A genetically engineered bacterium for synthesizing fucosyllactose and a preparation method and application thereof
By genetically modifying the probiotic Escherichia coli Nissle1917, a genetically engineered bacterium for synthesizing fucoidan was constructed, solving the endotoxin and safety issues in the production process of existing technologies, and realizing efficient and safe fucoidan synthesis, which is suitable for industrial production.
Patent Information
- Application Number
- CN202311431659.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-31
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2043-10-31
AI Technical Summary
In existing technologies, the production of fucoidan lactose by chemical and enzymatic methods has problems such as complicated steps, many by-products, significant environmental pollution, and low enzyme catalytic activity. Furthermore, the bacterial endotoxins produced by the host bacteria E. coli during the culture process affect its industrial application.
Using the probiotic Escherichia coli Nissle1917 as the host bacterium, we constructed a genetically engineered bacterium that synthesizes fucosyllactose by knocking out specific genes and overexpressing key enzymes. This included knocking out the wcaJ and lacZ genes, overexpressing manB, manC, gmd, WcaG, lacY, α-1,2-fucosyltransferase or α-1,3-fucosyltransferase and sugar efflux transporter genes, optimizing the T7 RNA polymerase expression cassette, and performing gene editing using CRISPR/Cas9 gene editing or homologous recombination technology.
The efficient synthesis of fucose-syl lactose has been achieved, solving the problem of bacterial endotoxins, improving product safety, and meeting the requirements of large-scale industrial production.
Smart Images

Figure CN119101639B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to a genetically engineered bacterium for synthesizing fucosyllactose, a preparation method and application thereof, and especially to a genetically engineered bacterium for synthesizing 2'-fucosyllactose or 3-fucosyllactose, a preparation method and application thereof. BACKGROUND
[0002] Human milk oligosaccharides (HMOs) are the third largest solid component in human milk after lactose and fat, and are important natural prebiotics. HMOs play an important role in many physiological functions, such as helping the colonization of the newborn intestinal flora; regulating intestinal epithelial cell function and immune response by regulating gene expression and cytokine production; reducing the infection of intestinal pathogenic microorganisms as an anti-adhesion antibacterial agent, reducing the risk of necrotizing enterocolitis, and providing sialic acid for newborns as essential nutrients for brain development and cognitive improvement. 2'-fucosyllactose (2'-FL) and 3-fucosyllactose (3-FL) are the most abundant fucosyl oligosaccharides in human milk, which can selectively enhance the growth of bifidobacteria and form receptors similar to the polysaccharides on the surface of intestinal mucosal cells, thereby protecting infants from intestinal pathogenic microorganisms. As the highest content component in human milk oligosaccharides, 2'-FL and 3-FL have attracted widespread attention due to their unique probiotic properties and have broad prospects for application in infant formula.
[0003] At present, the production methods of fucosyllactose (2'-FL and 3-FL) mainly include chemical method, enzymatic method and biosynthesis method, etc. Among them, the chemical method has complicated steps, many by-products and serious environmental pollution; the substrate price of the enzymatic method is expensive, the enzyme catalytic activity is low, and the industrial production requirements cannot be met. In recent years, the use of system biology and metabolic engineering technologies to construct genetically engineered bacteria (especially Escherichia coli genetically engineered bacteria) to produce fucosyllactose has attracted more and more attention from researchers. However, E. coli as a prokaryotic expression host will produce a class of bacterial endotoxins with lipopolysaccharide (LPS) structure during cultivation. Bacterial endotoxins have small molecular weight, strong stability to heat and chemical reagents, and are currently mainly removed from samples by ion exchange, adsorption, ultrafiltration and surfactant methods. However, the above methods still have problems such as low efficiency, poor specificity, toxicity of reagents used in the process, difficulty in removal, and high cost of purification, which seriously restrict the wide application of E. coli as a host strain in industrial production.
[0004] Therefore, searching for an endotoxin-free E. coli as a host bacterium will greatly simplify the purification of the target product in the industrial production process and improve the safety of the target product. SUMMARY
[0005] In view of the deficiencies in the prior art, the present application aims to provide a genetically engineered bacterium for synthesizing fucosyl lactose and a preparation method and application thereof. The genetically engineered bacterium takes the probiotic E. coli Nissle 1917 (EcN) as a host bacterium, which does not contain pathogenic factors such as enterotoxin, hemolytic toxin and cytotoxin, has no safety risk to the host, is genetically modified, and constructs an engineered bacterium capable of synthesizing fucosyl lactose, thereby realizing efficient fermentation synthesis of fucosyl lactose and solving the problem of product safety, overcoming the deficiency that bacterial endotoxin is produced in the production process of fucosyl lactose using E. coli as a host, and providing a basis for realizing large-scale safe production of fucosyl lactose.
[0006] To achieve the object of the present application, the following technical solutions are adopted:
[0007] In a first aspect, the present application provides a genetically engineered bacterium for synthesizing fucosyl lactose, which knocks out the genes wcaJ and lacZ of phosphoglucan-1-phosphate transferase and beta-galactosidase on the basis of an initial strain, overexpresses the genes manB, manC, gmd, WcaG and lacY of phosphomannomutase, phosphoguanosine transferase, GDP-mannose-4,6-dehydratase, GDP-fucose synthetase and beta-galactosidase permease, and further overexpresses the genes of alpha-1,2-fucosyltransferase or alpha-1,3-fucosyltransferase.
[0008] Preferably, the genetically engineered bacterium further overexpresses a sugar efflux transporter gene.
[0009] Preferably, the sugar efflux transporter gene is setA, ydeA, mdfA or setB gene derived from E. coli K-12 MG1655, the nucleotide sequence of which is shown in SEQ ID NO. 16-SEQ ID NO. 19, tpyB gene of Yersinia bercovieri, the nucleotide sequence of which is shown in SEQ ID NO. 20, or CDT2 gene of Neurospora crassa, the nucleotide sequence of which is shown in SEQ ID NO. 21; more preferably, the sugar efflux transporter gene is tpyB gene of Yersinia bercovieri, the nucleotide sequence of which is shown in SEQ ID NO. 20.
[0010] Preferably, the genetically engineered bacteria also knock out one or more of the protease gene Ion, the 6-phosphofructokinase gene pfkA, or the GDP-mannose-based hydrolase nudD.
[0011] Preferably, the initial strain is selected from Escherichia coli selected from BL21 (DE3) or Nissle 1917 engineered bacteria integrated with T7 RNA polymerase expression frame.
[0012] Preferably, the modification method of Nissle 1917 engineered bacteria integrated with T7 RNA polymerase (T7RNAP) expression frame is optimized and modified according to the method described in patent CN202310516515.6.
[0013] Preferably, the genetic modification of the Nissle 1917 engineered bacteria integrated with T7 RNA polymerase expression frame includes inserting a T7 RNA polymerase expression frame on the genome of Nissle 1917, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2.
[0014] Preferably, the T7 RNA polymerase expression frame includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence (Gene ID: 1261050) downstream of the RBS downstream of the spacer sequence, the 5' end of which is shown in SEQ ID NO. 72, and the modified and optimized T7RNAP expression frame sequence is shown in SEQ ID NO. 73.
[0015] Preferably, the knockout is performed by CRISPR gene editing or homologous recombination to knock out / silence the gene, thereby down-regulating or removing the function of the related gene.
[0016] Preferably, the overexpression is achieved by integrating the manB, manC, gmd, WcaG, and lacY genes with the alpha-1,2-fucosyltransferase gene into one or more exogenous plasmids selected from any one of pETDuet, pCOLADuet, pRSFDuet, or pCDFDuet or a combination of at least two of them and introducing them into the initial strain for expression.
[0017] Preferably, the overexpression is achieved by integrating the manB, manC, gmd, WcaG, and lacY genes with the alpha-1,3-fucosyltransferase gene into one or more exogenous plasmids selected from any one of pETDuet, pCOLADuet, pRSFDuet, or pCDFDuet or a combination of at least two of them and introducing them into the initial strain for expression.
[0018] Preferably, the α-1,2-fucosyltransferase gene is derived from Bacteroides Fragilis, Helicobacter pylori, E. coli O86, A. lipoferum or Helicobacter sp. 13S00401-1, and the nucleotide sequence thereof is codon-optimized for E. coli and shown as SEQ ID NO. 6-SEQ ID NO. 10; more preferably, the α-1,2-fucosyltransferase gene is derived from wcfB of Bacteroides Fragilis, and the nucleotide sequence thereof is codon-optimized for E. coli and shown as SEQ ID NO. 6.
