ISG15-(H4)2-IFN-λ3 recombinant protein and its application

Abstract

The present invention belongs to the field of biotechnology and specifically relates to ISG15-(H4) 2 ‑IFN‑λ3 recombinant protein and its application. The present invention provides ISG15‑(H4) 2 ‑IFN‑λ3 recombinant protein, the ISG15‑(H4) 2 ‑IFN‑λ3 recombinant protein via linker peptide (H4) 2 Linking ISG15 to IFN‑λ3, the ISG15‑(H4) 2 The IFN-λ3 recombinant protein has an amino acid sequence as shown in SEQ ID NO: 1. The present invention solves the technical problems in the prior art of low expression of IFN-λ3 protein, high production cycle and production cost, and difficulty in large-scale production and application.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an ISG15-(H4)2-IFN-λ3 recombinant protein and an application thereof. Background Art

[0002] IFN is a protein with antiviral activity produced by host cells under the action of viruses or other stimulating factors. It has a broad spectrum of antiviral and immunomodulatory effects and plays an important role in natural immunity. Interferon can be divided into three major families according to its encoding gene sequence and receptor type: IFN-I, IFN-II, and IFN-III. IFN-III is mainly produced by epithelial cells, and the IFN-III receptor is composed of IFN-λ receptor 1 (Interferon Lambda Receptor 1, IFNLR1) and interleukin 10 receptor 2 (Interleukin 10 Receptor 2, IL10R2). IFNLR1 receptor is only expressed in some cells, mainly located in epithelial cells, especially in epithelial cells of the kidneys, lungs and gastrointestinal tract, and also in some immune cells such as neutrophils, B lymphocytes, dendritic cells, etc. IFN-Ⅲ is considered to be an antiviral cytokine in the natural immune response. Its family members all show antiviral activity against a series of viruses, especially against epithelial cells in the gastrointestinal tract, lungs and other parts. It can provide effective antiviral effects. This is mainly because most of the IFNLR1 receptors of IFN-Ⅲ are located in epithelial tissues. In viral infections of epithelial cells, epithelial cells promote the production of IFN-Ⅲ by expressing more peroxisomes and TLRs and act on adjacent epithelial cells to induce the antiviral effect of epithelial cells. In mucosal-associated viral infections, epithelial cells mainly produce IFN-Ⅲ and act on adjacent epithelial cells to exert antiviral effects. Therefore, IFN-Ⅲ is also considered to be the first barrier of mucosal defense.

[0003] IFN-Ⅲ also has a strong immunomodulatory function. The expression level of IFNLR1 receptor on the surface of immune cells such as neutrophils is high. When neutrophils are stimulated by IFN-λ, the JAK / STAT pathway is activated, reducing the production and degranulation of reactive oxygen species (ROS), but does not change the ability of neutrophils to exert biological activities such as cytokine production and phagocytosis, thereby reducing the inflammatory response and tissue damage at the site of infection. In addition, IFN-λ stimulation can inhibit the production of neutrophil extracellular traps (NETS) and limit the migration ability of neutrophils. IFN-λ also affects the activity of NK cells and can induce NK cells to exert anti-tumor effects.

[0004] Interferon-stimulated Gene 15 (ISG15) is an interferon-induced ubiquitin-like protein, a member of the ubiquitin-like protein family, and plays an important role in the host's response to viral infection. Among the ISGs produced in the initial stage of the innate immune response, ISG15 is one of the ISGs with the highest expression level after IFN stimulation of cells. ISG15 functions by coupling with protein substrates through a three-stage enzyme cascade reaction, namely ISG modification (ISGylation). Studies have shown that ISGylation modification does not seem to directly degrade the target protein, but indirectly regulates the degradation of the target protein and affects the function of the protein by competing with ubiquitin for ubiquitin binding sites on the protein. ISG15-mediated ISGylation has an inhibitory effect on a variety of viruses, such as vaccinia virus, Newcastle disease virus, hepatitis C virus, and Japanese encephalitis virus. ISGylation can inhibit the replication of the viral genome by targeting proteins when the virus infects cells, and can also inhibit the discharge of the virus by targeting host proteins required for viral budding and release. In addition, ISGylation can target proteins related to host metabolism and thus affect the replication of the viral genome. In addition to mediating ISGylation modification, ISG15 can also be secreted into the extracellular space in an uncoupled form to play a cytokine-like role. After being stimulated by IFNs or other pathogenic factors, ISG15 can be secreted and released by a variety of cells such as fibroblasts, neutrophils, monocytes and lymphocytes. ISG15 can play a cytokine-like function to participate in the host immune regulation function.

