating an autoimmune disorder, wherein the recombinant vector comprises the above-mentioned nucleic acid molecule.

[0010] In a fourth aspect, the present invention further provides a use of a recombinant cell in the preparation of a drug or reagent for treating an autoimmune disorder, wherein the recombinant cell comprises the above-mentioned nucleic acid molecule or the above-mentioned recombinant vector.

[0011] In a fifth aspect, the present invention also provides a use of a deubiquitinase inhibitor in the preparation of a drug for combined treatment of autoimmune disorders.

[0012] The present invention has the following beneficial effects:

[0013] The present invention provides a drug for treating autoimmune disorders. The activity of ubiquitinase USP8 (Ubiquitin-specific protease 8, or UBPY) is inhibited by a deubiquitinase USP8 inhibitor, and the target protein cannot be deubiquitinated, so that the isopeptide bond between ubiquitin and the target protein or between ubiquitin molecules can be maintained, and MDA5 is degraded, thereby inhibiting antiviral signal transduction and autoimmunity. Experiments have confirmed that inhibiting USP8 by small molecule inhibitors or gene knockout can significantly downregulate the expression of MDA5 protein. In a mouse model simulating human AGS disease, inhibiting USP8 by small molecule inhibitors can significantly prolong the survival of mice; in PBMC cells of MDA5-positive dermatomyositis patients, inhibiting USP8 by small molecule inhibitors can significantly inhibit the interferon response. Inhibiting USP8 can effectively inhibit the autoimmunity induced by MDA5 in AGS mice and cells of MDA5+ dermatomyositis (DM) or systemic lupus erythematosus (SLE) patients. Therefore, USP8 is expected to become a new therapeutic target for autoimmune disorders, and deubiquitinase inhibitors, nucleic acid molecules, recombinant vectors, and recombinant cells have good application prospects in the treatment of autoimmune disorders. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0015] Figure 1 The results of the experiment show the effect of inhibiting or knocking out USP8 on the interferon response induced by MDA5 in various cells;

[0016] Figure 2 This is the experimental result diagram of the effect of inhibiting USP8 in cells on the expression of MDA5 function-enhanced mutant G821S protein;

[0017] Figure 3 This is a graph showing the experimental results of the effect of USP8 inhibitor on the survival of mice in a mouse model simulating human AGS disease;

[0018] Figure 4This is the experimental result of the response of USP8 inhibitor to interferon in PBMC cells of patients with MDA5-positive dermatomyositis;

[0019] Figure 5 Figure 2 shows the experimental results of the effect of USP8 on the ubiquitination of other IFIH1 mutations associated with pathogenic heterozygous mutations (such as R337G, M854K, A946T and I956V). DETAILED DESCRIPTION

[0020] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0021] The term "includes / comprising" is generally used in an inclusive / comprising sense, that is, allowing the presence of one or more features or components.

[0022] As used herein, "at least one" means "one or more," "two or more," "three or more," etc.

[0023] As used herein, the terms "subject" / "subject in need" or "patient" / "patient in need" are recognized in the art and are used interchangeably herein to refer to mammals, including dogs, cats, rats, mice, monkeys, cows, horses, goats, sheep, pigs, camels, and most preferably humans. In some cases, the subject is a subject in need of treatment or a subject suffering from a disease or condition. However, in other aspects, the subject can be a normal subject. The term does not indicate a particular age or sex. Therefore, it is intended to cover adult and neonatal subjects, whether male or female. Preferably, the subject is a human. Most preferably, a human suffering from an autoimmune disease or a human who may be at risk of suffering from an autoimmune disease.

[0024] The terms "nucleic acid", "polynucleotide" and "oligonucleotide" are used interchangeably and refer to any type of deoxyribonucleotide (e.g., DNA, cDNA ...) or ribonucleotide (e.g., RNA, mRNA, ...) polymer or a combination of deoxyribonucleotide and ribonucleotide (e.g., DNA / RNA) polymers, in linear or circular conformation, and in single-stranded or double-stranded form. These terms should not be interpreted as limiting the length of the polymer, and may encompass known analogs of natural nucleotides, as well as nucleotides modified in the base, sugar and / or phosphate moieties (e.g., phosphorothioate backbones). Typically, analogs of a particular nucleotide have the same base pairing specificity, i.e., an analog of A will base pair with T.

[0025] As used herein, the term "vector" refers to a viral vector or a nucleic acid (DNA or RNA) molecule, such as a plasmid or other vector, which contains one or more heterologous nucleic acid sequences of the present invention and, preferably, is designed for transfer between different host cells. The terms "expression vector", "gene delivery vector" and "gene therapy vector" refer to any vector that effectively incorporates and expresses one or more nucleic acids of the present invention in a cell. A cloning or expression vector may contain additional elements, for example, regulatory and / or post-transcriptional regulatory elements in addition to a promoter.

