Application of simvastatin as medicine for rehabilitation treatment after cerebral trauma

Abstract

According to the application of simvastatin as a rehabilitation treatment medicine after cerebral trauma, the medicine acts on the subacute stage of cerebral trauma. The invention relates to a medicine for inhibiting the expression of an extension factor extremely long chain fatty acid protein 1 (Elongation OfVery Long Chain Chelin FattyAcids Like Protein ELOVL). The medicine can be used for inhibiting the expression of the Elongation OfVery Long Chain Chelin FattyAcids Like Protein ELOVL. The medicine improves the motor function recovery of the body after cTBI in the treatment of the cerebral trauma in the subacute stage, and inhibits the excessive activation of astrocytes and the formation of glial scars. The medicine is used for down-regulating ELOVL through an mTOR way.

Description

Technical Field

[0001] The present invention relates to a new mechanism of simvastatin promoting the recovery of neurological function in the subacute phase after brain trauma, and in particular to the application of simvastatin as a drug for rehabilitation treatment after brain trauma. Background Art

[0002] Traumatic brain injury (TBI) is one of the diseases with the highest mortality and disability rates in the world. The pathogenesis of TBI includes primary mechanical injury and secondary injury. Secondary injuries including oxidative stress, inflammation, apoptosis, mitochondrial dysfunction, and increased blood-brain barrier permeability may last for days to months and may further aggravate neurological deficits. This means that TBI is a chronic, evolving disease process. However, when TBI progresses to the subacute and chronic stages, there are currently no other ideal treatments or drugs except rehabilitation training. Therefore, it is very urgent to find drugs that can effectively promote neurological recovery after TBI and have a wide treatment time window.

[0003] Simvastatin is a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor that is widely used in clinical practice for its cholesterol-lowering effect. In a large cohort study of 1,000,000 people aged 65 and above, Khokhar et al. found that previous use of statins was associated with reduced mortality, dementia, stroke, and depression in patients hospitalized for TBI after discharge. A recent randomized clinical trial showed that even in patients with severe brain trauma, oral simvastatin for 10 days immediately after admission significantly improved the Glasgow Coma Scale score. Although not all studies support a clear benefit of simvastatin, current clinical data and epidemiological studies show that statins have good prospects in the treatment of brain trauma. In different clinical cases and animal models of TBI, most studies have shown that taking statins before injury to 24 hours after injury can reduce brain damage by reducing inflammatory response, reducing thrombosis, reducing intracranial hematoma volume, increasing neurogenesis and reducing neuroapoptosis, or inhibiting the activation of microglia and astrocytes. However, there are no reports on whether statins can improve the prognosis of the disease when taken as a rehabilitation drug after TBI in the subacute phase. As a safe drug with few side effects and high compliance rate, statins are widely used in clinical practice. It is of great significance to further expand their clinical indications and extend their treatment time window.