[0005] At present, in addition to separation from pig leukocytes, the production of IFN mainly relies on genetic engineering methods for expression and purification. The target gene of IFN is inserted into the host gene to induce the host gene to express IFN, and then purified by a certain method to obtain IFN. Commonly used IFN expression systems include Escherichia coli expression system, yeast expression system, baculovirus expression system, adenovirus expression system, etc. The protein activity produced by baculovirus and yeast expression systems is better than that of Escherichia coli expression system, and can be correctly folded and exert biological activity, but the protein expression level is low, the production cycle and production cost are high, and it is difficult to produce and apply on a large scale. The Escherichia coli expression system has low production cost, short production cycle, and high protein expression level. Therefore, the expression of IFN using the Escherichia coli expression system is more suitable for application in production practice. However, proteins produced by the E. coli expression system are mostly expressed as inclusion bodies, which are difficult to fold correctly and renature successfully. For example, Lian Danhua (“Expression, Purification and Activity Identification of Type III Interferon IFN-λ” [D]) constructed a BL21 / pET26b(+) / IFN-λ3 prokaryotic expression strain and successfully induced soluble IFN-λ3 recombinant protein using 1 μg / mL IPTG inducer, but the overall expression level of the recombinant protein in the periplasm was low.

[0006] Therefore, how to achieve large-scale production of IFN-λ3 is a major technical problem faced in the development of IFN-Ⅲ preparations. Summary of the invention

[0007] In order to solve the technical problems in the prior art of low IFN-λ3 protein expression, high production cycle and production cost, and difficulty in large-scale production and application, the present invention aims to provide an ISG15-(H4)2-IFN-λ3 recombinant protein and its application.

[0008] In order to achieve the above object, the present invention provides the following technical solutions:

[0009] In a first aspect, the present invention provides an ISG15-(H4)2-IFN-λ3 recombinant protein, wherein the ISG15-(H4)2-IFN-λ3 recombinant protein connects ISG15 and IFN-λ3 via a connecting peptide (H4)2, and the ISG15-(H4)2-IFN-λ3 recombinant protein has an amino acid sequence as shown in SEQ ID NO:1.

[0010] In a second aspect, a polynucleotide is provided, wherein the polynucleotide encodes the ISG15-(H4)2-IFN-λ3 recombinant protein of the present invention, and the polynucleotide has a nucleotide sequence as shown in SEQ ID NO:2.

[0011] In a third aspect, a polynucleotide construct is provided, wherein the polynucleotide construct comprises the polynucleotide according to the present invention.

[0012] In a fourth aspect, a host cell is provided, wherein the host cell contains the polynucleotide according to the present invention.

[0013] In a fifth aspect, a recombinant vector pET-28a-ISG15-(H4)2-λ3 is provided, wherein the recombinant vector pET-28a-ISG15-(H4)2-λ3 contains the polynucleotide described in the present invention.

[0014] In a sixth aspect, a recombinant strain is provided, wherein the recombinant strain contains the recombinant vector pET-28a-ISG15-(H4)2-λ3 as described in the present invention.

[0015] Preferably, the recombinant strain is Escherichia coli.

[0016] More preferably, the recombinant strain is Escherichia coli BL21 (DE3).

[0017] In the seventh aspect, a method for large-scale preparation of IFN-λ3 protein is provided, the method comprising: transforming the recombinant vector pET-28a-ISG15-(H4)2-λ3 described in the present invention into competent cells to obtain recombinant bacteria, and obtaining ISG15-(H4)2-IFN-λ3 recombinant protein by inducing expression.

[0018] Preferably, the competent cells are competent cells BL21 (DE3).

[0019] Preferably, the ISG15-(H4)2-IFN-λ3 recombinant protein is used to prepare a drug for preventing and / or treating animal diseases caused by viral infection, and the virus is Newcastle disease virus NDV or porcine reproductive and respiratory syndrome virus PRRSV.

[0020] Preferably, the animal is a pig.