[0026] As used herein, a "chemical agent" is a compound that changes due to its chemical composition and its effect on living tissues and organisms. The chemical agent can be a small molecule inhibitor (SMI), a nucleic acid, a siRNA, or a peptide.

[0027] The terms "microRNA," "miRNA," and "MiR" are interchangeable and refer to endogenous or artificial non-coding RNAs that are capable of regulating gene expression. It is believed that miRNAs act through RNA interference. The design of such microRNAs is within the skill of the ordinary technician.

[0028] The terms "siRNA" and "short interfering RNA" are interchangeable and refer to single-stranded or double-stranded RNA molecules capable of inducing RNA interference. siRNA molecules typically have a duplex region between 18 and 30 base pairs in length. The design of such siRNAs is within the skill of the ordinary technician.

[0029] The terms "piRNA" and "Piwi-interacting RNA" are interchangeable and refer to a class of small RNAs involved in gene silencing. PiRNA molecules are typically between 26 and 31 nucleotides in length. The design of such PiRNAs is within the skill of an ordinary technician. Examples of modified antisense oligonucleotides (ASOs) include GapmeR. GapmeR is a chimeric antisense oligonucleotide that contains a central block of deoxynucleotide monomers that is long enough to induce RNaseH cleavage.

[0030] The terms "sgRNA" and "guideRNA" are interchangeable and refer to a specific RNA sequence that recognizes a target DNA region and guides an endonuclease to make edits there. The gRNA typically consists of two parts: crisprRNA (crRNA), a 17-20 nucleotide sequence complementary to the target DNA, and tracrRNA, which serves as a scaffold for the Cas nuclease to bind.

[0031] Any suitable engineered sgRNA, or crRNA and tracrRNA can be used, as long as it is effective for recognizing the target DNA of the present invention. The design of such sgRNA or crRNA and tracrRNA is within the skill of ordinary technicians.

[0032] The terms "snRNA" and "small nuclear RNA" are interchangeable and refer to a class of small RNAs involved in various processes, including RNA splicing and regulation of transcription factors. Also included are subclasses of small nucleolar RNAs (snoRNAs). The term is also intended to include artificial snRNAs, such as antisense derivatives of snRNAs. The design of such snRNAs is within the skill of the ordinary technician.

[0033] In a first aspect, the present invention provides a use of a deubiquitinase inhibitor in the preparation of a drug for treating autoimmune disorders.

[0034] The present invention provides a drug for treating autoimmune disorders. The activity of ubiquitinase USP8 (Ubiquitin-specific protease 8, or UBPY) is inhibited by a deubiquitinase USP8 inhibitor, and the target protein cannot be deubiquitinated in the target cell, so that the isopeptide bond between ubiquitin and the target protein or between ubiquitin molecules can be maintained, and MDA5 is degraded, thereby inhibiting antiviral signal transduction and autoimmunity. Experiments have confirmed that inhibiting USP8 by small molecule inhibitors or gene knockout can significantly downregulate the expression of MDA5 protein. In a mouse model simulating human AGS disease, inhibiting USP8 by small molecule inhibitors can significantly prolong the survival of mice; in PBMC cells of MDA5-positive dermatomyositis patients, inhibiting USP8 by small molecule inhibitors can significantly inhibit the interferon response. Inhibiting USP8 can effectively inhibit the autoimmunity induced by MDA5 in AGS mice and cells of MDA5+ dermatomyositis (DM) or systemic lupus erythematosus (SLE) patients. Therefore, USP8 is expected to become a new therapeutic target for autoimmune disorders, and deubiquitinase inhibitors have good application prospects in the treatment of autoimmune disorders.

[0035] In a preferred embodiment of the present invention, the deubiquitinase inhibitor is selected from DUBs-IN-2 (U8IN), GEN-6776, AZ1, compounds represented by the following formula I to formula IV, and pharmaceutically acceptable salts thereof:

[0036] Formula I: , Formula II: , Formula III , Formula IV The preparation method of the compounds represented by Formula I to Formula IV is shown in patent CN201911297842.7.

[0037] GEN-6776, CAS number: 2009273-71-4; AZ1, CAS number: 2165322-94-9; DUBs-IN-2, CAS number: 924296-19-5.

[0038] Since the dysregulation of MDA5 can lead to excessive enhancement of IFN signaling, which in turn triggers autoimmune diseases, there are about 30 different gain-of-function mutations in the gene IFIH1 encoding MDA5 that are associated with human autoimmune diseases, such as AGS, SMS, systemic lupus erythematosus, dermatomyositis, and type 1 diabetes. Therefore, deubiquitinase inhibitors can be expected to have therapeutic effects on a variety of autoimmune diseases associated with the dysregulation of MDA5.