[0004] Although statins are classic lipid-lowering drugs, current studies on statins for TBI treatment mainly focus on their non-lipid-lowering related effects. Some researchers even believe that the mechanism of statins in treating TBI is unrelated to their lipid-lowering effects. It is still unclear whether statins can improve the prognosis of TBI by regulating lipid-related genes. The Elongation Of Very Long Chain Fatty Acids Like Protein (ELOVL) family is a family of seven integral membrane proteins that synthesize very long chain fatty acid esters (VLCFAs) with different chain lengths from 16 to more than 28 carbons. In recent years, the important role of ELOVL1 in many neurological diseases has received increasing attention. In oligodendrocytes (OLs) of cerebral leukodystrophy (ALD), the level of ELOVL1 mRNA is consistent with the VLCFA load. ELOVL1 inhibitors may treat ALD by reducing the concentration of VLCFAs in the central nervous system. Kamierczak et al. reported the first dominant missense mutation in ELOVL1, which caused ichthyosis keratosis, dysmorphic features, spasticity, and moderate hypomyelination in two families, and further pointed out that the mutation may have a much greater effect on VLCFA levels in the skin and brain than on fibroblasts or plasma levels. Interestingly, in 2021, Liddelow et al. found that A1 astrocytes may have toxic effects on central nervous system cells by secreting long-chain saturated lipids, proving that long-chain saturated lipids are a class of neurotoxic molecules that can be secreted by astrocytes. Using astrocyte ELOVL1 conditional knockout mice, they confirmed that downregulating ELOVL1 could inhibit the production of long-chain saturated lipids, thereby alleviating astrocyte-mediated neurotoxicity in in vitro and in vivo optic nerve injury models. Previous studies have shown that many neurological diseases are directly affected by VLCFAs and ELOVL1. Therefore, a better understanding of the role of ELOVL1 and intervention in it may be crucial to the development of effective TBI treatments. Currently, more and more researchers are looking for ELOVL1 inhibitors for the treatment of neurological diseases (such as leukodystrophy). The inhibitors that have been synthesized so far have been hindered from clinical promotion due to their preclinical safety findings in the skin, eyes, and central nervous system. Therefore, if there is a drug that has been widely used in clinical practice and has guaranteed safety that can serve as an inhibitor of ELOVL1 expression, it may promote the progress of the treatment of ELOVL1-related diseases.Statins have been reported to normalize VLCFA levels in oligodendrocytes and alleviate the damage of oligodendrocytes induced by hexadecanoic acid (C26:0) (saturated fatty acids) in glial cells in vitro, and can also reduce neuronal death caused by A1 astrocytes in a Parkinson's disease mouse model. Therefore, we hypothesized that statins may be inhibitors of ELOVL1 expression and produce neurorepair effects in the subacute phase of TBI by downregulating ELOVL1.

[0005] Therefore, this study used a mouse brain cryogenic TBI (cTBI) model and oral administration to observe the effect of delayed simvastatin treatment (initial administration time was 3 to 7 days after cTBI, which is in the subacute period) on neural repair, and constructed an adeno-associated virus vector (AAV-GFAP-ELOVL1) containing the ELOVL1 gene with GFAP as the promoter. This vector specifically expresses ELOVL1 only in astrocytes. AAV-GFAP-ELOVL1 was injected into the cerebral cortex of ICR mice to observe the effect of overexpression of astrocyte ELOVL1 on the neural repair effect of simvastatin, in order to explore new mechanisms for expanding the clinical application of simvastatin, and also to provide new treatment methods or drugs for the rehabilitation treatment of TBI patients in the subacute period. Summary of the invention

[0006] In order to solve the problems existing in the above-mentioned prior art, the object of the present invention is to provide the use of simvastatin as a drug for rehabilitation treatment after TBI.

[0007] To achieve the above object, the technical solution of the present invention is:

[0008] Simvastatin is used as a rehabilitation treatment drug after TBI. The drug acts in the subacute phase of TBI.

[0009] Furthermore, the drug inhibits the expression of ELOVL1.

[0010] Furthermore, the drug promotes the recovery of the body's neurological function and inhibits the excessive activation of astrocytes and the formation of glial scars in the subacute stage of TBI.

[0011] Furthermore, the effect of the drug in improving prognosis in the treatment of subacute TBI is antagonized by overexpressed ELVOL1.

[0012] Furthermore, the drug downregulates ELOVL1 by inhibiting the mTOR pathway.

[0013] Compared with the prior art, the beneficial effects of the present invention are:

[0014] Subacute treatment with simvastatin improved motor function recovery and inhibited astrocyte overactivation and glial scar formation in mice after cTBI;

[0015] Simvastatin exerts its therapeutic effect by inhibiting ELOVL1 expression;

[0016] Simvastatin treatment in the subacute phase downregulates ELOVL1 by inhibiting the mTOR pathway. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Flowchart for the dose-finding trial of simvastatin therapy

[0018] Figure 2 This is a line graph of the balance beam foot error rate in the simvastatin treatment dose-finding trial. ** P<0.01vs cTBI group, *** P<0.001vs cTBI group.