[0021] In an eighth aspect, there is provided a use of the ISG15-(H4)2-IFN-λ3 recombinant protein of the present invention in the preparation of a drug, wherein the drug is used to activate the JAK / STAT signaling pathway of cells and induce the production of ISGs.

[0022] With respect to the prior art, the beneficial effects of the present invention are:

[0023] First, the present invention selects different connecting peptides: RL, HL, (H4)2, to connect ISG15 with IFN-λ3 to promote the biological activity of ISG15-IFN-λ3. Studies have shown that after ISG15 and IFN-λ3 are connected by RL and HL, although the protein expression level is improved, a large amount of precipitation is found in PBS, and it is difficult to renature successfully. The ISG15-(H4)2-IFN-λ3 recombinant protein using the (H4)2 connecting peptide is successfully renatured and dialyzed into PBS, and the expression level and stability are significantly improved. Under the same conditions, the present invention selects the (H4)2 connecting peptide to connect ISG15 and IFN-λ3, which can achieve stable and large-scale expression of IFN-λ3 protein, solves the technical problem that IFN-λ3 cannot be mass-produced using a prokaryotic expression system, and its purified yield is more than 4 times that when RL and HL are used as connecting peptides, about 4.4 times and 4.6 times, respectively, achieving unexpected technical effects and laying a foundation for large-scale and low-cost mass production of IFN-λ3.

[0024] Second, the present invention added different doses of ISG15-(H4)2-IFN-λ3 to immortalized porcine alveolar macrophages CRL2843 and treated the cells for 12 hours to detect the ability of inducing downstream genes ISG15 and ISG56. Western Blot and qPCR results showed that ISG15-(H4)2-IFN-λ3 recombinant protein could successfully induce the upregulation of cellular ISG15 and ISG56 genes, and the induction level was positively correlated with the dose of ISG15-(H4)2-IFN-λ3 recombinant protein, indicating that ISG15-(H4)2-IFN-λ3 recombinant protein successfully activated the JAK / STAT signaling pathway and induced the production of ISGs. The inhibitory ability of ISG15-(H4)2-IFN-λ3 recombinant protein on NDV-GFP and PRRSV was further detected. The results showed that the decrease in the number of GFP-positive cells indicated that ISG15-(H4)2-IFN-λ3 recombinant protein also showed an inhibitory effect on viral infection. This is because the ISGs induced by ISG15-(H4)2-IFN-λ3 recombinant protein put the cells into an antiviral state, thereby inhibiting the proliferation of NDV-GFP. Similarly, it has an inhibitory effect on PRRSV infection. It can be seen that the ISG15-(H4)2-IFN-λ3 recombinant protein expressed and purified by the present invention has good biological activity and can be used for the production of drugs for preventing and / or treating animal diseases caused by viral infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solution of the present invention, the drawings involved in the description of the embodiments will be briefly introduced below. Obviously, the drawings in the description are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1a The expression of ISG15-(H4)2-IFN-λ3 recombinant protein; A: SDS-PAGE identification; B: Western Blot identification, M: protein marker; 1: without IPTG induction; 2: IPTG induction; 3: induced supernatant; 4: induced precipitate.

[0027] Figure 1b The expression of ISG15-HL-IFN-λ3 recombinant protein; A: SDS-PAGE identification; B: Western Blot identification, M: protein marker; 1: without IPTG induction; 2: IPTG induction; 3: induced supernatant; 4: induced precipitate.

[0028] Figure 1c The expression of ISG15-RL-IFN-λ3 recombinant protein; A: SDS-PAGE identification; B: Western Blot identification, M: protein marker; 1: without IPTG induction; 2: IPTG induction; 3: induced supernatant; 4: induced precipitate.

[0029] Figure 1d The expression of IFN-λ3 monomer protein.

[0030] Figure 2 Purification of ISG15-IFN-λ3 recombinant protein; A: Nickel column purification conditions of ISG15-(H4)2-IFN-λ3 recombinant protein; 1: Before protein loading; 2: Effluent; 3: 10mM elution; 4: 20mM elution; 5: 50mM elution; 6: 100mM elution; 7: 250mM elution; B: Inclusion body purification of ISG15-RL-IFN-λ3 recombinant protein and ISG15-HL-IFN-λ3 recombinant protein; 1: ISG15-RL-IFN-λ3 recombinant protein; 2: ISG15-HL-IFN-λ3 recombinant protein; C: ISG15-(H4)2-IFN-λ3 recombinant protein dialyzed in PBS; D: ISG15-RL-IFN-λ3 recombinant protein and ISG15-HL-IFN-λ3 recombinant protein were dialyzed in PBS; 1: ISG15-RL-IFN-λ3 recombinant protein; 2: ISG15-HL-IFN-λ3 recombinant protein.