[0039] In a preferred embodiment of the present invention, autoimmune disorders include but are not limited to idiopathic inflammatory myopathy, type 1 diabetes, AGS, SMS, lupus erythematosus, Crohn's disease, ulcerative colitis, dermatitis, Goodpasture's syndrome, Graves' disease, Guillain-Barre syndrome (GBS), autoimmune encephalomyelitis, Hashimoto's disease, idiopathic thrombocytopenic purpura, mixed connective tissue disease, multiple sclerosis (MS), myasthenia gravis, narcolepsy, pemphigus vulgaris, pernicious anemia, psoriasis, psoriatic arthritis, primary biliary cirrhosis, rheumatoid arthritis, Sjögren's syndrome, scleroderma, temporal arteritis, vasculitis and Wegener's granulomatosis.

[0040] In a preferred embodiment of the present invention, lupus erythematosus includes but is not limited to systemic lupus erythematosus (SLE) and cutaneous lupus erythematosus (CLE).

[0041] In a preferred embodiment of the present invention, idiopathic inflammatory myopathy (IIM) is selected from dermatomyositis (DM), polymyositis (PM), overlap myositis (including anti-synthetase syndrome anti-synthetase syndrom, ASS), immune-mediated necrotizing myopathy (IMNM) and sporadic inclusion body myositis (sIBM).

[0042] In a preferred embodiment of the present invention, dermatomyositis is anti-MDA5 antibody-positive dermatomyositis or anti-MDA5 antibody-positive dermatomyositis combined with interstitial lung disease.

[0043] In a preferred embodiment of the present invention, the MDA5 mutation type is selected from RNA binding domain mutation (Ala946Thr, Ile956Val), ATP binding site mutation (Arg337Gly, Gly821Ser) and binding site mutation other than the two (Met854Lys).

[0044] In a preferred embodiment of the present invention, the drug has at least one of the following uses:

[0045] (1) Inhibit the expression of MDA5 protein;

[0046] (2) Inhibit MDA5-induced autoimmune response;

[0047] (3) Prolong the survival of the subjects;

[0048] (4) Increase the subject's weight;

[0049] (5) Reduce the levels of p-TBK1 or p-IRF3 protein.

[0050] In a preferred embodiment of the present invention, the method for inhibiting the expression of MDA5 protein is selected from: inhibiting the expression of IFIH1 gene, inhibiting the expression of MDA5 mutant protein; In a preferred embodiment of the present invention, MDA5 mutant protein refers to: MDA5 protein undergoing G821S mutation;

[0051] In a preferred embodiment of the present invention, inhibiting the autoimmune response induced by MDA5 refers to: down-regulating the interferon response induced by MDA5;

[0052] In a preferred embodiment of the present invention, down-regulating the interferon response induced by MDA5 is selected from at least one of the following: reducing NF-κB promoter activity, reducing IFNβ levels, reducing CXCL10 levels, reducing ISG56 levels, reducing IRF3 and TBK1 phosphorylation.

[0053] In a second aspect, the present invention also provides a use of a nucleic acid molecule in the preparation of a drug or reagent for treating an autoimmune disorder, wherein the nucleic acid molecule reduces the expression of USP8 protein and / or inhibits the level of RNA encoding USP8. The USP8 protein encoding gene or mRNA is knocked out or partially knocked out by the nucleic acid molecule, thereby reducing the expression level of USP8 protein and the RNA level of USP8.

[0054] In a preferred embodiment of the present invention, the nucleic acid molecule is selected from shRNA, sgRNA, siRNA, miRNA, esiRNA, piRNA, hnRNA, snRNA and antisense oligonucleotide;

[0055] In a preferred embodiment of the present invention, the nucleic acid molecule is selected from shRNA; shRNA can reduce the expression of USP8 protein to a certain extent, and / or inhibit the level of RNA encoding USP8, without completely knocking out USP8, thereby avoiding the risk of damage to organs such as the liver caused by completely knocking out USP8.

[0056] In a preferred embodiment of the present invention, the nucleotide sequence of shRNA is shown in SEQ ID NO.1. The sequence shown in SEQ ID NO.1 is as follows:

[0057] 5'-CCGGAATCTTCAGCAGCTTATATCCCTCGAGGGATATAAGCTGCTGAAGATTTTTTTG-3'.

[0058] In a preferred embodiment of the present invention, the nucleic acid inhibits the translation of RNA encoding USP8 and / or inhibits the transcription of the gene encoding USP8.