[0019] Preferably, the α-1,3-fucosyltransferase gene is derived from Helicobacter pylori, Helicobacter trogontum or Bacteroides Fragilis, and the nucleotide sequence thereof is codon-optimized for E. coli and shown as SEQ ID NO. 11-SEQ ID NO. 15; more preferably, the α-1,2-fucosyltransferase gene is derived from cafF of Helicobacter pylori, and the nucleotide sequence thereof is codon-optimized for E. coli and shown as SEQ ID NO. 12.
[0020] The present application provides a recombinant probiotic E. coli strain for producing fucosyllactose, wherein the recombinant E. coli is obtained by enhancing the expression of key enzymes in the de novo synthesis pathway of fucosyllactose in the cells of the probiotic E. coli EcNcΔattB(lacUV5-T7)ΔendAΔompT original strain and knocking out the key enzyme gene of the GDP-Fuc bypass catabolic pathway, thereby improving the production level of fucosyllactose.
[0021] In a second aspect, the present application provides the use of the genetically engineered bacteria for synthesizing fucosyllactose according to the first aspect in the synthesis of α-1,2-fucosyllactose or 3-fucosyllactose.
[0022] In a third aspect, the present application provides a preparation method of the genetically engineered bacteria for synthesizing fucosyllactose according to the first aspect, and the preparation method comprises:
[0023] (1) knocking out the phosphoglucomutase-1-phosphate transferase gene wcaJ and the β-galactosidase gene lacZ in the original bacteria;
[0024] (2) the phosphomannosylase gene manB, the phosphoguanylyltransferase gene manC, the GDP-mannose-4,6-dehydratase gene gmd, the GDP-fucose synthetase gene WcaG, the β-galactoside permease gene lacY, and the α-1,2-fucosyltransferase gene are integrated into one or more exogenous plasmids and introduced into the initial strain for expression;
[0025] Alternatively, the phosphomannosylase gene manB, the phosphoguanylyltransferase gene manC, the GDP-mannose-4,6-dehydratase gene gmd, the GDP-fucose synthetase gene WcaG, the β-galactoside permease gene lacY, and the α-1,3-fucosyltransferase gene are integrated into one or more exogenous plasmids and introduced into the initial strain for expression.
[0026] Preferably, a sugar efflux transporter gene is also integrated into the exogenous plasmid.
[0027] Preferably, the sugar efflux transporter gene is setA, ydeA, mdfA, setB gene derived from Escherichia coli (K-12 MG1655), the nucleotide sequence is shown in SEQ ID NO. 16-SEQ ID NO. 19, tpyB of Yersinia bercovieri, the nucleotide sequence is shown in SEQ ID NO. 20, or CDT2 of Neurospora crassa, the nucleotide sequence is shown in SEQ ID NO. 21; more preferably, the sugar efflux transporter gene is tpyB of Yersinia bercovieri, the nucleotide sequence is shown in SEQ ID NO. 20.
[0028] Preferably, the nucleotide sequence of the β-galactosidase gene lacZ is shown in SEQ ID NO. 22.
[0029] Preferably, the nucleotide sequence of the undecaprenol-1-phosphate uridylyltransferase gene wcaJ is shown in SEQ ID NO. 23.
[0030] Preferably, one or more of the protease gene lon, the 6-phosphofructokinase gene pfkA, and the GDP-mannose hydrolase nudD are also knocked out.
[0031] Preferably, the initial strain is selected from Escherichia coli selected from BL21 (DE3) or Nissle 1917 engineered bacteria integrated with a T7 RNA polymerase expression frame.
[0032] Preferably, the genetic modification of the Nissle 1917 engineered bacterium integrated with the T7 RNA polymerase expression cassette comprises: inserting the T7 RNA polymerase expression cassette into the genome of Nissle 1917, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2.
[0033] Preferably, the T7 RNA polymerase (T7RNAP) expression cassette comprises a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence downstream of the RBS downstream of the spacer sequence, the 5' end of which is shown in SEQ ID NO. 72, and the modified and optimized T7RNAP expression cassette sequence is shown in SEQ ID NO. 73.
[0034] In the present application, the method for knocking out in the genetic modification of the Nissle 1917 engineered bacterium is selected from the CRISPR-Cas9 gene editing method or the homologous recombination method. The insertion site of the expression cassette is the attB site on the genome, wherein the nucleotide sequence of the sgRNA targeting the attB site is shown in SEQ ID NO. 29.
[0035] In the present application, the endA gene and the ompT gene are knocked out by the CRISPR-Cas9 gene editing method, the nucleotide sequence of the sgRNA targeting the endA gene is shown in SEQ ID NO. 31, and the nucleotide sequence of the sgRNA targeting the ompT gene is shown in SEQ ID NO. 32.
[0036] In the present application, the cryptic plasmids pMUT1 and pMUT2 are knocked out by the CRISPR-Cas9 gene editing method, the nucleotide sequence of the sgRNA targeting pMUT1 is shown in SEQ ID NO. 27, and the nucleotide sequence of the sgRNA targeting pMUT2 is shown in SEQ ID NO. 28.
[0037] Preferably, the exogenous plasmid is selected from any one of pETDuet, pCOLADuet, pRSFDuet, or pCDFDuet or a combination of at least two thereof.
[0038] Preferably, the α-1,2-fucosyltransferase gene is derived from Bacteroides Fragilis, H. pylori, E. coli O86, A. lipoferum or Helicobacter sp. 13S00401-1, and the nucleotide sequence thereof is codon-optimized for E. coli and shown as SEQ ID NO. 6-SEQ ID NO. 10; more preferably, the α-1,2-fucosyltransferase gene is derived from wcfB of Bacteroides Fragilis, and the nucleotide sequence thereof is codon-optimized for E. coli and shown as SEQ ID NO. 6.
[0039] Preferably, the α-1,3-fucosyltransferase gene is derived from H. pylori, Helicobacter trogontum or Bacteroides Fragilis, and the nucleotide sequence thereof is codon-optimized for E. coli and shown as SEQ ID NO. 11-SEQ ID NO. 15; more preferably, the α-1,3-fucosyltransferase gene is derived from cafF of H. pylori, and the nucleotide sequence thereof is codon-optimized for E. coli and shown as SEQ ID NO. 12.
[0040] Preferably, the knockout is performed by CRISPR gene editing or homologous recombination to knock out / silence the gene and down-regulate or remove the function of the related gene.
[0041] Preferably, in step (2), the manB, manC, gmd and WcaG genes are overexpressed by using pETDuet, pCOLADuet or pRSFDuet plasmids in series, and the lacY, α-1,2-fucosyltransferase gene and tpyB gene are overexpressed by using pCDFDuet plasmids in series.
[0042] Alternatively, in step (2), the manB, manC, gmd and WcaG genes are overexpressed by using pETDuet, pCOLADuet or pRSFDuet plasmids in series, and the lacY, α-1,3-fucosyltransferase gene and tpyB gene are overexpressed by using pCDFDuet plasmids in series.
[0043] As a preferred embodiment of the recombinant probiotic E. coli strain with high production of fucosylated lactose, the genetic modification of the engineered bacteria includes knocking out the β-galactosidase gene lacZ, the undecaprenyl-phosphate-1-phosphotransferase gene wcaJ, the protease gene Ion, the 6-phosphofructokinase gene pfkA, the GDP-mannose-hydrolyzing enzyme nudD, and overexpressing the phosphomannomutase gene manB, the phosphoguanosine transferase gene manC, the GDP-mannose-4,6-dehydratase gene gmd, the GDP-fucose synthase gene WcaG, the β-galactoside permease gene lacY, the α-1,2-fucosyltransferase gene wcfB or the α-1,3-fucosyltransferase gene cafF, and the sugar efflux transporter gene tpyB.