[0031] Figure 3The biological activity of ISG15-(H4)2-IFN-λ3 recombinant protein was detected for CRL2843 cells; A: Western Blot detection of ISG15 protein induction level; 1: negative control; 2: 100ng ISG15-IFN-λ3; 3: 500ng ISG15-IFN-λ3; 4: 1000ng ISG15-IFN-λ3; 5: positive control. B: Fluorescence quantitative detection of ISG15 gene induction level; C: Fluorescence quantitative detection of ISG56 gene induction level; Among them, MOCK refers to the blank control without any treatment, and IFN-α refers to the positive control stimulated by IFN-α protein.

[0032] Figure 4 The ability of ISG15-(H4)2-IFN-λ3 recombinant protein to inhibit the replication of NDV-GFP was detected in CRL2843 cells.

[0033] Figure 5 The anti-PRRSV activity of PAMs cells was tested after the ISG15-(H4)2-IFN-λ3 recombinant protein (ISG15-IFN-λ3) and PRRSV virus were treated simultaneously; A: Western blot was used to test the replication level of PRRSV virus; 1:1000U ISG15-IFN-λ3+0.2 MOI JXA1; 2:500U ISG15-IFN-λ3+0.2 MOI JXA1; 3:250U ISG15-IFN-λ3+0.2 MOI JXA1; 4:0.2 MOI JXA1; B: Fluorescence quantitative PCR was used to test the replication level of PRRSV virus. DETAILED DESCRIPTION

[0034] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0035] Example 1 Expression and purification of fusion protein

[0036] 1.1 Plasmids and strains

[0037] Plasmid: pET-28a-ISG15-HL-IFN-λ3, pET-28a-ISG15-RL-IFN-λ3, pET-28a-ISG15-(H4)2-IFN-λ3, and pET-28a-λ3 recombinant expression plasmids were fully synthesized by Nanjing Qingke Biotechnology Co., Ltd.

[0038] The amino acid sequences of the connecting peptides are as follows: the amino acid sequence of the RL connecting peptide is PAPAP, the amino acid sequence of the HL connecting peptide is AEAAAKEAAAKA, and the amino acid sequence of the (H4)2 connecting peptide is LEA(EAAAK)4ALEA(EAAAK)4ALE.

[0039] Bacteria: Competent cells BL21 (DE3) were purchased from Beijing Transgene Biotechnology Co., Ltd.

[0040] 1.2 Expression of ISG15-IFN-λ3 fusion protein

[0041] 1.2.1 Conversion

[0042] (1) Take out three tubes of competent cells BL21 (DE3) from -80℃ and place them on ice, waiting for them to thaw naturally;

[0043] (2) Take 1 μL of ISG15-HL-IFN-λ3, ISG15-RL-IFN-λ3, and ISG15-(H4)2-IFN-λ3, respectively, and add them to the competent cells BL21 (DE3) and mark them;

[0044] (3) Ice bath for 30 min, heat shock in 42°C water bath for 90 s, ice bath for 3 min;

[0045] (4) Add 500 μL of antibiotic-free liquid LB (tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, dilute to 1 L with deionized water, sterilize by high pressure for later use) and incubate at 37 °C in a shaking incubator for 20 min;

[0046] (5) Pour the shaken bacterial liquid onto a kanamycin-resistant solid LB plate (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar powder, dilute to 1 L with deionized water, sterilize under high pressure for later use), spread it evenly with a spreader, place it upside down in a 37°C constant temperature incubator, and culture it overnight for 12-14 hours.