[0019] Figure 3 Flowchart of the time window exploration experiment for simvastatin.

[0020] Figure 4 This is a line graph of the foot error rate in the simvastatin treatment time window exploration experiment. * P<0.05vs cTBI group, ** P<0.01vs cTBI group, *** P<0.001vs cTBI group.

[0021] Figure 5 Flow chart of the experiment to explore the maintenance effect of simvastatin after discontinuation.

[0022] Figure 6 This is a line graph of the foot error rate in an experiment to explore the maintenance effect of simvastatin after discontinuation of treatment. ** P<0.01vs cTBI group.

[0023] Figure 7 A typical picture of immunofluorescence staining of astrocytes.

[0024] Figure 8 Bar graph exploring the regulatory effects of simvastatin on astrocyte hyperactivation after cTBI. *** P<0.001vs cTBI group.

[0025] Fig. 9 This is a typical image of immunofluorescence staining of glial scar.

[0026] Fig.10 Exploring bar graphs for the regulatory effects of simvastatin on glial scar formation after cTBI. **P<0.01vs cTBI group.

[0027] Fig.11 Bar graph showing the regulatory effect of delayed simvastatin administration on ELOVL1 mRNA 14 days after cTBI. ** P<0.01vs cTBI group, *** P<0.001vs cTBI group.

[0028] Fig.12 The protein band diagram and bar graph show the regulatory effect of delayed administration of simvastatin on ELOVL1 protein expression 14 days after cTBI. ** P<0.01vs cTBI group.

[0029] Fig.13 This is a typical immunofluorescence image of positive virus AAV-GFAP-ELOVL1 overexpression in the brain.

[0030] Fig.14 This is a bar graph showing protein validation of ELOVL1 overexpression in the brain. ** P<0.01 vs cTBI group

[0031] Fig.15 The figure is a line graph showing the recovery of motor function in mice treated with negative virus (AAV-GFAP-Contol) and positive virus (AAV-GFAP-ELOVL1) after delayed administration of simvastatin. * P<0.05vs AAV-GFAP-ELOVL1-cTBI group. ## P<0.01vs AAV-GFAP-Control-cTBI group, @ P<0.05vs

[0032] AAV-GFAP-ELOVL1-cTBI+Sim group, @@ P<0.01vsAAV-GFAP-ELOVL1-cTBI+Sim group.

[0033] Fig.16 A typical diagram of the total length of dendritic branches showing neuronal morphological changes (Golgi staining).

[0034] Fig.17 The bar graph shows the total length of dendritic branches in neuronal morphology changes (Golgi staining). * P<0.05 vscTBI group, ** P<0.01vs cTBI group, *** P<0.001vs cTBI group.

[0035] Fig.18This is a line graph showing the effect of mTOR agonist L-leucine on the neurological function recovery of mice with delayed administration of simvastatin. ** P<0.01vs cTBI group, *** P<0.001vs cTBI group, # P<0.05vs cTBI+Sim+L-Leu group, ## P<0.001vs cTBI+Sim+L-Leu group.

[0036] Fig.19 The bar graph and column graph show the changes in ELOVL1 protein expression. * P<0.05.

[0037] Fig. 20 These are the bar graphs and column graphs showing the changes in expression of mTOR and p-mTOR proteins. * P<0.05,.

[0038] Fig.21 The bar graph and column graph of 4EBP1 and p-4EBP1 protein expression changes * P<0.05, ** P<0.01. DETAILED DESCRIPTION

[0039] 1. Methods

[0040] 1. Establishment of cTBI model

[0041] ICR (Institute of Cancer Research) mice (purchased from the Experimental Animal Center of Shanxi Medical University) were used in this experiment. Male ICR mice aged 8-9 weeks were anesthetized by intraperitoneal injection of sodium pentobarbital (45 mg / kg, ip) and fixed on a mouse brain stereotaxic instrument. After disinfection with alcohol, the scalp was cut along the midsagittal direction of the scalp to expose the skull. A circular area with a diameter of 3 mm was drawn with bregma as the origin (0,0), 0.5 mm forward and 2 mm to the right (0.5,2) as the center. A copper rod (3 mm) pre-cooled with liquid nitrogen was pressed on the mouse skull with a force of 180 g for 30 seconds, the scalp was sutured, and the mouse body temperature was maintained at 36-37°C using a heating pad until it was fully awake. The control group underwent a sham operation, but the brain was not frozen.