[0059] In a preferred embodiment of the present invention, the drug further comprises a pharmaceutically acceptable excipient.

[0060] Pharmaceutically acceptable excipients include but are not limited to pharmaceutically acceptable carriers or diluents, and "pharmaceutically acceptable carriers or diluents" refer to carriers or diluents that can be used to prepare pharmaceutical compositions, which are generally safe and non-toxic and include carriers or diluents that are acceptable for human medicine.

[0061] Such pharmaceutically acceptable carriers can be sterile liquids, such as water and oils, including oils of petroleum, animal, plant or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. When the pharmaceutical composition is administered intravenously, water is a preferred carrier. Saline solutions and aqueous solutions of dextrose and glycerol can also be used as liquid carriers, particularly for injectable solutions.

[0062] Pharmaceutically acceptable excipients include starch, glucose, lactose, sucrose, sodium stearate, glyceryl monostearate, talc, sodium chloride, skimmed milk powder, glycerol, propylene glycol, water, ethanol and the like.

[0063] The pharmaceutical composition may also contain one or more pharmaceutically acceptable salts, such as inorganic acid salts, such as hydrochlorides, hydrobromides, phosphates, sulfates, etc.; and organic acid salts, such as acetates, propionates, malonates, benzoates, etc. In addition, auxiliary substances, such as wetting agents or emulsifiers, pH buffer substances, gels or gelling materials, flavoring agents, colorants, microspheres, polymers, suspending agents, etc. may also appear here. In addition, one or more other conventional pharmaceutical ingredients may also be present, such as preservatives, humectants, suspending agents, surfactants, antioxidants, anti-caking agents, fillers, chelating agents, coating agents, chemical stabilizers, etc., especially if the dosage form is a reconstructible form. Suitable exemplary ingredients include microcrystalline cellulose, sodium carboxymethylcellulose, polysorbate 80, phenylethyl alcohol, chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerol, phenol, p-chlorophenol, gelatin, albumin, and combinations thereof.

[0064] In a third aspect, the present invention also provides a use of a recombinant vector in the preparation of a drug or reagent for treating an autoimmune disorder, wherein the recombinant vector comprises the above-mentioned nucleic acid molecule.

[0065] The recombinant vector is an expression vector or a cloning vector, preferably an expression vector, and may refer to any recombinant polynucleotide construct that can introduce the target DNA fragment directly or indirectly (such as packaging into a virus) into a host cell by transformation, transfection or transduction to express the target gene.

[0066] One type of vector is a plasmid, which is a circular double-stranded DNA molecule into which the target DNA fragment can be connected. Another type of vector is a viral vector, which can package the target DNA fragment into a viral genome (such as adenovirus, adeno-associated virus, retrovirus, lentivirus, oncolytic virus). After these vectors enter the host cell, they can express the target gene.

[0067] Those skilled in the art can also transcribe into RNA by in vitro transcription using the above nucleic acid sequence of the present invention as a template, and further transfect, transduce or transform the RNA into a host cell.

[0068] In a fourth aspect, the present invention further provides a use of a recombinant cell in the preparation of a drug or reagent for treating an autoimmune disorder, wherein the recombinant cell comprises the above-mentioned nucleic acid molecule or the above-mentioned recombinant vector.

[0069] In a preferred embodiment of the present invention, the recombinant cell is a bacterium, a fungus, or a 293 cell, a 293T cell, a 293FT cell, a CHO cell, a COS cell, or a Per6 cell. 293 series cells.

[0070] The bacteria are Agrobacterium, Mycobacterium, Streptomyces, Escherichia coli or Bacillus subtilis.

[0071] In a fifth aspect, the present invention also provides a use of a deubiquitinase inhibitor in the preparation of a drug for combined treatment of autoimmune disorders;

[0072] In a preferred embodiment of the present invention, the deubiquitinase inhibitor is selected from DUBs-IN-2, GEN-6776, AZ1, compounds represented by the following formula I to formula IV, and pharmaceutically acceptable salts thereof:

[0073] Formula I: , Formula II: , Formula III , Formula IV

[0074] Drugs that can be used in combination therapy include, but are not limited to, deubiquitinase inhibitors, glucocorticoids, tacrolimus, cyclophosphamide, and Janus kinase inhibitors.

[0075] The pharmaceutical composition of the present invention can be applied to the subject by different routes, including but not limited to oral, parenteral, sublingual, transdermal, rectal, transmucosal, topical, by inhalation, by oral administration, intrapleural, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intranasal, intratumoral, intrathecal and intraarticular or its combination. For human use, the composition can be administered as a suitable acceptable preparation according to normal human practice. Those skilled in the art will easily determine the dosage regimen and route of administration that are most suitable for a particular patient. The composition of the present invention can be applied by traditional syringes, needleless injection devices.