[0047] 1.2.2 Expression of ISG15-IFN-λ3 fusion protein

[0048] (1) Take out the bacterial plate that has been cultured overnight, add 10 mL of liquid LB medium to the bacterial culture tube, pick single colonies of ISG15-HL-IFN-λ3, ISG15-RL-λ3, and ISG15-(H4)2-IFN-λ3 into the bacterial culture tubes, and culture them on a shaker at 37°C for 12-14 hours;

[0049] (2) Take out the overnight cultured bacterial solution and expand the culture at a volume ratio of 1:50, that is, add 200 μL of bacterial solution to 10 mL of liquid LB medium and culture in a shaking incubator at 37°C; the remaining bacterial solution is thoroughly mixed with 50% glycerol at a ratio of 1:1 and stored at -80°C;

[0050] (3) After the bacterial solution is shaken, measure the OD with a spectrometer 600 = 0.6-0.8, add IPTG at a final concentration of 0.1 μM and culture at 37°C in a shaking incubator for 6-8 h;

[0051] (4) Place the cultured bacterial solution in a centrifuge tube and centrifuge at 6000 rpm / 5 min / 4°C. Discard the supernatant and resuspend the precipitate in PBS.

[0052] (5) Place the resuspended bacterial solution on an ice-water mixture and crush it with an ultrasonic crusher: power 250W, ultrasonic for 3s, stop for 3s, working time 2min;

[0053] (6) Centrifuge the sonicated bacterial solution at 6000 rpm / 10 min / 4°C, separate the supernatant and inclusion bodies, and dissolve the inclusion bodies with 8 M urea.

[0054] 1.2.3 Expression and identification of ISG15-IFN-λ3 fusion protein

[0055] (1) Gel preparation: prepare 10% SDS-PAGE protein gel;

[0056] (2) Sample preparation: Take 40 μL of the supernatant after ultrasonic disruption of ISG15-HL-IFN-λ3, ISG15-RL-λ3, and ISG15-(H4)2-IFN-λ3 and the inclusion bodies dissolved in 8 M urea, place them in 1.5 mL EP tubes, label them, add 10 μL of 5× sample buffer, and boil them in 100°C water for 12 min.

[0057] (3) Electrophoresis: Place the solidified SDS-PAGE gel on the electrode, add 1× running buffer, add 10 μL protein sample and 2 μL protein marker to the gel wells, voltage 100 V, and stop running the gel when the bromophenol blue indicator reaches the lowest end;

[0058] (4) Staining: Add 30 mL of Coomassie Brilliant Blue staining solution into the staining box, take out the gel and place it in the staining box for staining for 1 hour;

[0059] (5) Decolorization: discard the Coomassie Brilliant Blue, rinse several times with clean water, boil it with clean water for 3 minutes, boil it twice; add decolorization solution (formula: 5% ethanol, 10% glacial acetic acid, 85% distilled water), decolorize overnight and observe the results, such as Figure 1aA in Figure 1b A in Figure 1c As shown in A, the test results show that ISG15-RL-IFN-λ3, ISG15-HL-IFN-λ3, and ISG15-(H4)2-IFN-λ3 are all expressed in inclusion bodies. The sizes of ISG15-RL-IFN-λ3 recombinant protein and ISG15-HL-IFN-λ3 recombinant protein are about 35kD, and the size of ISG15-(H4)2-IFN-λ3 recombinant protein is about 35-45kD, and the results are consistent with expectations.

[0060] In addition, according to the same method as above, the pET-28a-IFN-λ3 recombinant expression plasmid was transformed into competent cells BL21 (DE3) for recombinant expression and identification of IFN-λ3 protein. Figure 1d As shown, the IFN-λ3 monomer protein is about 19 kD in size and is mainly present in the bacterial precipitate after lysis.

[0061] 1.2.4 Identification of His-tag specificity of ISG15-IFN-λ3 fusion protein

[0062] (1) Gel preparation, sample preparation, and electrophoresis are performed as in 1.2.3;

[0063] (2) Transfer: Activate the PVDF membrane with methanol for 1 min, take it out and place it in transfer solution (glycine 29 g / L, Tris 58 g / L, SDS 3.7 g / L), and soak the filter paper and sponge in the transfer solution in advance to wet it; take out the SDS-PAGE gel, open the transfer electrode, and place it in the order from negative electrode to positive electrode: sponge-filter paper-SDS-PAGE gel-PVDF membrane-filter paper-sponge; clamp the electrode and place it in the electrophoresis tank, add transfer solution to the electrophoresis tank, and place the electrophoresis tank in an ice-water mixture. Transfer parameters: voltage 100 V, time 1 h;