[0042] 2. Medication

[0043] Simvastatin (MCE, USA, #HY-17502) was dissolved in anhydrous ethanol (EtOH) (10 mg / mL) as a stock solution. The final drug solution was diluted before use with a dilution ratio of 10% EtOH and 90% saline containing 20% ​​SBE-β-CD. Mice were given simvastatin 1 mg / kg, 2 mg / kg, or 5 mg / kg daily by gavage on days 1-14, 3-14, 514, or 7-14 after cTBI. The specific protocol is shown in Figure 1 , 3 5. The m-TOR agonist L-leucine (MCE, USA, #HY-N0486) was dissolved in PBS (4.5 mg / ml). Mice were intraperitoneally injected with 45 mg / kg L-leucine daily from day 3 to day 14 after cTBI, 30 minutes before simvastatin administration. The sham-operated mice were given the same solvent control.

[0044] 3. Balance beam experiment

[0045] Three days before cTBI modeling, mice were trained to adapt to the condition so that they could cross a balance beam 30 cm above the ground, 0.8 cm in diameter, and 100 cm long, without slipping, and the training was repeated three times a day for three consecutive days. The mice were tested on the balance beam 3, 7, and 14 days after cTBI to evaluate their motor function. The total number of steps and slips of the left hind limbs in three repeated experiments (5 min intervals) were recorded, and the slip rate = slip number / total number of steps × 100%. If some mice were unable to pass the balance beam due to severe motor function defects, their slip rate was recorded as 100%.

[0046] 4. Real-time fluorescence quantitative PCR

[0047] Total RNA from tissues in the peri-infarct area and the corresponding area of ​​the sham operation group was extracted using a total RNA extraction kit (Sangon, China, #B511311). Then, cDNA was prepared using the M5 Super-qPCR RT Kit with gDNA removal agent (Mei5bio, China, #MF166), and real-time quantitative PCR was performed on the CFX96TM real-time system (Bio-Rad Laboratories, USA) using HiefUNICON-qPCR SYBR Green MasterMix (Yeasen, Shanghai, #11198ES08) for cDNA amplification and signal detection. Mouse GAPDH was used as an internal reference. The primer sequences are as follows:

[0048] Elovl1:Fwd:GAAGCACTTCGGATGGTTCG;

[0049] Rev:CACCACCAACTCCAGGGA

[0050] GAPDH:Fwd:GTCGGTGTGAACGGATTTGG;

[0051] Rev:GCTCCTGGAAGATGGTGATGG

[0052] 5. AAV Virus Injection

[0053] The AAV viruses injected in this experiment included AAV-GFAP-control negative virus (HBAAV-2 / 9-GFAP-EGFP) and AAV-GFAP-ELOVL1 positive virus (HBAAV2 / 9-GFAP-m-Elovl1-3xflag-EGFP). After anesthesia with sodium pentobarbital (45 mg / kg, ip), the mice were fixed on a stereotaxic apparatus, and the scalp was cut along the midbrain suture line with scissors to fully expose the skull. The skull surface tissue was wiped with a sterile cotton swab and the surface was kept dry. Referring to the stereotaxic atlas of the mouse brain, first use the Bregma point as the origin, and then accurately mark the four sites for AAV vector injection into the brain parenchyma on the right side of the brain: (1.2mm right of the Bregma, 1.19mm anterior, 1.5mm depth), (2.4mm right of the Bregma, 1.1mm posterior, 1.75mm depth), (1.3mm right of the Bregma, 0mm anterior, 1.5mm depth), (2.7mm right of the Bregma, 0mm anterior, 1.75mm depth), aim the cranial drill at the above sites to drill holes. Use a microinjection pump to inject the AAV vector into the brain parenchyma at an injection rate of 0.1μl / min and an injection volume of 1μl / site. After 10 minutes of injection at each hole, the needle must be stopped for 10 minutes before the injection needle can be slowly removed. Finally, suture the scalp and disinfect it, remove the mouse from the adapter, and use a heating pad to keep the mouse body temperature at 36-37°C until it is fully awake.