[0076] The pharmaceutical compositions of the present invention can also be delivered to patients by several techniques, including DNA injection, with and without in vivo electroporation, liposome-mediated, nanoparticle-facilitated, recombinant vectors such as recombinant lentivirus, recombinant adenovirus, and recombinant adeno-associated virus. The compositions can be injected intravenously or topically into the brain or muscle or electroporated in tissues of interest, such as muscle, brain, liver, prostate, breast, kidney, and hematopoietic system.

[0077] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0078] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0079] Example 1

[0080] This example studies the interferon response induced by MDA5 after inhibiting or knocking out USP8 in various cells.

[0081] 1. A shRNA targeting USP8 was designed, and the sequence is shown in SEQ ID NO: 1.

[0082] HEK-293T cells were seeded into a 6 cm cell culture dish and cultured overnight at 37 °C and 5% carbon dioxide. When the cell density reached 70-80%, transfection was performed. In a 1.5 mL sterile centrifuge tube, 300 µL of opti-MEM medium was added, and then 4 µg of plasmid DNA mixture was added, including psPAX2: 1 µg; pMD2.G: 1 µg; shUSP8: 2µg. The bottom of the test tube was gently flicked with a finger to mix, and the mixture was allowed to stand at room temperature for 5 min. 10 µL of 1mg / mL PEI was added, and the test tube was flicked to mix, and the mixture was allowed to stand at room temperature for 15-20 min. After the HEK-293T cells were replaced with the medium, the above transfection mixture was slowly dripped in, and the mixture was gently shaken horizontally to mix. Cultured at 37 °C, the medium was changed after 6 h, and the culture was continued overnight. 48 h after transfection, the virus solution was collected, and fresh medium was added, and the culture was continued overnight. The collected virus solution was filtered through a 0.45 µM membrane and then infected with HEK293T or SUM159 cells. After 48 h of virus infection, puromycin was added to screen the cells. After 3-5 days, all cells in the control group died and the stable cell line was constructed. Cell samples were collected to detect USP8 protein expression.

[0083] USP8 gene knockdown HEK293T cells (ShUSP8-HEK293T) and wild-type control cells were collected, and Western blot experiments showed that shRNA targeting USP8 could significantly reduce the level of USP8 protein (Figure 1A).

[0084] 2. Control or ShUSP8-HEK293T cells were seeded in 48-well plates. When the cells were flattened to 60%-80% of the area, 100ng NF-κB promoter and 5ng pRL-TK plasmid were co-transfected. After 24 hours, 1 ug / ml Poly(I:C) HMW was transfected. After 6 hours, the cells were collected for dual luciferase activity detection. Or 100ng MDA5 plasmid, 100ng NF-κB promoter and 5ng pRL-TK plasmid (purchased from Addgene) were directly co-transfected. After 36 hours, the cells were collected for dual luciferase activity detection. Among them, poly(I:C) HMW is a synthetic analog of double-stranded RNA (dsRNA) and a strong inducer of type I IFN. It was purchased from InvivoGenCatalog#tlrl-pic.

[0085] The results showed that shRNA targeting USP8 could significantly inhibit the NF-κB promoter activity induced by transfection of MDA5 and Poly(I:C) HMW ( Figure 1B ).

[0086] 3. Control or shUSP8-SUM159 cells were seeded in 12-well plates overnight and transfected with 1 ug / ml Poly(I:C)HMW. Cells were collected at 0, 12, 18, and 24 hours after transfection, and RNA was extracted for real-time fluorescence quantitative PCR to detect the expression of IFNβ, CXCL10, and ISG56 in cells. GAPDH was used as an internal reference.

[0087] PrimerTime qPCR assay (IFNβ):

[0088] F 5'-CAGTCTGCACCTGAAAAGATATTATG-3' (SEQ ID NO: 2);

[0089] R 5'-GATTTCCACTCTGACTATGGTCCAGG-3' (SEQ ID NO: 3);

[0090] PrimerTime qPCR assay (CXCL10):

[0091] F 5'-GGTGAGAAGAGATGTCTGAATCC-3' (SEQ ID NO: 4);

[0092] R 5'- GTCCATCCTTGGAAGCACTGCA-3' (SEQ ID NO: 5);

[0093] PrimerTime qPCR assay (ISG56):

[0094] F 5'-TCAGGTCAAGGATAGTCTGGAG-3' (SEQ ID NO: 6);

[0095] R 5'- AGGTTGTGTATTCCCACACTGTA-3' (SEQ ID NO: 7);

[0096] PrimerTime qPCR assay (GAPDH):

[0097] F 5'-TCCCTGAGCTGAACGGGAAG-3' (SEQ ID NO: 8);

[0098] R 5'-GGAGGAGTGGGTGTCGCTGT-3' (SEQ ID NO: 9).

