KASP molecular marker of rice false smut resistance gene FSR1, primer, kit and application

Abstract

The invention discloses a KASP molecular marker of a rice false smut resistance gene FSR1, a primer, a kit and application, and belongs to the technical field of biology. On one hand, the invention provides the KASP molecular marker of the rice false smut resistance gene FSR1, and on the other hand, the invention provides application of the KASP molecular marker to detection of the rice false smut resistance gene FSR1. The invention overcomes the defect that the selection of the false smut resistance phenotype in the traditional disease resistance breeding is easily influenced by the environment, and can be used for the rapid identification of the false smut resistance gene FSR1 and the auxiliary selection of the false smut resistance breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically to KASP molecular markers and primers, a kit and applications of a rice false smut resistance gene FSR1. Background Art

[0002] Rice is one of the most important food crops in the world, feeding more than half of the world's population. Stable rice yield plays an important role in maintaining food security. In recent years, with the large-scale planting of high-yield and hybrid rice, excessive application of chemical fertilizers and global climate change, rice false smut (RFS) has gradually developed into a major disease in rice-producing areas. Rice false smut is a fungal disease caused by Ustilaginoideavirens, which can cause a 30% reduction in rice production and reduce the quality of rice. At the same time, the Ustilaginoideavirens will also produce a variety of toxins that have a strong inhibitory effect on cell division, threatening the safety of humans and animals. At present, the prevention and control of rice false smut mainly adopts chemical fungicides and agricultural cultivation measures. It is urgent to develop a new green prevention and control technology system for rice false smut. Cultivating rice varieties resistant to rice false smut is an important basis for the new green prevention and control technology system for rice false smut. Therefore, it is urgent to explore rice false smut resistance genes and develop corresponding molecular markers to create rice materials resistant to rice false smut, laying the foundation for cultivating disease-resistant varieties.

[0003] Molecular markers can be used for rapid identification of disease-resistant genes and effective breeding. With the rapid development of genomes, single nucleotide polymorphism (SNP) markers between individuals have gradually become popular. Among them, KASP (Kompetitive Allele Specific PCR) marker technology uses specific fluorescent primers to accurately amplify the target SNP site, and performs genotyping by scanning the fluorescent signal. It does not require electrophoresis, photography, and band reading analysis. It has the advantages of being fast, accurate, low-cost, and automated. This technology is widely used in gene positioning and molecular marker-assisted selection breeding of crops. The rice false smut resistance gene FSR1 was identified from the disease-resistant variety NJ11. The genetic population constructed by hybridization with the susceptible variety CG3 has completed the fine positioning of the disease resistance gene FSR1. Subsequently, the rice false smut resistance gene FSR1 has been identified through gene editing and genetic complementation. Therefore, the development of KASP molecular markers for the rice false smut resistance gene FSR1 is of great value and significance for the rapid detection of rice false smut resistance genes and molecular selection breeding. Summary of the invention

[0004] In view of the problems existing in the prior art, the purpose of the present invention is to design and provide a KASP molecular marker, primers, kit and application technical solution for the rice false smut resistance gene FSR1. The present invention overcomes the disadvantage that the selection of rice false smut resistance phenotype in traditional disease resistance breeding is easily affected by the environment, and can be used for rapid identification of the rice false smut resistance gene FSR1 and auxiliary selection of rice false smut resistance breeding.

[0005] The present invention is specifically implemented by the following technical solutions:

[0006] In a first aspect, the present invention provides a KASP molecular marker for a rice false smut resistance gene FSR1. The KASP molecular marker comprises a TMT1p5 primer set and a TMT1p6 primer set. The TMT1p5 primer set comprises TMT1p5F1, TMTp5F2 and TMTp5R. The nucleotide sequence of the TMT1p5F1 is shown in SEQ ID NO.1, the nucleotide sequence of the TMTp5F2 is shown in SEQ ID NO.2, and the nucleotide sequence of the TMTp5R is shown in SEQ ID NO.3. The TMT1p6 primer set comprises TMT1p6F1, TMTp6F2 and TMTp6R. The nucleotide sequence of the TMT1p6F1 is shown in SEQ ID NO.4, the nucleotide sequence of the TMTp6F2 is shown in SEQ ID NO.5, and the nucleotide sequence of the TMTp6R is shown in SEQ ID NO.6.