[0054] 6. Tissue Immunofluorescence

[0055] The brains of mice were removed by perfusion 2 weeks after cTBI, and then fixed in 4% paraformaldehyde and dehydrated in 15% and 30% sucrose solutions to completely sink the brain tissue. The brain tissue was cut into a series of 20 μm thick coronal sections using a freezing microtome. The brain sections were fixed with sodium citrate buffer (0.01M, pH 6.0) at 80°C for 30 minutes, permeabilized with 10% Triton X-100 for 30 minutes, blocked with 10% donkey serum at room temperature for 2 hours, and incubated with primary antibodies rabbit anti-GFAP (1:2000, Abcam, Ab278054) and goat anti-Iba-1 (1:400, Novus Biologicals, NB100-1028) at 4°C overnight. Subsequently, the sections were incubated with the corresponding secondary antibodies donkey anti-rabbit IgG Alexa Fluor 488 (1:400, Yeasen, 34206ES60) and donkey anti-goat IgG Alexa Fluor 594 (1:400, Yeasen, 34312ES60) at room temperature for 2 hours. Finally, 4′, 6-diamidino-2-phenylindole (DAPI) staining solution was used for incubation at room temperature for 10 minutes, and the sections were sealed with anti-fluorescence attenuation mounting medium. The fluorescence signal of the peri-infarction area was photographed using a laser confocal scanning microscope (Olympus, FV3000, Japan).

[0056] 7. Western blot

[0057] Two weeks after cTBI, mice were sacrificed by cervical dislocation, and the brains were removed and the cortical tissues were separated. The tissues were lysed in RIPA lysis buffer containing protease and phosphatase inhibitors. Equal amounts of protein were electrophoresed using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel and transferred to polyvinylidene fluoride (PVDF) membranes. The PVDF membrane was incubated with 5% skim milk at room temperature for 2 hours, and then the PVDF membrane was placed in the primary antibody rabbit anti-ELOVL1 (1:1000, Thremo Fisher, PA5-104373), rabbit anti-GAPDH (1:2500, Cell Signaling Technology, 2118S), rabbit anti-mTOR (1:2000, Cell Signaling Technology, 2983T), rabbit anti-p-mTOR (1:2000, Cell Signaling Technology, 5536S), rabbit anti-4EBP1 (1:2000, Cell Signaling Technology, 9644T), rabbit anti-p-4EBP1 (1:2000, Cell Signaling Technology, 2855S), and incubated overnight at 4°C. Subsequently, goat anti-rabbit (1:5000, Boster, Ba1054) horseradish peroxidase (HRP) secondary antibody was incubated for 2 hours at room temperature. Immunoblot images were visualized using the ECL ultrasensitive chemiluminescence kit on a Bio-Rad imaging system.

[0058] 8. Golgi staining

[0059] FD Rapid GoljiAStain Kit (PK401) was used for Golgi staining. Two weeks after cTBI, mice were killed by cervical dislocation. After washing the brain tissue, it was placed in a liquid mixed with Solution A and Solution B in equal proportions. After being fixed at room temperature in the dark for 2 weeks, it was transferred to Solution C and fixed at room temperature in the dark for 3 days. After being quickly frozen with dry ice and isopentane, 100 μm thick slices were cut and fixed at room temperature in the dark for 3 days. The slices were washed with Milli-Q water and placed in a mixture of Solution D, Solution E and Milli-Q (mixed in a ratio of 1:1:2). The slices were washed with Milli-Q water and dehydrated with gradient ethanol (50%-100%). Xylene was transparent and the slices were sealed with neutral gum. The slices were photographed using a laser confocal scanning microscope (Olympus, FV3000, Japan), and the complexity of neuronal branching was calculated using Image J.