[0044] As a preferred embodiment of the probiotic E. coli engineered bacteria, the specific construction method of the engineered bacteria is as follows: using the CRISPR / Cas9 gene editing technology, designing sgRNA for lacZ and wcaJ respectively to knock them out; constructing a recombinant plasmid containing multiple genes such as the phosphomannomutase gene manB, the phosphoguanosine transferase gene manC, the GDP-mannose-4,6-dehydratase gene gmd, the GDP-fucose synthase gene WcaG, the β-galactoside permease gene lacY, the α-1,2-fucosyltransferase gene wcfB or the α-1,3-fucosyltransferase gene cafF, and the sugar efflux transporter gene tpyB.
[0045] Specifically, the overexpression is the expression of multiple copies of the gene on the plasmid. Among them, the pETDuet, pCOLADuet or pRSFDuet plasmid is used to overexpress the manB, manC, gmd and WcaG genes in series, and the pCDFDuet plasmid is used to overexpress the lacY, α-1,2-fucosyltransferase gene and tpyB gene in series; or the pETDuet, pCOLADuet or pRSFDuet plasmid is used to overexpress the manB, manC, gmd and WcaG genes in series, and the pCDFDuet plasmid is used to overexpress the lacY, α-1,3-fucosyltransferase gene and tpyB gene in series.
[0046] Specifically, the nucleotide sequence of the overexpressed gene is as follows:
[0047] The nucleotide sequence of the phosphomannosylase gene manB is shown as SEQ ID NO. 1. The nucleotide sequence of the phosphoguanosine transferase gene manC is shown as SEQ ID NO. 2. The nucleotide sequence of the GDP-mannose-4,6-dehydratase gene gmd is shown as SEQ ID NO. 3. The nucleotide sequence of the GDP-fucose synthetase gene WcaG is shown as SEQ ID NO. 4. The nucleotide sequence of the β-galactoside permease gene lacY is shown as SEQ ID NO. 5. The nucleotide sequence of the α-1,2-fucosyltransferase gene wcfB is shown as SEQ ID NO. 6. The nucleotide sequence of the α-1,3-fucosyltransferase gene cafF is shown as SEQ ID NO. 12. The nucleotide sequence of the sugar efflux transporter gene tpyB is shown as SEQ ID NO. 20.
[0048] Specifically, in the process of knocking out by using CRISPR / Cas9 gene editing technology, the nucleotide sequence of the sgRNA used is as follows:
[0049] The nucleotide sequence of the sgRNA targeting the protease gene lon is shown as SEQ ID NO. 57. The nucleotide sequence of the sgRNA targeting the 6-phosphofructokinase gene pfkA is shown as SEQ ID NO. 58. The nucleotide sequence of the sgRNA targeting the GDP-mannose hydrolase nudD is shown as SEQ ID NO. 59. The nucleotide sequence of the sgRNA targeting the undecaprenyl-phosphate-1-phosphotransferase gene wcaJ is shown as SEQ ID NO. 34. The nucleotide sequence of the sgRNA targeting the β-galactosidase gene lacZ is shown as SEQ ID NO. 33.
[0050] In a fourth aspect, the present application provides a method for producing 2'-fucosyllactose and 3-fucosyllactose, which comprises: using glucose as a carbon source, using lactose as a substrate, and using the genetically engineered bacteria for synthesizing 2'-fucosyllactose and 3-fucosyllactose according to the first aspect to ferment 2'-fucosyllactose and 3-fucosyllactose.
[0051] Preferably, in the fermentation process, the seed medium comprises, by concentration: 10 g / L of tryptone, 5 g / L of yeast powder, 10 g / L of sodium chloride, 50 mg / L of kanamycin, and 50 mg / L of streptomycin.
[0052] Preferably, in the fermentation process, the shake flask fermentation culture includes, by concentration: 10 g / L of tryptone, 5 g / L of yeast powder, 10 g / L of sodium chloride, 20 g / L of glucose, 12 g / L of lactose, 50 mg / L of kanamycin, and 50 mg / L of streptomycin.
[0053] Preferably, in the fermentation process, the fermentation conditions are as follows: the fermentation temperature is 25-28°C, the fermentation time is 48-72 hours, the shaker speed is 220-250 rpm, the inoculation amount is 1-2%, and the IPTG induction concentration is 0.1-0.15 mM.
[0054] Specifically, the method for producing 2'-fucosyllactose and 3-fucosyllactose in the present application includes: recombinant Escherichia coli is cultured in 2 mL of LB medium (kanamycin or ampicillin 50 μg / mL, streptomycin 50 μg / mL) at 37°C and a shaker speed of 220 rpm overnight for about 15 hours. 1 mL of the seed liquid of the overnight culture is transferred into 50 mL of LB medium (kanamycin or ampicillin 50 μg / mL, streptomycin 50 μg / mL, and glucose is added to a final concentration of 20 g / L), and cultured at 30°C and a shaker speed of 250 rpm for about 8 hours (bacterial solution OD 600 about 0.8). Lactose is added to a final concentration of 12 g / L and 0.2 mM of IPTG, and the induction fermentation is continued at 25°C and a shaker speed of 250 rpm for 48-72 hours. After the fermentation is completed, the fermentation supernatant is collected by centrifugation, the supernatant is boiled at 100°C for 10 minutes, centrifuged again, diluted with purified water to an appropriate multiple, filtered through a 0.22 μm filter membrane, and the content of fucosyllactose (2'-FL and 3-FL) is detected by liquid chromatography using an external standard method.
[0055] Compared with the prior art, the present application has the following beneficial effects:
[0056] The application takes probiotic Escherichia coli EcNcDeltaattB(lacUV5-T7)DeltaendADeltaOmpT as a host bacterium, and through overexpression of multiple genes such as phosphomannosylase gene manB, phosphoguanosine transferase gene manC, GDP-mannose-4,6-dehydratase gene gmd, GDP-fucose synthetase gene WcaG, beta-galactoside permease gene lacY, alpha-1,2-fucosyltransferase gene wcfB or alpha-1,3-fucosyltransferase gene cafF and sugar efflux transporter gene tpyB, and knockout of beta-galactosidase gene lacZ, undecaprenyl-phosphate-1-phosphotransferase gene wcaJ, protease gene lon, 6-phosphofructokinase gene pfkA and GDP-mannose hydrolase nudD, a fucosyllactose synthetic metabolic engineering bacterium strain is constructed. The metabolic engineering bacterium is used for shake flask fermentation verification, and the results show that when glucose is used as a substrate, the yield of 2'-FL and 3-FL reaches 8.25 g / L and 4.67 g / L respectively. The metabolic engineering bacterium constructed in the application achieves the purpose of safe and efficient synthesis of fucosyllactose. BRIEF DESCRIPTION OF DRAWINGS
[0057] Figure 1 Fig. 2 is the sequencing identification results of lacZ and wcaJ gene knockout of EcNcDeltaattB(lacUV5-T7)DeltaendADeltaOmpT strain; in the figure, (a) is the sequencing results of PCR product after lacZ gene knockout, and (b) is the sequencing results of PCR product after wcaJ gene knockout.
[0058] Figure 2 Fig. 3 is the sequencing identification results of lacZ and wcaJ gene knockout of BL21(DE3) strain; in the figure, (a) is the sequencing results of PCR product after lacZ gene knockout, and (b) is the sequencing results of PCR product after wcaJ gene knockout.
[0059] Figure 3 Fig. 4 is the knockout detection of Lon of Escherichia coli EcNc01 strain; wherein 3# and 5# bands are 629 and 744 bp respectively.
[0060] Figure 4 Fig. 5 is the knockout detection of pfkA of Escherichia coli EcNc01Deltaion strain; wherein 1# and 2# bands are 763 and 561 bp respectively.
[0061] Figure 5 Fig. 6 is the knockout detection of nudD of Escherichia coli EcNc01DeltaionDeltaPfkA strain; wherein 1# and 10# bands are 579 and 497 bp respectively.
[0062] Figure 6 Fig. 7 is the HPLC-MS results of 2'-FL standard and sample.
[0063] Figure 7 HPLC-MS results of 3-FL standard and sample. DETAILED DESCRIPTION
[0064] In order to more clearly illustrate the technical solutions of the present application, the following further describes the present application with reference to specific examples. Unless otherwise specified, the technical means used in the present application are methods known to those skilled in the art. In addition, the embodiments are understood to be illustrative rather than limiting the scope of the present application, which is only part of the embodiments of the present application, and the essence and scope of the present application are only limited by the claims. For those skilled in the art, various changes or modifications to the ingredients and amounts of the materials in these embodiments without departing from the essence and scope of the present application also fall within the scope of the present application.