[0007] A second aspect of the present invention provides a primer set for detecting a rice false smut resistance gene FSR1, the primer set comprising a TMT1p5 primer set and a TMT1p6 primer set, the TMT1p5 primer set comprising TMT1p5F1, TMTp5F2 and TMTp5R, the nucleotide sequence of the TMT1p5F1 being shown in SEQ ID NO.1, the nucleotide sequence of the TMTp5F2 being shown in SEQ ID NO.2, the nucleotide sequence of the TMTp5R being shown in SEQ ID NO.3, the TMT1p6 primer set comprising TMT1p6F1, TMTp6F2 and TMTp6R, the nucleotide sequence of the TMT1p6F1 being shown in SEQ ID NO.4, the nucleotide sequence of the TMTp6F2 being shown in SEQ ID NO.5, the nucleotide sequence of the TMTp6R being shown in SEQ ID NO.6.

[0008] The third aspect of the present invention provides a detection kit for the rice false smut resistance gene FSR1 containing the primer set.

[0009] The fourth aspect of the present invention provides the use of the above-mentioned molecular marker, the above-mentioned primer set and the above-mentioned kit in detecting the rice false smut resistance gene FSR1.

[0010] A fifth aspect of the present invention provides a method for detecting a rice false smut resistance gene FSR1, comprising the following steps:

[0011] The genome of the rice sample to be tested was used as a template, and the TMT1p5 primer set and the TMT1p6 primer set were used for fluorescence quantitative PCR amplification, and the amplification results were genotyped;

[0012] If both the TMT1p5 primer set and the TMT1p6 primer set detect the corresponding base T, it is judged that the rice does not contain the rice false smut resistance gene FSR1; if both the TMT1p5 primer set and the TMT1p6 primer set detect the corresponding base G, it is judged that the rice contains the rice false smut resistance gene FSR1; if the TMT1p5 primer set and the TMT1p6 primer set detect the bases T and G at the same time, the test material contains a heterozygous FSR1 gene.

[0013] Furthermore, the fluorescent quantitative PCR amplification system comprises HiGeno 2x Probe Mix B, rice gDNA, an amplification primer set and water.

[0014] Furthermore, the fluorescence quantitative PCR amplification program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s; annealing and extension at 61-55°C for 40 s, 10 cycles, reducing annealing and extension by 0.6°C in each cycle; denaturation at 95°C for 20 s; annealing and extension at 55°C for 40 s, 34 cycles.

[0015] Beneficial effects of the present invention:

[0016] The KASP molecular marker of the rice false smut resistance gene FSR1 provided by the present invention is a primer set specifically designed based on the differential SNP of the rice false smut resistance gene FSR1 in resistant and susceptible varieties. The molecular marker can quickly type the FSR1 gene in rice varieties. The present invention overcomes the disadvantage that the selection of rice false smut phenotype is easily affected by the environment, and can accelerate the breeding process of rice varieties resistant to rice false smut. On the other hand, the KASP sub-marker does not rely on traditional gel electrophoresis, and can achieve high-throughput detection of the FSR1 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The quantitative results of KASP molecular marker TMT1p5, red represents the disease-resistant genotype, blue represents the susceptible genotype, and green represents the heterozygous type. A1 is NJ11, A2 is the disease-resistant pool, A3 is CG3, A4 is the disease-susceptible pool, A5-D12 are susceptible plants, and E1-H12 are resistant plants.

[0018] Figure 2The quantitative results of KASP molecular marker TMT1p6, red represents the disease-resistant genotype, blue represents the susceptible genotype, and green represents the heterozygous type. A1 is NJ11, A2 is the disease-resistant pool, A3 is CG3, A4 is the disease-susceptible pool, A5-D12 are susceptible plants, and E1-H12 are resistant plants. DETAILED DESCRIPTION

[0019] The present invention is further described below with reference to the examples.