[0060] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments:

[0061] Experimental Example 1. Experimental study on the therapeutic dose of simvastatin

[0062] Male ICR mice were randomly divided into 5 groups: sham operation group, cTBI group, 1mg / kg, 2mg / kg and 5mg / kg simvastatin treatment groups, 6 mice in each group. The drug treatment groups were gavaged daily from 1 day after cTBI to 14 days. Balance beam test was performed on days 3, 7 and 14 after cTBI to evaluate the recovery of motor function of mice ( Figure 1 ), and the optimal therapeutic concentration was determined to be 1 mg / kg.

[0063] Experimental Example 2. Exploration of the time window for simvastatin treatment

[0064] Male ICR mice were randomly divided into sham operation group, cTBI group and simvastatin treatment group with different starting time of administration, 6 mice in each group. The drug treatment group was given simvastatin 1 mg / kg daily by gavage for 14 days starting from 1, 3 and 7 days after cTBI. The mice in all groups were subjected to balance beam test on days 3, 7 and 14 after cTBI to evaluate the recovery of motor function of mice and explore the treatment time window ( Figure 3 ). The results showed that delaying the administration of simvastatin to 7 days after cTBI can still significantly improve motor function.

[0065] Experimental Example 3. Effect of delayed administration of simvastatin on ELOVL1 mRNA and protein expression on day 14 after cTBI

[0066] Male ICR mice were randomly divided into sham operation group, cTBI group and simvastatin delayed administration group. Peri-infarction tissues were collected on day 14 after cTBI. Real-time fluorescence quantitative PCR and WB techniques were used to detect the expression of ELOVL1 mRNA and protein in sham operation group, cTBI group and simvastatin delayed administration group ( Fig.11 , 12). The results showed that delayed administration of simvastatin significantly inhibited the overexpression of ELOVL1 caused by cTBI ( Fig.11 , 12).

[0067] Experimental Example 4. Effect of ELOVL1 activation on simvastatin-induced motor function recovery and neural repair

[0068] We constructed an adeno-associated virus vector containing the ELOVL1 gene with GFAP as the promoter (AAV-GFAP-ELOVL1) and an empty vector virus (AAV-GFAP-Control). The AAV virus was constructed by Hanheng Biotechnology Company and its original name was HBAAV2 / 9-GFAP-m-ELOVL1-3xflag-EGFP, abbreviated as AAV-GFAP-ELOVL1.

[0069] Male ICR mice were divided into a negative virus group (AAV-GFAP-Control) and a positive virus group (AAV-GFAP-ELOVL1), and adenovirus (AAV) was injected into the brain parenchyma two weeks before cTBI. Each group was further divided into a sham operation group, a cTBI group, and a simvastatin treatment group, with 6 mice in each group. The drug treatment group began to take simvastatin orally every day from 3 days after cTBI to 14 days, and a balance beam experiment was performed 3, 7, 10, and 14 days after cTBI to evaluate the recovery of motor function in each group of mice and explore whether activation of ELOVL1 can reverse the protective effect of simvastatin on the motor function of mice. The results showed that ELOVL1 overexpression antagonized the neurorepair effect of simvastatin. Golgi staining was used to observe the length of dendrites of neurons in the peri-infarct area to evaluate the effect of overexpression of ELOVL1 on the neurorepair effect of simvastatin.

[0070] Experimental Example 5: Role of the mTOR pathway in the downregulation of ELOVL1 by simvastatin.