[0064] (3) Blocking: Prepare 5% skim milk powder in advance, place the PVDF membrane after transfer in 5% skim milk powder in a constant temperature incubator at 37°C for 1 hour;

[0065] (4) Incubation with primary antibody: Dilute the His-Tag antibody (Quanshijin Biotechnology Co., Ltd., catalog number: HT501-01) with PBS'T at 1:1000, place the PVDF membrane in it, and incubate in a constant temperature incubator at 25°C for 1 h;

[0066] (5) Wash the membrane: wash three times with PBS, 5 min each time;

[0067] (6) Incubation with secondary antibody: Dilute Goat@Mouse-HRP antibody (Quanshijin Biotechnology Co., Ltd., catalog number: HS201-01) with PBS'T at 1:5000, place the PVDF membrane in it, and incubate in a constant temperature incubator at 25°C for 1 h;

[0068] (7) Wash the membrane: wash three times with PBS, 5 min each time;

[0069] (8) Color development: Soak the PVDF membrane in 10 mL of ECL luminescent solution for 1 min and expose it to the gel imager. The results are as follows: Figure 1a B in Figure 1b B in Figure 1c As shown in B, the specific reaction of ISG15-RL-IFN-λ3, ISG15-HL-IFN-λ3, and ISG15-(H4)2-IFN-λ3 with the His tag antibody was detected by Western blot, and the size was consistent with the size of SDS-PAGE protein gel staining.

[0070] 1.3 Purification of ISG15-IFN-λ3 fusion protein

[0071] After expression identification, ISG15-HL-IFN-λ3, ISG15-RL-IFN-λ3, and ISG15-(H4)2-IFN-λ3 were all expressed in inclusion bodies. Therefore, the proteins expressed in inclusion bodies were purified by nickel column affinity chromatography.

[0072] 1.3.1 Protein purification by nickel column affinity chromatography

[0073] (1) Treatment of chromatography column: Clean the gasket inside the chromatography column (gravity column) with ultrapure water;

[0074] (2) Treatment of nickel filler: Pipette 1 mL of Ni-NTA beads 6FF filler, add it to the chromatography column, wash it with ultrapure water, and then equilibrate the nickel filler with 3 column volumes of 8 M urea;

[0075] (3) Nickel-protein incubation: The protein dissolved in 8 M urea was filtered through a 0.45 μm filter, mixed with the nickel filler and incubated at 4 °C overnight for 8-10 h or at room temperature for 2 h;

[0076] (4) Gradient elution: The incubated protein flows out through the chromatography column and the effluent is retained. Use 8M urea and 4M imidazole to prepare eluents of different concentrations: 10mM, 20mM, 50mM, 100mM, 250mM, and elute from low to high. When the protein indicator does not turn blue, change to the next gradient and retain the eluent of each gradient for subsequent identification;

[0077] (5) Gel analysis: Take 40 μL of the protein stock solution, effluent, and each gradient sample and effluent, add 10 μL of 5×Sample buffer, mix well, and boil in boiling water for 12 min; identify the protein by SDS-PAGE gel according to the method in 1.2.3 and determine the elution conditions;

[0078] (6) Dialysis: Place the target protein in a 3 kD dialysis bag and perform gradient dialysis: 6 M urea, 4 M urea, 2 M urea, 1 M urea, PBS. Dialyze each gradient at 4 °C for 4 h.

[0079] 1.3.2 Determination of protein concentration

[0080] (1) Gel analysis: Take 40 μL of the dialyzed protein in PBS, add 10 μL of 5× sample buffer, mix well, and boil in boiling water for 12 min; identify by SDS-PAGE protein gel;

[0081] (2) Determination of protein concentration by BCA method: According to the instructions of the BCA protein assay kit, the standard was diluted with PBS in a gradient manner, 20 μL of the protein to be tested and the diluted standard were added to the ELISA strip, and 200 μL of the working solution was added. The mixture was reacted at 37°C for 15 min, and the OD was measured on a spectrophotometer. 562 The protein concentration was calculated using the protein standard curve.