[0020] Example 1: Obtaining KASP molecular markers for the rice false smut resistance gene FSR1

[0021] 1. Test materials

[0022] The F2 genetic population was constructed using the rice smut resistant variety NJ11 and the susceptible variety CG3 as parents, and the FSR1 gene was located in the 220kb region between the Indel15 and RM1134 markers. qRT-PCR analysis was performed on 34 genes in the candidate region, and 5 genes were found to be significantly differentially expressed. The sequencing results combined with the gene editing results confirmed that TMT1 was a candidate gene for FSR1. At the same time, the F2:3 families were harvested to verify the reliability of the marker.

[0023] 2. Identification of resistance to rice false smut

[0024] The identification of resistance to rice false smut was carried out simultaneously using a natural induced disease nursery and artificial inoculation. Natural field induction method: In order to simulate the field environment where rice false smut is more likely to occur, a spraying system was built in the field disease nursery, and spraying was set every 2 hours, each time lasting 20 minutes. At the same time, in order to promote the occurrence of rice false smut, a series of adjustments were made to the field management. First, organic fertilizer was applied in the winter of the previous year to ensure sufficient base fertilizer. Secondly, a more intensive rice planting density was adopted than conventional field planting. In addition, nitrogen fertilizer was added during the rice heading stage, and the diseased ears collected in the previous year were evenly spread in the field. No disease prevention and control drugs were applied throughout the process to promote the occurrence of rice false smut. Artificial inoculation method: (1) Inoculate a filter paper sheet of rice spores stored in a refrigerator at -80°C on a potato culture dish and grow for about 7 days, then cut the mycelium blocks and put them into a potato liquid culture medium; (2) Shake and culture at 150 rpm / min under 28°C dark conditions for 7-9 days, break the obtained mycelium and spore mixture with a juicer, and use a single layer of coarse gauze (gauze with large holes) for inoculation, with a spore concentration of 10 to the sixth power per milliliter; (3) Artificial inoculation is carried out in a greenhouse. In the evening of 7 days before the rice breaks, draw the inoculation liquid with a syringe and inject it into the ear bud from the side until it overflows; (4) Keep the temperature at 22°C for 2 days after inoculation, spray water every 3 hours and shade; (5) Keep the temperature at 25°C and spray water every 3 hours for 3-7 days after inoculation; (6) Continue to culture under the condition that the temperature does not exceed 32°C and the humidity is greater than 50% after 7 days, and count the disease situation about 15 days before harvest.

[0025] 3. Rice genomic DNA extraction

[0026] (1) Cut 100-200 mg of leaves into a 2.0 mL high-quality centrifuge tube (or screw-cap cryotube), label it, cover the tube tightly, and freeze it in liquid nitrogen for about 15 seconds until it is completely frozen. Use a grinder (4000; 12 seconds) to quickly grind it into powder.

[0027] (2) Take out the centrifuge tubes and add 750 μL of preheated CTAB extract to each tube of sample. Mix well and place in a 65°C water bath for 30 min, shaking 2 to 3 times during the process.

[0028] (3) Take out the samples, add about 750 μL of chloroform isoamyl alcohol to each tube, and then centrifuge at 8000g for 15 minutes. Take 400 μL of the supernatant, add 320 μL of isopropanol (-20°C), and then place the centrifuge tube in a -20°C refrigerator for 10 minutes.

[0029] (4) Centrifuge at 10,000 g for 15 min at 4°C to precipitate DNA and discard the waste liquid. Add 500 μL of 70% alcohol, let stand for 5 min, then centrifuge at 10,000 g for 5 min and discard the waste liquid. After drying, add 100 μL of 35°C preheated ddH2O to dissolve. Store at -80°C for future use.