[0071] Male ICR mice were randomly divided into sham operation group, cTBI group, simvastatin treatment group, and L-leucine treatment group. The drug treatment group was orally administered simvastatin / simvastatin + L-leucine daily starting 3 days after cTBI for 14 days. Balance beam experiments were performed 3, 7, and 14 days after cTBI to evaluate the recovery of motor function in each group of mice. The expression of ELOVL1, mTOR, p-mTOR, 4EBP1, and p-4EBP1 proteins was used to evaluate whether the mTOR pathway was involved in the regulation of ELOVL1 by simvastatin.

[0072] result

[0073] 1. Delayed administration of simvastatin improved the motor function of mice after cTBI, inhibited the excessive activation of astrocytes, and reduced glial scar formation.

[0074] To explore the optimal dose of simvastatin to improve neurological function in mice, we performed a dose-response analysis. 1-14 days after cTBI, mice were gavaged daily with 1 mg / kg, 2 mg / kg, or 5 mg / kg of simvastatin ( Figure 1). Compared with the cTBI group, the percentage of foot errors in the balance beam test was significantly reduced in all dose groups at 7 and 14 days after injury, and the level of motor function recovery was similar in all groups at 14 days. ( Figure 2 ). Since the decrease in the percentage of foot errors in the 1 mg / kg dose group 14 days after cTBI was not significantly different from that in the other dose groups, and the strongest functional recovery was shown on day 7, this dose will be used for subsequent experiments. . To investigate the therapeutic time window of simvastatin, 1 mg / kg simvastatin was applied on days 1-14, 3-14, 5-14, or 7-14 after cTBI ( Figure 3 Compared with the cTBI group, the percentage of foot errors on day 14 was significantly reduced in all treatment groups ( Figure 4 These results suggest that delaying simvastatin administration until at least 7 days after cTBI can still produce motor benefits ( Figure 4 ), which suggests that intragastric administration of simvastatin may have a wider time window in the treatment of cTBI. To investigate whether simvastatin still has a maintenance effect after discontinuation of simvastatin, 1 mg / kg simvastatin ( Figure 5 ), and the percentage of foot errors was observed on day 21. The results showed that 7 days after stopping the drug, the percentage of foot errors in the simvastatin group was still lower than that in the cTBI group ( Figure 6 ), the protective effect of simvastatin still existed. Since the group with simvastatin 1 mg / kg given on days 3-14 had the best overall performance among all the expanded time window groups, this condition was adopted in subsequent experiments.

[0075] We then further investigated whether delayed administration of simvastatin in the peri-infarct region could inhibit astrocyte overactivation and glial scar formation ( Figure 7 , Fig. 9 ). On day 14 after cTBI, the delayed administration of simvastatin significantly reduced the number of GFAP-positive astrocytes and the thickness of glial scar in the peri-infarct area compared with the cTBI group. ( Figure 8 , Fig.10 ).

[0076] The above results indicate that delayed administration of simvastatin promoted the recovery of motor function in mice and inhibited the excessive activation of astrocytes and the formation of glial scars after cTBI.

[0077] Effect of delayed administration of simvastatin on the expression of ELOVL1 mRNA and protein in peri-infarct tissue on day 14 after cTBI

[0078] To explore whether ELOVL1 is a potential therapeutic target of simvastatin, we collected peri-infarct tissues on the 14th day after cTBI and detected the expression of ELOVL1 mRNA and protein in the sham operation group, cTBI group, and simvastatin delayed administration group by real-time fluorescence quantitative PCR and WB technology. On the 14th day after cTBI, the mRNA and protein expression of ELOVL1 in the cTBI group was significantly upregulated compared with the sham operation group ( Fig.11 , 12), while delayed administration of simvastatin significantly inhibited the overexpression of ELOVL1 induced by cTBI ( Fig.11 , 12). This suggests that simvastatin may exert its neuroprotective effect by inhibiting ELOVL1 expression.