[0065] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples can be obtained commercially.
[0066] Example 1
[0067] Preparation of probiotic E. coli EcNc ΔattB(lacUV5-T7) ΔendA ΔompT (this method is also described in CN202310516515.6)
[0068] 1.1 In the original strain of probiotic E. coli Nissle 1917 (E. coli Nissle 1917), based on the CRISPR / Cas9 gene editing technology, using a homologous recombination kit (Pro Ligation-Free Cloning Kit, abm company, item number E086), the Cas9 fragment was ligated with the NcoI enzyme / XhoI enzyme double enzyme digestion fragment of pKD46 plasmid to construct the pKD-Cas9 plasmid, and the pKD-Cas9 plasmid was transformed into E. coli Nissle 1917 cells, and positive clones were selected and named EcN-Cas9.
[0069] 1.2 At the same time as preparing EcN-Cas9, design and prepare sgRNA of secret plasmid pMTU1 and pMTU2 respectively, and transfer into EcN-Cas9 to knock out the secret plasmid, thereby constructing a kind of E. coli strain with secret plasmid removed, named EcNc.
[0070] sgRNA-pMTU1: agttaccggataaggcgcagcgg; (SEQ ID NO. 27)
[0071] sgRNA-pMTU2: gtttggcgcagaacctcggacgg. (SEQ ID NO. 28)
[0072] 1.3 Insert the optimized T7RNAP expression cassette into the genome of Nissle 1917 bacteria, and the insertion site of the expression cassette is the attB site on the genome.
[0073] The optimized T7RNAP expression cassette (referred to as "lacUV5-T7" for short) comprises a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase (Gene ID: 1261050) sequence downstream of the RBS downstream spacer sequence. The 5' end of the T7RNAP expression cassette sequence is shown in SEQ ID NO. 72, wherein the promoter sequence is "tttacactttatgcttccggctcgtataatg", the operator sequence is "ttgtgagcggataacaa", the RBS sequence is "AAAGAGGAGAAA", the spacer sequence is "GGCCACTACTAGAG" (RBS upstream spacer sequence) and "TACTAG" (RBS downstream spacer sequence), and "ATGAACACGATTAACATCGCTAAGAAC" is the upstream part of the T7 RNA polymerase (Gene ID: 1261050) coding gene sequence, and ATG is the start codon.
[0074] tttacactttatgcttccggctcgtataatgtgtggaattgtgagcggataacaaGGCCACTACTAGAGAAAGAGGAGAAA TACTAG ATGAACACGATTAACATCGCTAAGAAC (SEQ ID NO. 72)
[0075] The complete optimized T7RNAP expression cassette sequence is shown in SEQ ID NO. 73.
[0076] Referring to step 1.1, EcNc-Cas9 is constructed, and then the pUC-sgRNA-attB plasmid and the Donor fragment (the Donor fragment contains a T7 RNAP fragment and homologous arms of about 300 bp in length upstream and downstream of the attB site) are co-transformed into EcNc-Cas9 cells, and the T7RNAP fragment is integrated into the attB site of the EcNc strain using the CRISPR / Cas9 system; to obtain the strain EcNcΔattB(lacUV5-T7). The nucleotide sequence of the Donor fragment is shown in SEQ ID NO. 30.
[0077] The sgRNA nucleotide sequence for the attB site is shown as SEQ ID NO. 29.
[0078] sgRNA-attB: ctaacttgagcgaaacgggaagg. (SEQ ID NO. 29)
[0079] 1.4 Knockout of endA and ompT genes in probiotic E. coli EcNcΔattB(lacUV5-T7) strain based on CRISPR / Cas9 gene editing technology to prepare EcNcΔattB(lacUV5-T7)ΔendAΔompT.
[0080] The sgRNA of the Nissle 1917 bacterial gene endA (NCBI Accession No. (949092)) and ompT (NCBI Accession No. (945185)) was designed respectively. The sgRNA nucleotide sequence of endA is shown as SEQ ID NO. 31, and the sgRNA nucleotide sequence of ompT is shown as SEQ ID NO. 32. The CRISPR / Cas9 knockout system was transformed into the target strain EcNcΔattB(lacUV5-T7) for knockout of the target gene to obtain probiotic E. coli EcNcΔattB(lacUV5-T7)ΔendAΔompT.
[0081] sgRNA-endA: tttttctcaagcgaaagccgcgg (SEQ ID NO. 31);
[0082] sgRNA-ompT: tactcctgacaacataaatgcgg (SEQ ID NO. 32).
[0083] In addition to using CRISPR / Cas9 gene editing technology, homologous recombination technology can also be used for knockout, and the final EcNcΔattB(lacUV5-T7)ΔendAΔompT strain is functionally consistent.
[0084] Example 2
[0085] Knockout of lacZ and wcaJ genes in probiotic E. coli EcNcΔattB(lacUV5-T7)ΔendAΔompT and E. coli BL21(DE3) strain
[0086] The lacZ and wcaJ gene knockout of the probiotic E. coli EcNcΔattB(lacUV5-T7)ΔendAΔOmpT in this embodiment can be designed with reference to E. coli MG1655, lacZ (Gene ID: 945006) and wcaJ (Gene ID: 946583).
[0087] (1) The sgRNA of the genes lacZ and wcaJ (the nucleotide sequences of lacZ-sgRNA and wcaJ-sgRNA are shown in Table 1) were designed using the CRISPR / Cas9 gene editing technology, and the sgRNA and Donor sequence were cloned into the gene editing vector Donor plasmid (the nucleotide sequence of lacZ-Donor is shown as SEQ ID NO. 66; the nucleotide sequence of wcaJ-Donor is shown as SEQ ID NO. 67). The specific experimental procedure includes the following steps:
[0088] A) Prepare the electrocompetent cells of the EcNcΔattB(lacUV5-T7)ΔendAΔOmpT strain and the BL21(DE3) strain, respectively.
[0089] B) Transform the pUC-Cas9 plasmid into EcNcΔattB(lacUV5-T7)ΔendAΔOmpT and BL21(DE3) cells, respectively, and spread the bacterial solution on kanamycin-resistant plates and incubate at 30°C.
[0090] C) The next day, single colonies were picked for PCR verification, and positive clones were prepared into electrocompetent cells, named EcNcΔattB(lacUV5-T7)ΔendAΔOmpT-Cas9 and BL21(DE3)-Cas9.
[0091] D) Transform pUC-sgRNA-lacZ into EcNcΔattB(lacUV5-T7)ΔendAΔOmpT-Cas9 and BL21(DE3)-Cas9 cells, respectively, and spread the bacterial solution on Kan+Spec-resistant plates and incubate at 30°C.
[0092] E) The next day, single colonies were picked for PCR verification, and positive clones were prepared into electrocompetent cells, named EcNcΔattB(lacUV5-T7)ΔendAΔOmpT-Cas9 and BL21(DE3)-Cas9.
[0093] F) Use the same strategy to knockout the wcaJ gene by combining the sgRNA sequence of the wcaJ gene.
[0094] G) The positive clones were used as templates to amplify the upstream and downstream sequences of the lacZ and wcaJ genes by primers lacZ-F / R and wcaJ-F / R, respectively. The correct bands were recovered by agarose gel electrophoresis and verified by sequencing. The sequence of the knockout fragment was consistent with that of the donor fragment.
[0095] The results of sequencing identification of the lacZ and wcaJ gene knockouts of the EcNcΔattB(lacUV5-T7)ΔendAΔOmpT strain are shown in FIG. 2. (a) and (b) represent the sequencing results of the PCR products of the lacZ and wcaJ genes, respectively. Figure 1 The results of sequencing identification of the lacZ and wcaJ gene knockouts of the BL21(DE3) strain are shown in FIG. 3. (a) and (b) represent the sequencing results of the PCR products of the lacZ and wcaJ genes, respectively. Figure 2 The results of sequencing identification of the lacZ and wcaJ gene knockouts of the EcNcΔattB(lacUV5-T7)ΔendAΔOmpT strain are shown in FIG. 2. (a) and (b) represent the sequencing results of the PCR products of the lacZ and wcaJ genes, respectively.