[0030] 4. FSR1 sequencing analysis

[0031] Full-length primers FSR1-CF: AGGGCAAGGGCTTTGCTATT and FSR1-CR: GATACGGAAGGGTGTGGACC were designed to amplify the full-length FSR1 genome of the rice false smut-resistant variety NJ11 and the susceptible variety CG3, including the 1998 bp before ATG, the coding region, and the 427 bp after TGA. After sequencing, the generated SNPs were compared and analyzed.

[0032] 5. Development of KASP markers for the rice false smut resistance gene FSR1

[0033] According to the KASP primer design principles, (1) two allele-specific forward primers (Allele-specific forward primer 1 and 2) and a common reverse primer (Common reverse primer) are used to obtain SNP. (2) Ensure that there are no consecutive 5 or more base sequences complementary within a single primer. It is recommended that the PCR amplification length should not be greater than 120bp. For special SNP sites that are difficult to design, the amplification length can be extended to 150bp. (3) The specificity of the primers is tested using the rice genome database RGA.

[0034] The designed KASP marker was used to amplify the resistant parent NJ11, the resistant pool and the susceptible parent CG3, the susceptible pool and the offspring F2:3 population. The primer sets TMT1p5 and TMT1p6 were used to clearly type the resistant and susceptible materials.

[0035] The sequences of primer sets TMT1p5 and TMT1p6 are as follows:

[0036] TMT1p5 Primer Set

[0037] TMT1p5F1 (shown in SEQ ID NO.1):

[0038] GAAGGTGACCAAGTTCATGCTCGCCGGGCATAGAGAACAAACCCAT (with FAM linker);

[0039] TMTp5F2 (shown in SEQ ID NO.2):

[0040] GAAGGTCGGAGTCAACGGATTCGCCGGGCATAGAGAACAAACCCAG (including HEX connector);

[0041] TMTp5R (shown in SEQ ID NO.3):

[0042] CCTTCCCACCTCCTCAGTCTAAAACCGCT;

[0043] TMT1p6 Primer Set

[0044] TMT1p6F1 (shown in SEQ ID NO.4):

[0045] GAAGGTGACCAAGTTCATGCTCAATCAGTGACTTCCTTGAAACAAT (including FAM connector);

[0046] TMTp6F2 (shown in SEQ ID NO.5):

[0047] GAAGGTCGGAGTCAACGGATTCAATCAGTGACTTCCTTGAAACAAG (including HEX connector);

[0048] TMTp6R (shown in SEQ ID NO.6):

[0049] TACCTGAAGAATCCTGATCAGCGACATTC.

[0050] Example 2: Detection method of rice false smut resistance gene FSR1

[0051] First, the primers obtained in the example were uniformly diluted to a concentration of 10 μM, and the Primer mix was prepared according to the ratio of F1:F2:R=1:1:3; secondly, the genomic DNA to be detected was uniformly diluted to a concentration of 20 ng / μL. The fluorescence quantitative PCR amplification system (10 μL) was: 5 μL of HiGeno 2x Probe Mix B, 2 μL of genomic DNA, 0.75 μL Primer mix, and 2.25 μL ddH2O.

[0052] The fluorescence quantitative PCR amplification program was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s; annealing and extension at 61-55°C for 40 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6°C in each cycle; denaturation at 95°C for 20 s; annealing and extension at 55°C for 40 s, 34 cycles.

[0053] The fluorescence quantitative PCR result file was used for genotype analysis using an online tool (https: / / tools.goodbtk.com / SNPDecoder). Figure 1 ) and TMT1p6( Figure 2 ) Genotype results.

[0054] according to Figure 1 and Figure 2 Results TMT1p5 and TMT1p6 can distinguish the resistance type and susceptible type of rice false smut resistance gene FSR1. Secondly, the two molecular markers were used to detect the genotypes of 92 samples of F2:3 population, and the test results showed that the resistance genotype and susceptible genotype were consistent with the identification results of rice false smut resistance.