[0079] 4. Effect of astrocyte ELOVL1 overexpression on simvastatin-induced motor function recovery and neural repair

[0080] To further investigate the potential role of astrocyte-expressed ELOVL1 in the protective mechanism induced by delayed administration of simvastatin, we injected AAV-GFAP-ELOVL1 or AAV-GFAP-Control into the peri-infarct cortex of mice 2 weeks before cTBI. After AAV injection, we observed that EGFP was expressed and co-localized with GFAP in the peri-infarct cortex of injected mice by confocal microscopy ( Fig.13 ). On the 7th day after cTBI, we found that ELOVL1 protein was overexpressed in the cortex around the infarction of mice injected with AAV-GFAP-ELOVL1 by WB detection ( Fig.14 ).

[0081] In the AAV-GFAP-Control injected group, delayed administration of simvastatin significantly reduced the percentage of foot errors in the balance beam test on days 7, 10, and 14 after cTBI ( Fig.15 ). However, this effect was inhibited by ELOVL1 overexpression in the AAV-GFAP-ELOVL1-injected group of mice. This suggests that AAV-GFAP-ELOVL1 injection reversed the functional recovery caused by delayed administration of simvastatin after cTBI. Further, using Golgi staining, we observed changes in total dendritic length in the peri-infarct area ( Fig.16 ). The cTBI groups in AAV-GFAP-Control and AAV-GFAP-ELOVL1 mice showed a decrease in total dendritic length compared with the corresponding control groups. Simvastatin significantly increased the total dendritic length in AAV-GFAP-Control mice compared with the cTBI group, but in AAV-GFAP-ELOVL1 mice, this effect was inhibited by ELOVL1 overexpression ( Fig.17 ).

[0082] These results indicate that ELOVL1 overexpression partially prevents the beneficial effects of delayed simvastatin administration, suggesting that delayed simvastatin administration promotes functional recovery and neural repair at least in part by inhibiting brain-derived ELOVL1.

[0083] 5. Delayed administration of simvastatin downregulates ELOVL1 via the mTOR pathway

[0084] L-leucine is an agonist of the mTOR pathway, and we used it to investigate the role of mTOR in the regulation of ELOVL1 by simvastatin. In the balance beam test, delayed administration of simvastatin significantly reduced the foot error rate at 7, 10, and 14 days after cTBI ( Fig.18 ), while L-leucine administration reversed this effect ( Fig.18 ). The above results indicate that L-leucine administration inhibited the protective effect of simvastatin on motor function after cTBI. Next, the effect of L-leucine administration on the inhibition of ELOVL1 protein expression by delayed simvastatin administration was evaluated 14 days after cTBI. L-leucine administration reversed the effect of simvastatin on the inhibition of ELOVL1 protein overexpression ( Fig.19 ). The above results indicate that the inhibitory effect of delayed administration of simvastatin on ELOVL1 expression was reversed by L-leucine.

[0085] In addition, at 14 days after cTBI, the protein expressions of mTOR, p-mTOR, 4EBP1, and p-4EBP1 (downstream targets of mTOR) were significantly increased ( Fig. 20 , 21). Late treatment with simvastatin suppressed the upregulation of mTOR pathway proteins and their downstream target proteins induced by cTBI. L-leucine could reverse this inhibitory effect. These results suggest that simvastatin may play a positive role in TBI prognosis by regulating ELOVL1 expression through the mTOR pathway.

[0086] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that are not conceived through creative work should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope defined in the claims.

Claims

1. The use of simvastatin as a drug for rehabilitation treatment after brain trauma, characterized in that: The drug acts in the subacute phase of brain trauma.

2. The use according to claim 1, characterized in that: The drug inhibits ELOVL1 expression.

3. The use according to claim 1, characterized in that: The drug promotes the recovery of the body's nerve function after brain trauma in the treatment of subacute brain trauma, and inhibits the excessive activation of astrocytes and the formation of glial scars.

4. The use according to claim 1, characterized in that: The effect of the drug in improving neurological dysfunction in the subacute stage of brain trauma is antagonized by overexpressed ELVOL1.

5. The use according to claim 1, characterized in that: The drug downregulates ELOVL1 by inhibiting the mTOR pathway.

Images