[0096] (2) The genomic DNA of E. coli K-12 MG1655 was used as a template to clone the gene fragments of ManB-ManC (shown in SEQ ID NO. 1 and SEQ ID NO. 2), Gmd-WcaG (shown in SEQ ID NO. 3 and SEQ ID NO. 4), and LacY (shown in SEQ ID NO. 5) using CB-F / CB-R, GW-F / GW-R, and LacY-F / LacY-R primers (see Table 1), respectively. The DNA fragments were recovered by gel electrophoresis and gel cutting. The recovered gene fragments of ManB-ManC and Gmd-WcaG were ligated to the vector pETDuet by a homologous recombination seamless cloning kit (ProLigation-Free Cloning Kit, abm company, item number E086) to obtain the recombinant plasmid pETDuet-manB-manC-gmd-wcaG. The recovered LacY gene fragment was ligated to the pCDFDuet plasmid by the same ligation method to construct the plasmid pCDFDuet-lacY.
[0097] The codon-optimized a-1,2-fucosyltransferase gene futC (Helicobacter pylori, SEQ ID NO. 7) and a-1,3-fucosyltransferase gene futA (Helicobacter pylori, SEQ ID NO. 11) were synthesized by Suzhou Hongxun Biotechnology Co., Ltd. The synthesized futC and futA gene fragments were ligated to the vector pCDFDuet-lacY by homologous recombination seamless cloning kit to construct plasmids pCDFDuet-lacY-futC and pCDFDuet-lacY-futA. Table 1 shows the primers and sgRNA used in this example.
[0098] Table 1
[0099]
[0100]
[0101] (3) The plasmids pETDuet-manB-manC-gmd-wcaG and pCDFDuet-lacY-futC were co-transformed into EcNc01 and BL01 to obtain the engineering strains 2'-EcNc01 and 2'-BL01. The plasmids pETDuet-manB-manC-gmd-wcaG and pCDFDuet-lacY-futA were co-transformed into EcNc01 and BL01 to obtain the engineering strains 3-EcNc01 and 3-BL01. The engineering strains were inoculated into 2 mL LB medium containing corresponding antibiotics, and incubated at 37°C, 220 rpm, in a shaker flask overnight for about 15 hours to obtain seed liquid. 1 mL of the overnight culture seed liquid was inoculated into 50 mL LB medium containing corresponding antibiotics, and incubated at 30°C, 250 rpm, in a shaker flask until the OD600 reached 0.6-0.8. Then, 0.5 mM of arabinose was added to induce the expression of the target gene, and the culture was incubated at 30°C, 250 rpm, in a shaker flask for 16 hours. The culture was centrifuged at 4°C, 8000 rpm for 10 minutes to obtain the supernatant and the pellet. The supernatant was used for the preparation of the cell-free extract, and the pellet was used for the preparation of the whole-cell extract. 600For 0.8 (about 6 hours); IPTG was added to a final concentration of 0.1 mM, and lactose was added to a final concentration of 12 g / L, and the induction was continued at 25 °C, 250 rpm for 48-72 hours. After the fermentation, the fermentation supernatant was collected by centrifugation, and the supernatant was boiled at 100 °C for 10 minutes, then centrifuged again, and 0.5 mL of the supernatant was mixed with 0.5 mL of ddH2O. The sample was filtered through a 0.22 μm filter, and the content of fucosyllactose (2’-FL and 3-FL) was detected by liquid chromatography using an external standard method. The fermentation yield results of the engineering strains are shown in Table 2. After constructing the HMO synthesis pathway in the chassis strain EcNc01, the yields of 2’-FL and 3-FL reached 1.93 g / L and 0.82 g / L, respectively, which were higher than those of the engineering strains constructed from BL01. Therefore, EcNc01 was selected as the chassis cell for the following 2’-FL / 3-FL production pathway optimization and key enzyme screening research. Table 2 is the 2’-FL / 3-FL yield of the engineering strains of the present embodiment.
[0102] Table 2
[0103]
[0104] Example 3
[0105] Construction of recombinant plasmids for de novo synthesis of fucosyllactose
[0106] (1) Strengthen the intracellular 6-phosphofructose to GDP-L-fucose synthesis pathway of the engineering strain EcNc01 and screen for overexpression plasmids. The plasmid was constructed according to the method of Example 2.
[0107] The plasmids pETDuet-manB-manC-gmd-wcaG, pRSFDuet-manB-manC-gmd-wcaG and pCOLADuet-manB-manC-gmd-wcaG were co-transformed into the strain EcNc01 with the plasmid pCDFDuet-lacY-futC, respectively, to obtain the engineering strains 2’-EcNc01, 2’-EcNc02 and 2’-EcNc03.
[0108] The plasmids pETDuet-manB-manC-gmd-wcaG, pRSFDuet-manB-manC-gmd-wcaG and pCOLADuet-manB-manC-gmd-wcaG were co-transformed into the strain EcNc01 with the plasmid pCDFDuet-lacY-futA, respectively, to obtain the engineering strains 3-EcNc01, 3-EcNc02 and 3-EcNc03.
[0109] Shaking flask fermentation was used to verify the production of 2'-FL and 3-FL (Table 3), and the fermentation process and detection method were the same as those in Example 2. It was verified that the phosphomannomutase gene manB, the phosphoguanytransferase gene manC, the GDP-mannose-4, 6-dehydratase gene gmd, and the GDP-fucose synthase gene WcaG had the best expression effect on the pCOLADuet plasmid, and the production of 2'-FL and 3-FL of the engineered strains 2'-EcNc03 and 3-EcNc03 was the highest, which was 2.52 and 1.48 g / L, respectively. Table 3 shows the effect of strengthening the intracellular 6-phosphofructose to GDP-L-fucose synthesis pathway on the production of 2'-FL and 3-FL.
[0110] Table 3
[0111]
[0112] (2) Screening of α-1, 2-fucosyltransferase gene: In order to further improve the production of 2'-FL, the key enzyme α-1, 2-fucosyltransferase in the pathway was screened. The codon-optimized α-1, 2-fucosyltransferase gene was artificially synthesized by Suzhou Hongxun Biotechnology Co., Ltd., in which wcfB was derived from (Bacteroides Fragilis) (Bacteroides fragilis), the optimized wcfB sequence was shown as SEQ ID NO. 6, futC was derived from H. pylori (Helicobacter pylori), the optimized futC sequence was shown as SEQ ID NO. 7, wbwK was derived from E. coli O86 (Escherichia coli O86), the optimized wbwK sequence was shown as SEQ ID NO. 8, SAM1671 was derived from A. lipoferum (Azoarcus lipoferum), the optimized SAM1671 sequence was shown as SEQ ID NO. 9, and BKH04410 was derived from Helicobacter sp. 13S00401-1 (Helicobacter 13S00401-1), the optimized BKH04410 sequence was shown as SEQ ID NO. 10.
[0113] The synthetic gene fragments were connected to the vector pCDFDuet-lacY by homologous recombination seamless cloning kit to construct plasmids pCDFDuet-lacY-futC, pCDFDuet-lacY-wcfB, pCDFDuet-lacY-wbwK, pCDFDuet-lacY-SAM1671, pCDFDuet-lacY-BKH04410. These plasmids were co-transformed into strain EcNc01 with pCOLADuet-manB-manC-gmd-wcaG, respectively, to obtain engineered strains 2'-EcNc03, 2'-EcNc04, 2'-EcNc05, 2'-EcNc06, 2'-EcNc07.
[0114] The production of 2'-FL was verified by shake flask fermentation, and the fermentation process and detection method were the same as in Example 2. The 72-hour 2'-FL production of each strain is shown in Table 4, in which 2'-EcNc04 has the highest 72-hour 2'-FL production, reaching 4.83 g / L. The results show that the α-1,2-fucosyltransferase wcfB from B. fragilis has the highest activity in the expression of probiotic E. coli Nissle 1917, and is most beneficial to the production of 2'-fucosyllactose. Table 4 shows the effect of α-1,2-fucosyltransferases from different sources on the production of 2'-FL.