[0099] RT-qPCR results showed (Figure 1C) that knockout of USP8 could significantly reduce the expression of Poly(I:C) HMW-induced IFNβ, CXCL10, and ISG56 in SUM159 cells.

[0100] 4. According to the cells collected in step 3, Western blot experiments detected that USP8 deficiency greatly weakened the phosphorylation levels of IRF3 and TBK1 induced by Poly(I:C) HMW.

[0101] The results showed that, consistent with the gene induction analysis, knockout of USP8 significantly attenuated Poly(I:C) HMW-induced IRF3 and TBK1 phosphorylation (Figure 1D).

[0102] 5. To further verify the function of USP8, hybridization of Usp8 fl / fl (University of Freiburg) and ROSA26-CreERT2 mice (from Wuhan University, referred to as Cre-ER), which produced Cre-ER Usp8 fl / + Mice. Take Cre-ER Usp8 from about 14 days old fl / + Mouse embryonic fibroblasts (MEFs) were seeded in 12-well plates, infected with EMCV overnight, and cells were collected at 0, 12, 18, and 24 hours.

[0103] Western blot assays revealed that Usp8 deficiency also affected EMCV-induced MDA5 protein levels and phosphorylation of TBK1 and IRF3 ( Figure 1 Middle E).

[0104] Real-time fluorescence quantitative PCR detected that compared with the control group Usp8 fl / fl Compared with MEFs, Cre-ER Usp8 fl / + The expression of Ifnb1 and Cxcl10 in MEFs was significantly reduced ( Figure 1 Middle F).

[0105] Example 2

[0106] In this example, after inhibiting USP8 in cells, the expression of the MDA5 function-enhancing mutant G821S protein was studied.

[0107] 1. HEK293T cells stably transfected with MDA5 were used to detect the phosphorylation level of IRF3 in cells stably overexpressing MDA5G821S by Western blot.

[0108] The wild-type MDA5 plasmid (from Professor Shu Hongbing's laboratory at Wuhan University) was used as a template and amplified with primers F 5'-AGGCCCGTAGTCGAGCCAGAGCTGATG-3' (SEQ ID NO: 10); R 5'-CAGCTCTGGCTCGACTACGGGCCTGGA C-3' (SEQ ID NO: 11). The DNA fragment was recovered by gel extraction and homologous recombination occurred under the action of recombinase to form the full-length target plasmid MDA5G821S using the site-directed mutagenesis method of homologous recombination technology.

[0109] The method for constructing HEK293T cells transfected with MDA5 is as follows: HEK-293T cells were inoculated into a 6 cm cell culture dish and cultured overnight at 37 °C and 5% carbon dioxide. When the cell density reached 70-80%, transfection was performed. In a 1.5 mL sterile centrifuge tube, 300 µL of opti-MEM medium was added, and then 4 µg of plasmid DNA mixture was added, including 1 µg of psPAX2; 1 µg of pMD2.G; and 2 µg of MDA5 G821S plasmid. The mixture was gently flicked on the bottom of the test tube with a finger to mix, and the mixture was allowed to stand at room temperature for 5 min. 10 µL of 1 mg / mL PEI was added, and the test tube was flicked to mix, and the mixture was allowed to stand at room temperature for 15-20 min. After the HEK-293T cells were replaced with the medium, the above transfection mixture was slowly dripped in, and the mixture was gently shaken horizontally to mix. The cells were cultured at 37 °C, and the medium was changed after 6 h, and the culture was continued overnight. 48 hours after transfection, the virus solution was collected and fresh culture medium was added to continue overnight culture. The collected virus solution was filtered through a 0.45 µM membrane and then infected with HEK293T cells. 48 hours after virus infection, puromycin was added to screen the cells. After 3-5 days, until all cells in the control group died, the stable cell line was constructed. Cell samples were collected to detect the expression of MDA5 G821S protein.

[0110] The results showed that overexpression of MDA5 G821S significantly increased the phosphorylation of IRF3 ( Figure 2A ).

[0111] 2. HEK293T cells stably transfected with MDA5 G821S were seeded in 24-well plates overnight and treated with DUBs-IN-2 (0, 1.5, 3, 6 uM) for 9 hours. The cells were collected and the effect of USP8 inhibitor on the phosphorylation of IRF3 protein was detected by Western blot experiment; DUBs-IN-2 is U8IN.

[0112] The results showed that USP8 inhibitor (U8IN) significantly inhibited the phosphorylation of IRF3 protein (Figure 2B).