[0082] The ISG15-(H4)2-IFN-λ3 recombinant protein was purified by nickel column affinity chromatography and identified by SDS-PAGE. Figure 2 As shown, it was found that the ISG15-(H4)2-IFN-λ3 recombinant protein was eluted at 250 mM imidazole ( Figure 2 In A), ISG15-RL-IFN-λ3 and ISG15-HL-IFN-λ3 were purified by washing inclusion bodies ( Figure 2 B in the figure). The target protein was dialyzed in the gradient, identified by SDS-PAGE and the concentration was determined. During the dialysis, it was found that the ISG15-(H4)2-IFN-λ3 recombinant protein could be stably dialyzed into PBS and did not precipitate after freezing and thawing at -80℃. The concentration was 1.2mg / mL. Figure 2 As shown in C. ISG15-RL-IFN-λ3 and ISG15-HL-IFN-λ3 precipitated slightly when dialyzed to 2M urea, precipitated in large quantities in PBS, and had poor stability. They were easily precipitated after freeze-thawing at -80°C, with concentrations of 0.27 mg / mL and 0.26 mg / mL, respectively. Figure 2 As shown in D.

[0083] The IFN-λ3 monomer protein obtained by recombinant expression of pET-28a-IFN-λ3 was purified by the same method as above. The results showed that the IFN-λ3 monomer protein could not enter PBS through dialysis.

[0084] The present invention selects different connecting peptides: RL, HL, (H4)2, and connects ISG15 with IFN-λ3 to promote the biological activity of ISG15-IFN-λ3. Studies have shown that after ISG15 and IFN-λ3 are connected by RL and HL, although the protein expression level is improved, a large amount of precipitation is made in PBS, and it is difficult to successfully renature. This may be because the length of the two connecting peptides RL and HL is too short, resulting in interference between the two domains, which cannot be folded correctly, thus causing structural instability. The ISG15-(H4)2-IFN-λ3 recombinant protein using the (H4)2 connecting peptide was successfully renatured and dialyzed into PBS, and the expression level and stability were significantly improved. Under the same conditions, the present invention selected the (H4)2 connecting peptide to connect ISG15 and IFN-λ3, which can achieve stable and large-scale expression of IFN-λ3 protein, solving the technical problem that IFN-λ3 cannot be mass-produced using a prokaryotic expression system. The yield after purification is more than 4 times (about 4.4 times and 4.6 times) that when RL and HL are used as connecting peptides. This effect is difficult for technicians in this field to predict, and there is no related report in the prior art.

[0085] Therefore, the selection of ISG15-(H4)2-IFN-λ3 recombinant protein (the amino acid sequence is shown in SEQ ID NO: 1, and the nucleotide sequence encoding it is shown in SEQ ID NO: 2) can achieve large-scale production of IFN-λ3, which is the basis for the development of IFN-Ⅲ preparations. Therefore, the present invention selects to use ISG15-(H4)2-IFN-λ3 recombinant protein for subsequent experiments.

[0086] Example 2 Activity and application of ISG15-(H4)2-IFN-λ3 recombinant protein

[0087] 2.1 Activation of downstream signaling molecules by ISG15-(H4)2-IFN-λ3 recombinant protein

[0088] 2.1.1 Cell treatment

[0089] (1) Plating: Add 1×10 cells per well of a 24-well cell culture plate. 5 CRL2843 cells were cultured in DMEM medium containing 10% FBS and placed in a 37°C incubator for 12 h;

[0090] (2) After the cells were fully grown, ISG15-(H4)2-IFN-λ3 recombinant protein was added in a gradient manner: 100 ng, 500 ng, and 1000 ng; the addition of IFN-α was set as a positive control, and the group without IFN was set as a negative control. The cells were placed in a 37°C incubator for 12 h.

[0091] 2.1.2 Western Blot detection of ISG15-(H4)2-IFN-λ3 recombinant protein-induced ISG15 levels

[0092] (1) Sample treatment: After treating the cells for 12 h according to step 2.1.1, discard the culture medium, add 100 μL of 2× Sample buffer, stir thoroughly to lyse the cells, and boil in boiling water for 12 min;

[0093] (2) Prepare SDS-PAGE gel: Prepare according to the method in 1.2.3;

[0094] (3) Gel running: Place the SDS-PAGE gel on an electrode rack, add 1× running buffer, add 20 μL of sample to each well, and run at 100 V until the bromophenol blue indicator reaches the bottom;

[0095] (4) Transfer and blocking: Complete transfer and blocking according to the steps in 1.2.4;