[0115] Table 4
[0116]
[0117]
[0118] (3) Screening of α-1,3-fucosyltransferase genes: In order to further improve the production of 3-FL, the key enzyme α-1,3-fucosyltransferase in the pathway was screened. The codon-optimized α-1,3-fucosyltransferase genes were artificially synthesized by Suzhou Hongxun Biotechnology Co., Ltd., in which futA, cafF and futH were derived from H. pylori (Helicobacter pylori), the optimized sequence of futA is shown as SEQ ID NO. 11, the optimized sequence of cafF is shown as SEQ ID NO. 12, and the optimized sequence of futH is shown as SEQ ID NO. 13, futD was derived from Helicobacter trogontum (Helicobacter trogontum), the optimized sequence of futD is shown as SEQ ID NO. 14, and futM was derived from Bacteroides Fragilis (Bacteroides fragilis), the optimized sequence of futM is shown as SEQ ID NO. 15.
[0119] The synthetic gene fragments were ligated to the vector pCDFDuet-lacY by homologous recombination seamless cloning kit to construct plasmids pCDFDuet-lacY-futA, pCDFDuet-lacY-cafF, pCDFDuet-lacY-futH, pCDFDuet-lacY-futD and pCDFDuet-lacY-futM. These plasmids were co-transformed into strain EcNc01 with pCOLADuet-manB-manC-gmd-wcaG, respectively, to obtain engineered strains 3-EcNc03, 3-EcNc04, 3-EcNc05, 3-EcNc06 and 3-EcNc07.
[0120] The yield of 3-FL was verified by shake flask fermentation, and the fermentation process and detection method were the same as in Example 2. The 3-FL yield of each strain at 72 hours is shown in Table 5, in which 3-EcNc04 had the highest 3-FL yield at 72 hours, reaching 2.31 g / L. The results showed that the α-1, 3-fucosyltransferase cafF from Helicobacter pylori had the highest activity in the expression in probiotic Escherichia coli Nissle 1917, and was most conducive to the production of 3-fucosyllactose. Table 5 shows the effect of α-1, 3-fucosyltransferases from different sources on the yield of 3-FL.
[0121] Table 5
[0122]
[0123] Example 4
[0124] Screening of fucosyllactose efflux transporters
[0125] Sugar efflux transporters promote the transport of fucosyllactose 2’-FL and 3-FL out of the cell to further improve the yield: Generally, in microbial cell production, reducing the accumulation of products in the cytoplasm to reduce the toxicity and growth inhibition of microbial cells by strengthening the efflux of products is a common and effective method. Human milk oligosaccharides 2’-FL and 3-FL can be excreted from the cell by suitable efflux transporters, reducing the inhibitory effect of intracellular products while improving the yield of human milk oligosaccharides, and being conducive to the separation and purification of human milk oligosaccharides.
[0126] (1) Fucose lactose efflux transporter gene acquisition and co-expression plasmid construction: The setA, ydeA, mdfA, and setB gene fragments of the sugar efflux transporter were cloned from the genome of E. coli K-12 MG1655 using SetA-F / SetA-R, YdeA-F / YdeA-R, MdfA-F / MdfA-R, and SetB-F / SetB-R primers, respectively. The sequences are shown in SEQ ID NO. 16-SEQ ID NO. 19. The codon-optimized sugar efflux transporter genes tpyB (derived from Yersinia bercovieri) and CDT2 (derived from Neurospora crassa) were artificially synthesized by Suzhou Hongxun Biotechnology Co., Ltd. The optimized tpyB sequence is shown in SEQ ID NO. 20, and the optimized CDT2 sequence is shown in SEQ ID NO. 21.
[0127] To facilitate the transport of intracellular fucose lactose to the extracellular and improve the yield of fucose lactose in the fermentation broth, the sugar efflux transporter genes setA, ydeA, mdfA, setB, tpyB, or CDT2 were expressed in series based on the plasmids pCDFDuet-lacY-wcfB and pCDFDuet-lacY-cafF. Specifically, based on overlap extension PCR technology (the relevant primers are shown in Table 6), the genes setA, ydeA, mdfA, setB, tpyB, or CDT2 were expressed in series after the wcfB and cafF genes using an RBS sequence (the sequence is shown in SEQ ID NO. 71), obtaining the wcfB-RBS-setA, cafF-RBS-setA, wcfB-RBS-ydeA, cafF-RBS-ydeA, wcfB-RBS-mdfA, cafF-RBS-mdfA, wcfB-RBS-setB, cafF-RBS-setB, wcfB-RBS-tpyB, cafF-RBS-tpyB, wcfB-RBS-CDT2, and cafF-RBS-CDT2 fragments. The obtained fragments were ligated to the vector pCDFDuet-lacY using a homologous recombination seamless cloning kit to construct the series plasmid. Table 6 shows the primers used in this example.
[0128] Table 6
[0129] Primer name Primer sequence (5’-3’) SetA-F (SEQ ID NO. 45) gttaaaaggagatataccatgatctggataatgacgatggctcgc SetA-R (SEQ ID NO. 46) cgcgccgagctcgaattcggatcctcaaacgtctttaacctttgc YdeA-F (SEQ ID NO. 47) gttaaaaggagatataccatgacaacaaacactgtttcc YdeA-R (SEQ ID NO. 48) cgcgccgagctcgaattcggatccctattgcgtctgttcttcgag MdfA-F (SEQ ID NO. 49) gttaaaaggagatataccatgcaaaataaattagcttccg MdfA-R (SEQ ID NO. 50) cgcgccgagctcgaattcggatccttacccttcgtgagaatttccc SetB-F (SEQ ID NO. 51) gttaaaaggagatataccatgcataactcccccgcag SetB-R (SEQ ID NO. 52) cgcgccgagctcgaattcggatccttaaacatctttaatccgcagtaag TpyB-F (SEQ ID NO. 53) tgtaaaaggagatataccatgaaaagcgcactgacctttagccg TpyB-R (SEQ ID NO. 54) cgcgccgagctcgaattcggatccttacgcttcgcgaacgcgtgcgc CDT2-F (SEQ ID NO. 55) gttaaaaggagatataccatgggtattttcaacaaaaagc CDT2-R (SEQ ID NO. 56) cgcgccgagctcgaattcggatcctcaggcaacagacttaccttcg RBS (SEQ ID NO. 71) aaggagatatacc
[0130] (2) The effect of different sources of sugar efflux transporters on the yield of 2'-FL: The tandem plasmids pCDFDuet-lacY-wcfB-RBS-setA, pCDFDuet-lacY-wcfB-RBS-ydeA, pCDFDuet-lacY-wcfB-RBS-mdfA, pCDFDuet-lacY-wcfB-RBS-setB, pCDFDuet-lacY-wcfB-RBS-tpyB, and pCDFDuet-lacY-wcfB-RBS-CDT2 were co-transformed into the strain EcNc01 with pCOLADuet-manB-manC-gmd-wcaG, respectively, to obtain the engineering strains 2'-EcNc08, 2'-EcNc09, 2'-EcNc10, 2'-EcNc11, 2'-EcNc12, and 2'-EcNc13, respectively.
[0131] Single colonies were picked for shake flask fermentation to verify the yield of 2'-FL. The yield results are shown in Table 7, and overexpression of the sugar efflux transporter tpyB effectively increased the transport of the product 2'-FL to the extracellular. The yield of 2'-FL of the engineering strain 2'-EcNc12 was increased to 6.79 g / L. Table 7 shows the effect of different sources of sugar efflux transporters on the yield of 2'-FL.
[0132] Table 7
[0133]
[0134]
[0135] (3) The effect of different sources of sugar efflux transporters on the yield of 3-FL: The tandem plasmids pCDFDuet-lacY-cafF-RBS-setA, pCDFDuet-lacY-cafF-RBS-ydeA, pCDFDuet-lacY-cafF-RBS-mdfA, pCDFDuet-lacY-cafF-RBS-setB, pCDFDuet-lacY-cafF-RBS-tpyB, and pCDFDuet-lacY-cafF-RBS-CDT2 were co-transformed into the strain EcNc01 with pCOLADuet-manB-manC-gmd-wcaG, respectively, to obtain the engineering strains 3-EcNc08, 3-EcNc09, 3-EcNc10, 3-EcNc11, 3-EcNc12, and 3-EcNc13, respectively.
[0136] Individual clones were selected for shake flask fermentation to verify 3-FL production. The yield results are shown in Table 8. Overexpression of the sugar efflux transporter tpyB effectively increased the extracellular transport of the product 3-FL, raising the 3-FL yield of the engineered strain 3-EcNc12 to 3.37 g / L. The highest yield was achieved in the engineered strain 3-EcNc12, obtained by co-transforming the strain EcNc01 with pCDFDuet-lacY-cafF-RBS-tpyB and pCOLADuet-manB-manC-gmd-wcaG. Table 8 shows the effects of sugar efflux transporters from different sources on 3-FL production.