[0113] 3. HEK293T cells stably transfected with MDA5 G821S were seeded in 24-well plates overnight, and DUBs-IN-2 (6uM) and protein synthesis inhibitor cycloheximide CHX (100 ug / ml) were added at the same time. Cells were collected at 0, 2, 4, 6, and 8 hours. Western blot experiments showed that USP8 inhibitor significantly destroyed the stability of MDA5G821S protein in HEK293T cells stably overexpressing MDA5G821S (Figure 2C).

[0114] 4. The control or stably transfected HEK293T cells with MDA5 were seeded in 48-well plates. When the cells were spread to 60%-80% of the area, 100 ng of IFNβ promoter and 5 ng of pRL-TK plasmid were co-transfected. After 24 hours, the cells were treated with DUBs-IN-2 (0, 4, 8, 12 uM) for 9 hours. Then, the cells were collected and the dual luciferase activity was detected. The USP8 inhibitor significantly reduced the activity of the IFNβ promoter induced by MDA5 G821S in a dose-dependent manner (Figure 2D).

[0115] Example 3

[0116] This example studies the effect of USP8 inhibitor on the survival of AGS mice in a mouse model that simulates human AGS disease.

[0117] 1. CRISPR technology was used to edit and generate G821S (gs / +) mutant mice. The construction method was referenced Figure 3 A in Figure 1 is shown in Figure 1. A brief summary is as follows:

[0118] Exon 13 where G821S is located was selected as the target site. Design gRNA (gRNA-1 5'-ATCAGCTCTGGCTCGACCCCGGG-3' (SEQ ID NO: 12); gRNA-2 5'- CATCAGCTCTGGCTCGACCCCGG-3' (SEQ ID NO: 13)) targeting vector and donor oligomer (with targeting sequence, 122 bp homologous sequence combination on both sides, single-sranded donor:

[0119] 5'-GAGCTCATAACAAGACACAACACTTCCTTTTTTTGTTGTTGTTCACATTCTCAGGCCCGGTCTCGAGCCAGAGCTGATGAAAGCACGTATGTCCTGGTCACCAGCAGTGGCTCAGGAGTTAC-3' (SEQ ID NO: 14). The p.G821S (GGT-TCT) mutation site in the donor oligonucleotide will be introduced into exon 13 by homology-directed repair. Cas9, gRNA, and donor oligonucleotide will be co-injected into fertilized eggs for the production of knockin (KI) mice. The pups will be genotyped by PCR and then sequenced.

[0120] The tail of a one-month-old gs / + mouse (F0) was taken, DNA was extracted, and then amplified by PCR and sequenced for identification. The results showed that Ifih1 was obtained by CRISPR gs / + (gs / +) mice (Fig. 3B).

[0121] 2. WT and gs / + mice (F0) were crossed, tissues of mice of specified age (F1) were collected, DNA was extracted and amplified by PCR.

[0122] (Primer sequences: F1 5′- ATAGATGGCTTTACTGTCCAAG-3′ (SEQ ID NO: 26); R1 5′-ACAGTCATCTGTGGCAATCAA-3′ (SEQ ID NO: 15) or F2 5′- ATGGGGCTAAATGGGTGGTTGTG-3′ (SEQ ID NO: 16); R2 5′- CCTGAAGAAGTAGCCACACAGTC-3′ (SEQ ID NO: 17)) and sequenced, and genotyping was performed to find ( Figure 3 (C), the proportion of gs / + mice decreased from 47.1% (8 of 17) in 14-day embryos to 30.3% (10 of 33) in 3-week-old gs / + mice.

[0123] 3. The body weights of WT and gs / + mice (F1) of the same litter at about 3.5 weeks of age were measured and counted. It was found that the body weight of gs / + mice was significantly lower than that of WT mice ( Figure 3 Figure D in the figure).

[0124] 4. WT and gs / + mice (F1) around 22 days old were randomly divided into groups and intraperitoneally injected with DUBs-IN-2 (1 mg / kg, first dissolved in DMSO and then diluted in 30% captisol) once every two days or three times a week for a total of 25 days ( Figure 3 Figure E), by statistically analyzing the survival rates of WT and gs / + mice, it was found that inhibition of USP8 significantly increased the survival rate of gs / + mice ( Figure 3 Figure F in the figure).

[0125] Example 4

[0126] In PBMC cells from patients with MDA5-positive dermatomyositis, treatment with USP8 inhibitors significantly suppressed the interferon response.

[0127] Peripheral blood was collected from patients with anti-MDA5 antibody-positive dermatomyositis or SLE with the help of the Department of Rheumatology and Immunology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, after obtaining informed consent. The collection of human blood was approved by the Scientific Investigation Committee of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology. Human primary PBMCs were isolated using Lymphocyte Isolation Medium (Human) (Catalog P8610, Solarbio) according to the manufacturer's protocol. The isolated PBMCs were cultured in RPMI-1640 medium (the medium was supplemented with 10% FBS, 2 mM glutamine, 1% penicillin, and 1% streptomycin).