[0055] In order to more accurately detect the resistance-susceptibility genotype, the resistance-susceptibility genotype is comprehensively determined based on the results of TMT1p5 and TMT1p6:

[0056] (1) If both the TMT1p5 primer set and the TMT1p6 primer set detect the corresponding base T (blue), it is judged that the rice does not contain the rice false smut resistance gene FSR1;

[0057] (2) If both TMT1p5 primer set and TMT1p6 primer set detect the corresponding base G (red), it is judged that the rice contains the rice false smut resistance gene FSR1;

[0058] (3) If the TMT1p5 primer set and the TMT1p6 primer set simultaneously detect bases T and G (green), the test material contains a heterozygous FSR1 gene.

Claims

1. The KASP molecular marker of the rice false smut resistance gene FSR1 is characterized by: The KASP molecular marker includes a TMT1p5 primer set and a TMT1p6 primer set, wherein the TMT1p5 primer set includes TMT1p5F1, TMTp5F2 and TMTp5R, the nucleotide sequence of the TMT1p5F1 is shown in SEQ ID NO.1, the nucleotide sequence of the TMTp5F2 is shown in SEQ ID NO.2, and the nucleotide sequence of the TMTp5R is shown in SEQ ID NO.3; the TMT1p6 primer set includes TMT1p6F1, TMTp6F2 and TMTp6R, the nucleotide sequence of the TMT1p6F1 is shown in SEQ ID NO.4, the nucleotide sequence of the TMTp6F2 is shown in SEQ ID NO.5, and the nucleotide sequence of the TMTp6R is shown in SEQ ID NO.

6.

2. A primer set for detecting the rice false smut resistance gene FSR1, characterized in that: The primer set includes a TMT1p5 primer set and a TMT1p6 primer set, wherein the TMT1p5 primer set includes TMT1p5F1, TMTp5F2 and TMTp5R, the nucleotide sequence of the TMT1p5F1 is shown in SEQ ID NO.1, the nucleotide sequence of the TMTp5F2 is shown in SEQ ID NO.2, and the nucleotide sequence of the TMTp5R is shown in SEQ ID NO.3; the TMT1p6 primer set includes TMT1p6F1, TMTp6F2 and TMTp6R, the nucleotide sequence of the TMT1p6F1 is shown in SEQ ID NO.4, the nucleotide sequence of the TMTp6F2 is shown in SEQID NO.5, and the nucleotide sequence of the TMTp6R is shown in SEQ ID NO.

6.

3. A detection kit for the rice false smut resistance gene FSR1 containing the primer set as claimed in claim 2.

4. Use of the molecular marker according to claim 1, the primer set according to claim 2, and the kit according to claim 3 in detecting the rice false smut resistance gene FSR1.

5. A method for detecting the rice false smut resistance gene FSR1, characterized in that: The following steps are involved: The genome of the rice sample to be tested was used as a template, and the TMT1p5 primer set and the TMT1p6 primer set were used for fluorescence quantitative PCR amplification, and the amplification results were genotyped; If both the TMT1p5 primer set and the TMT1p6 primer set detect the corresponding base T, it is judged that the rice does not contain the rice false smut resistance gene FSR1; if both the TMT1p5 primer set and the TMT1p6 primer set detect the corresponding base G, it is judged that the rice contains the rice false smut resistance gene FSR1; if the TMT1p5 primer set and the TMT1p6 primer set detect the bases T and G at the same time, the test material contains a heterozygous FSR1 gene.

6. The method for detecting the rice false smut resistance gene FSR1 according to claim 5, characterized in that: The fluorescent quantitative PCR amplification system comprises HiGeno 2x Probe Mix B, rice gDNA, an amplification primer set and water.

7. The method for detecting the rice false smut resistance gene FSR1 according to claim 5, characterized in that: The fluorescence quantitative PCR amplification program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s; annealing and extension at 61-55°C for 40 s, 10 cycles, reducing annealing and extension by 0.6°C in each cycle; denaturation at 95°C for 20 s; annealing and extension at 55°C for 40 s, 34 cycles.

Images