[0137] Table 8
[0138]
[0139] Example 5
[0140] Knockout of lon, pfkA, and nudD genes in the probiotic Escherichia coli EcNc01 strain and its effects on 2'-FL and 3-FL production
[0141] Using CRISPR / Cas9 gene editing technology, sgRNAs for the genes lon, pfkA, and nudD were designed (the nucleotide sequences of lon-sgRNA, pfkA-sgRNA, and nudD-sgRNA are shown in Table 9), and the sgRNA and Donor sequences were cloned into the gene editing vector Donor plasmid. The specific experimental process was the same as in Example 2. The gene sequences of lon, pfkA, and nudD are shown in SEQ ID NO. 24 to SEQ ID NO. 26.
[0142] The EcNc01 strain was used as the starting strain to sequentially knock out the lon, pfkA, and nudD genes (gene sequences are shown in SEQ ID NO.24-SEQ ID NO.26), and then PCR verification and sequencing were performed using primers Lon-F / Lon-R, PfkA-F / PfkA-R, and NudD-F / NudD-R, respectively. The gene knockout results are shown in Figure 2. Figure 3 、 4 ,5, Figure 3 In the figure, lanes #1-#8 represent different single colonies, lane M is a molecular weight standard, the gene of the single colony in lane #5 has not been knocked out, and the gene of the single colony in lane #3 has been knocked out. Figure 4 In the figure, lanes #1-#6 represent different single colonies, lane M is a molecular weight standard, the gene of the single colony in lane #1 is not knocked out, and the gene of the single colony in lane #2 is knocked out. Figure 5 In the figure, lanes #1-#12 represent different single colonies, lane M is a molecular weight standard, the gene of the single colony in lane #1 has not been knocked out, and the gene of the single colony in lane #10 has been knocked out.
[0143] The sequence of the knockout fragment was verified by sequencing to be consistent with the sequence of the Donor design fragment, and the knockout successful strains were named EcNc01Δlon, EcNc01ΔlonΔpfkA, EcNc01ΔlonΔpfkAΔnudD in turn. Table 9 shows the sequences of the primers and sgRNAs used in this example.
[0144] Table 9
[0145] Primer / sgRNA name Primer sequence (5’-3’) lon-sgRNA (SEQ ID NO. 57) cagatgctgaaactgcctgacgg pfkA-sgRNA (SEQ ID NO. 58) aaaatcggtgtgttgacaagcgg nudD-sgRNA (SEQ ID NO. 59) attaagtcgagagagacaagcgg Lon-F (SEQ ID NO. 60) gcgcaacaggcatctggtg Lon-R (SEQ ID NO. 61) gccagtttcagcggcatatgt PfkA-F (SEQ ID NO. 62) tgttccgtcgtacccaggga PfkA-R (SEQ ID NO. 63) ccaacgtcagatcgccaca NudD-F (SEQ ID NO. 64) agtaacagctcatcttccgct NudD-R (SEQ ID NO. 65) gcgttgactgcactatccg
[0146] The optimal expression combination pCOLADuet-manB-manC-gmd-wcaG and pCDFDuet-lacY-wcfB-RBS-tpyB screened in Examples 3 and 4 were respectively transformed into EcNc01Δlon, EcNc01ΔlonΔpfkA, EcNc01ΔlonΔpfkAΔnudD to obtain the engineering strains 2’-EcNc14, 2’-EcNc15, 2’-EcNc16, and the production of 2’-FL was verified by shake flask fermentation.
[0147] The optimal expression combination pCOLADuet-manB-manC-gmd-wcaG and pCDFDuet-lacY-cafF-RBS-tpyB screened in Examples 3 and 4 were respectively transformed into EcNc01Δlon, EcNc01ΔlonΔpfkA, EcNc01ΔlonΔpfkAΔnudD to obtain the engineering strains 3-EcNc14, 3-EcNc15, 3-EcNc16, and the production of 3-FL was verified by shake flask fermentation.
[0148] The results are shown in Table 10. By knocking out the protease lon gene, the negative regulation on the synthesis of GDP-L-fucose intermediate was removed. By knocking out the 6-phosphofructokinase pfkA gene, the branch pathway of 6-phosphofructose converting 1,6-phosphofructose was blocked. By knocking out the mannose glycosyl hydrolase nudD, the consumption of intermediate GDP-D-mannose in cell wall biosynthesis was inhibited, thereby enhancing the carbon flux of GDP-L-fucose synthesis, and finally increasing the production of 2’-FL and 3-FL, which were 8.25 g / L and 4.67 g / L, respectively. Table 10 shows the production of 2’-FL / 3-FL of the engineering strains after knocking out the lon, pfkA and nudD genes.
[0149] Table 10
[0150]
[0151]
[0152] Example 6
[0153] 2’-FL and 3-FL liquid chromatography-mass spectrometry (HPLC-MS) identification
[0154] The fermentation broth containing 2’-FL / 3-FL obtained by fermentation of the genetically engineered bacteria of the present application was centrifuged at 10,000 rpm for 5 minutes to obtain the fermentation broth supernatant. The fermentation broth supernatant was diluted 5-10 times and filtered through a 0.22 μm water phase filter to obtain the sample to be tested, which was subjected to HPLC-MS detection.
[0155] 2’-FL liquid detection conditions: Agilent 1200 Series high performance liquid chromatography equipped with a refractive index detector (RID); chromatographic column: BEH Amide 1.7 μm 100×2.1 mm; mobile phase: A is 0.1% ammonia-10 mM ammonium acetate aqueous solution, B is acetonitrile; elution gradient as shown in Table 11; column temperature 30°C.
[0156] Table 11
[0157] Time (min) A% B% Flow rate mL / min Upper pressure limit bar 0 10 90 0.2 600 0.1 10 90 0.2 600 8 50 50 0.2 600 10 50 50 0.2 600 12 10 10 0.2 600 15 10 10 0.2 600
[0158] 3-FL liquid detection conditions: Agilent 1200 Series high performance liquid chromatography equipped with a refractive index detector (RID); chromatographic column: Aminex HPX-87H 9 μm 300×7.8 mm; mobile phase: 5 mM H2SO4, isocratic elution; column temperature 60°C; flow rate 0.5 mL / min.
[0159] MS detection conditions: ionization mode: electrospray negative ion mode; detection mode: Product Ion; atomization gas pressure: 40 psi; ion spray voltage: 4000 V; dryer temperature: 350°C; drying gas flow rate: 8 L / min. Qualitative ion pairs, fragmentation voltages and collision energies are shown in Table 12:
[0160] Table 12
[0161]
[0162] The HPLC-MS results of 2’-FL standard and sample are shown in Figure 6 , (A) is the liquid chromatogram of the mixed standard of glucose, lactose and 2’-FL; (B) is the liquid chromatogram of the 2’-FL fermentation broth; (C) is the mass spectrometry detection peak chart of the 2’-FL fermentation broth.
[0163] Figure 6 In the above, the peak time of the mixed standard of glucose, lactose and 2’-FL is 7.184 minutes, 11.736 minutes and 15.174 minutes, respectively Figure 6 (A)), and the peak time of the product 2’-FL in the fermentation broth sample is consistent with that of the standard Figure 6(B)); and the MS result of the sample (C) is consistent with the MS result of 2'-FL reported in the literature, indicating that the product of the strain 2'-EcNc16 in Example 5 is 2'-FL. Figure 6
[0164] The HPLC-MS results of the 3-FL standard and the sample are shown in Figs. 3A-3F. Figure 7 Fig. 3A is a liquid chromatogram of a glucose, lactose and 3-FL mixed standard; Fig. 3B is a liquid chromatogram of a 3-FL fermentation broth; Fig. 3C is a mass spectrum of the 3-FL fermentation broth; Fig. 3D is a liquid chromatogram of a glucose, lactose and 3-FL mixed standard; Fig. 3E is a liquid chromatogram of a 3-FL fermentation broth; and Fig. 3F is a mass spectrum of the 3-FL fermentation broth.