[0128] PBMC cells were seeded in 12-well plates and treated with DMSO or DUBs-IN-2 (6uM) for 16 hours. The collected PBMC cells were tested by Western blot to show that USP8 inhibitor could significantly inhibit the expression of MDA5 and p-TBK1 proteins ( Figure 4 ).

[0129] Example 5

[0130] Experimental method: HEK293T cells were seeded in 10 cm dishes. When the cells were spread to 60%-80% of the area, they were co-transfected with SFB-MDA5 (WT / R337G / G821S / M854K / A946T / I956V, different mutation sites were referenced Figure 5A), HA-Ub (ubiquitin plasmid with HA protein tag) and empty vector or Myc-USP8 (USP8 plasmid with Myc tag), all plasmids were from Addgene. After 24 hours, MG132 (Selleck; Catalog#S2619; a proteasome inhibitor) was added to treat the cells for 4-6 hours. The cell samples were collected, 1% SDS lysis buffer (100 μl) was added, the cell samples were placed at 95 ℃ for 10 minutes, diluted 10 times with RIPA lysis buffer (50 mM Tris-HCl, pH8.0; 150 mM NaCl; 1% NP-40; 1% TritonX-100; 0.1% SDS; 1%Sodium Deoxycholate; containing protease inhibitors), sonicated, centrifuged, and the supernatant was collected. The cell supernatant was incubated with anti-S protein agarose beads (S-protein) (2 hours, RT or 4°C overnight), then the supernatant was discarded, washed 5 times with 1 ml lysis buffer, and the agarose bead-protein complex was resuspended with 50 µl 2×SDS loading buffer. The mixture was heated at 95°C for 10 minutes and used for Western blot detection of ubiquitination modification of the target protein.

[0131] Referring to the method of Example 2, the wild-type MDA5 plasmid (from Professor Shu Hongbing's laboratory at Wuhan University) was used as a template, and the following primers were used for amplification. The DNA fragments were recovered by gel, and the site-directed mutagenesis method of homologous recombination technology was used to undergo homologous recombination under the action of the recombinase to form the full-length target plasmid MDA5 R337G, M854K, A946T, I956V.

[0132] Primer sequences:

[0133] Primers used to amplify MDA5 R337G: F 5'-GAG TGGAAAAACCGGAGTGGCTGTTTACATTG-3' (SEQ ID NO: 18), R 5'-CAGCCACTCCGGTTTTTCCACTCC CTGTAG-3' (SEQ ID NO: 19).

[0134] Primers used to amplify MDA5 M854K: F 5'- CGA GAGAAGATGAAGTATAAAGCTATACATTGTG-3' (SEQ ID NO: 20), R 5'- TATAGCTTTATACTTCATCTTCTC TCGGAAATCA-3' (SEQ ID NO: 21).

[0135] Primers used to amplify MDA5 A946T: F 5'- AAG AGAAAACAAAACACTGCAAAAGAAGTGTGC-3' (SEQ ID NO: 22), R 5'- TTCTTT TGCAGTGTTTTGTTT TCTCTTACAATGT-3' (SEQ ID NO: 23).

[0136] Primers used to amplify MDA5 I956V: F 5'- TGC CGACTATCAAGTAAATGGTGAAATCATCTGC-3' (SEQ ID NO: 24), R 5'- ATTTCACCATTTACTTGATAGTCG GCACACTTCT-3' (SEQ ID NO: 25).

[0137] Result description: In this example, other IFIH1 mutations related to pathogenic heterozygous mutations (such as R337G, M854K, A946T and I956V) were constructed and the effect of USP8 on their ubiquitination was detected. Figure 5 As shown in Figure (B), USP8 can clear polyubiquitinated chains in other IFIH1 mutations associated with pathogenic heterozygous mutations, suggesting that autoimmune responses induced by various MDA5 mutations may be counteracted by inhibiting USP8 activity.

[0138] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of a deubiquitinase inhibitor in the preparation of a drug for treating autoimmune disorders, characterized in that: The deubiquitinase inhibitor is DUBs-IN-2, CAS number: 924296-19-5; the autoimmune disorder is Aicardi-Goutières syndrome.

2. Use of a deubiquitinase inhibitor in the preparation of a drug for combined treatment of an autoimmune disorder, wherein the autoimmune disorder is Aicardi-Goutières syndrome; The deubiquitinase inhibitor is DUBs-IN-2, CAS number: 924296-19-5.

Images