[0165] Figure 7 In Fig. 3D, the elution times of the 3-FL, lactose and glucose mixed standard are 7.655 minutes, 8.438 minutes and 9.913 minutes, respectively. Figure 7 Fig. 3D is a liquid chromatogram of a glucose, lactose and 3-FL mixed standard; Fig. 3E is a liquid chromatogram of a 3-FL fermentation broth; and Fig. 3F is a mass spectrum of the 3-FL fermentation broth. Figure 7 Fig. 3E is a liquid chromatogram of a 3-FL fermentation broth; and Fig. 3F is a mass spectrum of the 3-FL fermentation broth. Figure 7 Fig. 3F is a mass spectrum of the 3-FL fermentation broth.
[0166] In summary, the present application provides an engineered E. coli strain for efficiently synthesizing fucosyl lactose (2'-FL and 3-FL) and a method for constructing the same. The engineered strain is obtained by knocking out the β-galactosidase gene lacZ, the undecaprenyl-phosphate glucose-1-phosphate uridylyltransferase gene wcaJ, the protease gene Ion, the 6-phosphofructokinase gene pfkA, the GDP-mannose hydrolase nudD from the genome of the original strain Nissle1917ΔattB(lacUV5-T7)ΔendAΔompT, and overexpressing the lactose permease gene lacY, the key enzyme gene of the intracellular GDP-Fuc de novo synthesis metabolic pathway, the α-1,2-fucosyltransferase gene, the α-1,3-fucosyltransferase gene and the sugar efflux transporter gene tpyB.
[0167] The scheme of the present application can improve the rate of exogenous lactose transfer into cells and reduce lactose hydrolysis, thereby effectively increasing the intracellular lactose concentration; meanwhile, the intracellular GDP-Fuc concentration is increased; the fucosyltransferase activity is improved through codon optimization, thereby effectively promoting the synthesis of fucosylated lactose; finally, the overexpression of sugar efflux transporter promotes the transport of intracellular fucosylated lactose to the outside, thereby improving the yield of fucosylated lactose in the fermentation broth. The present application uses Escherichia coli probiotic Nissle1917 as the host to biosynthesize fucosylated lactose, thereby laying a foundation for the safe industrial production of fucosylated lactose.
[0168] The applicant states that the above description is only a specific embodiment of the present application, but the protection scope of the present application is not limited thereto, and those skilled in the art should understand that any changes or replacements within the technical scope disclosed by the present application, which can be easily thought of by any person skilled in the art, falls within the protection scope and disclosure scope of the present application.
Claims
1. A genetically engineered bacterium for synthesizing fusosyl lactose, characterized in that: The genetically engineered bacterium is based on an initial strain, in which the genes of phospho-glucoside-1-phosphotransferase wcaJ and β-galactosidase lacZ are knocked out, the genes of phosphomannose isomerase manB, phosphoguanosine transferase manC, GDP-mannose-4,6-dehydratase gmd, GDP-fucose synthetase WcaG and β-galactoside permease lacY are overexpressed, the gene of sugar efflux transporter tpyB is further overexpressed, and the genes of α-1,2-fucosyltransferase wcfB or α-1,3-fucosyltransferase cafF are further overexpressed; the genetically engineered bacterium further knocks out the genes of protease lon, 6-phosphofructokinase pfkA and GDP-mannose hydrolase nudD. The overexpression is achieved by integrating manB, manC, gmd and WcaG into pCOLADuet plasmid for expression, and integrating wcfB or cafF, lacY and tpyB into pCDFDuet plasmid for expression; the nucleotide sequence of the phosphomannose isomerase gene manB is shown in SEQ ID NO. 1; the nucleotide sequence of the phosphoguanosine transferase gene manC is shown in SEQ ID NO. 2; the nucleotide sequence of the GDP-mannose-4,6-dehydratase gene gmd is shown in SEQ ID NO. 3; the nucleotide sequence of the GDP-fucose synthetase gene WcaG is shown in SEQ ID NO. 4; the nucleotide sequence of the β-galactoside permease gene lacY is shown in SEQ ID NO. 5; the nucleotide sequence of the α-1,2-fucosyltransferase gene wcfB is shown in SEQ ID NO. 6; the nucleotide sequence of the α-1,3-fucosyltransferase gene cafF is shown in SEQ ID NO. 12; and the nucleotide sequence of the sugar efflux transporter gene tpyB is shown in SEQ ID NO.
20. The initial strain is an Nissle 1917 engineered bacterium integrated with a T7 RNA polymerase expression frame; the genetic modification of the Nissle 1917 engineered bacterium integrated with the T7 RNA polymerase expression frame comprises: inserting a T7 RNA polymerase expression frame into the genome of Nissle 1917, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2; the T7 RNA polymerase expression frame comprises a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence and a T7 RNA polymerase sequence downstream of the RBS downstream spacer sequence, the 5' end of which is shown in SEQ ID NO. 72, and the sequence of the T7 RNA polymerase expression frame is shown in SEQ ID NO.
73. 2.The genetically engineered bacteria according to claim 1, characterized in that, The knocking out is achieved by CRISPR gene editing or homologous recombination to knock out / silence the genes, thereby down-regulating or removing the functions of the related genes.
3. Use of the genetically engineered bacteria of synthetic lactosyl-lactose according to claim 1 or 2 in the synthesis of a-1, 2-lactosyl-lactose or 3-lactosyl-lactose.
4. A method for producing the genetically engineered bacteria of synthetic lactosyl- rockafellerose according to claim 1 or 2, characterized by, The preparation method comprises: (1) knocking out the undecaprenyl-phosphate glucose-1-phosphate transferase gene wcaJ and the β-galactosidase gene lacZ in the initial bacteria; the initial bacteria are Nissle 1917 engineered bacteria integrated with a T7 RNA polymerase expression frame; the genetic modification of the Nissle 1917 engineered bacteria integrated with the T7 RNA polymerase expression frame comprises: inserting a T7 RNA polymerase expression frame on the genome of Nissle 1917, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2; the T7 RNA polymerase expression frame comprises a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the RBS and downstream of the spacer sequence, the 5' end is shown as SEQ ID NO. 72, and the T7 RNA polymerase expression frame sequence is shown as SEQ ID NO. 73; (2) integrating the phosphomannomutase gene manB, the phosphoguanylyltransferase gene manC, the GDP-mannose-4, 6-dehydratase gene gmd, the GDP-fucose synthase gene WcaG, the β-galactoside permease gene lacY, the sugar efflux transporter gene tpyB, and the a-1, 2-fucosyltransferase gene into an exogenous plasmid and introducing them into the initial bacteria for expression; wherein the manB, manC, gmd, and WcaG genes are overexpressed in series by using the pCOLADuet plasmid, and the lacY, a-1, 2-fucosyltransferase gene, and tpyB gene are overexpressed in series by using the pCDFDuet plasmid; or, integrating the phosphomannomutase gene manB, the phosphoguanylyltransferase gene manC, the GDP-mannose-4, 6-dehydratase gene gmd, the GDP-fucose synthase gene WcaG, the β-galactoside permease gene lacY, the sugar efflux transporter gene tpyB, and the a-1, 3-fucosyltransferase gene into an exogenous plasmid and introducing them into the initial bacteria for expression; wherein the manB, manC, gmd, and WcaG genes are overexpressed in series by using the pCOLADuet plasmid, and the lacY, a-1, 3-fucosyltransferase gene, and tpyB gene are overexpressed in series by using the pCDFDuet plasmid; (3) knocking out the protease gene lon, the 6-phosphofructokinase gene pfkA, and the GDP-mannose hydrolase nudD.
5. The method for preparing the genetically engineered bacteria for synthesizing fucose-based lactose according to claim 4, characterized in that: The knocking out is performed by using the CRISPR gene editing or homologous recombination method to knock out / silence the genes, thereby down-regulating or removing the functions of the related genes.
Citation Information
Patent Citations
T7 expression system-based Nissel 1917 engineering bacterium as well as preparation method and application of T7 expression system-based Nissel 1917 engineering bacterium
CN118931930A
Method for removing cryptic plasmids from escherichia coli Nissle by using suicide vectors
CN103740747A
Genetically engineered bacterium for producing 2'-fucosyllactose and application of genetically engineered bacterium
CN112342176A
Recombinant escherichia coli for synthesizing 3-fucosyllactose and construction method thereof
CN112662604A
Improved process for the production of fucosylated oligosaccharides
US20190309336A1