[0096] (5) Incubation with primary antibody: dilute ISG15 rabbit polyclonal antibody (preserved and prepared by the laboratory of Northwest Agriculture and Forestry University) with PBS at a ratio of 1:250, and incubate the PVDF membrane in a constant temperature incubator at 25°C for 1 h;

[0097] (6) Washing the membrane: Wash with PBS 3 times, 5 min each time;

[0098] (7) Incubation with secondary antibody: Dilute Goat@Rabbit-HRP antibody (Quanshijin Biotechnology Co., Ltd., catalog number: HS101-01) with PBS at a ratio of 1:5000, and incubate the PVDF membrane in a constant temperature incubator at 25°C for 1 h;

[0099] (8) Washing the membrane: Wash with PBS 3 times, 5 min each time;

[0100] (9) Color development: Add 20 μL of 30% hydrogen peroxide into 10 mL of ECL luminescent solution, soak the PVDF membrane for 1 min, and expose it to the gel imager. The results are as follows: Figure 3 shown.

[0101] 2.1.3 Detection of ISG15 and ISG56 levels induced by ISG15-(H4)2-IFN-λ3 recombinant protein by quantitative PCR

[0102] (1) Sample treatment: Treat the cells according to step 2.1.1. After the cells are treated, discard the culture medium, add 300 μL Trizol, repeatedly pipette and lyse the cells, and place them in a 1.5 mL EP tube;

[0103] (2) Extraction of total RNA: Add 60 μL of chloroform to the sample, shake and mix, let stand for 5 min, centrifuge at 16,000 g and 4°C for 15 min, carefully aspirate the top layer of the stratified liquid after centrifugation, transfer it to a new 1.5 mL EP tube, add an equal amount of isopropanol, mix and precipitate at -20°C overnight; centrifuge at 16,000 g and 4°C for 15 min, discard the supernatant; add 500 μL of anhydrous ethanol to the tube for washing, centrifuge at 16,000 g and 4°C for 5 min, discard the supernatant, repeat washing twice; invert the 1.5 EP tube on absorbent paper to air dry; add 20 μL of RNase Free H2O water and measure the concentration;

[0104] (3) Reverse transcription: The reverse transcription system is: template RNA 500ng, 5× PrimeScript RT Master Mix 2 2μL, add RNase Free H2O until 10μL. The reverse program is: 37℃ 25min, 85℃ 5s, and keep warm at 4℃;

[0105] (4) The reverse transcribed cDNA was diluted 10 times and the target gene was detected by fluorescence quantitative PCR; the primer sequences are shown in Table 1. The PCR system was: SYBR Green Master 7.5 μL, upstream primer F 0.5 μL, downstream primer R 0.5 μL, template (cDNA) 2.5 μL, RNase Free H2O 4 μL. The PCR program was: 95℃ 10 min, (95℃ 15 s→60℃ 30 s→95℃ 15 s) × 40 cycles.

[0106] Table 1 Primer sequences for fluorescence quantitative PCR

[0107]

[0108] By detecting the activation of ISG15 and ISG56 in the IFN downstream gene ISGs, the ISG15-(H4)2-IFN-λ3 recombinant protein was used to stimulate CRL2843 cells with different gradients, and the expression level of ISG15 protein was detected by Western blot. The results showed that the ISG15-(H4)2-IFN-λ3 recombinant protein could stimulate CRL2843 cells to produce ISG15 protein, and with the increase of the stimulation dose, the expression level of ISG15 protein also increased. Figure 3As shown in A. Fluorescence quantitative PCR was used to detect the expression levels of ISG15 and ISG56 genes. The results showed that ISG15-(H4)2-IFN-λ3 recombinant protein could stimulate CRL2843 cells to induce the expression of ISG15 and ISG56 genes, and with the increase of the stimulation dose, the mRNA levels of ISG15 and ISG56 also gradually increased. Figure 3 B in Figure 3 As shown in C, the above results indicate that the ISG15-(H4)2-IFN-λ3 recombinant protein exerts biological activity and can activate the expression of downstream ISGs.

[0109] 2.2 Application of ISG15-(H4)2-IFN-λ3 recombinant protein in inhibiting NDV replication

[0110] (1) Plating: Add 1×10 cells per well of a 24-well cell culture plate. 5 CRL2843 cells were cultured in DMEN medium containing 10% FBS serum and placed in a 37°C incubator for 12 h;

[0111] (2) After the cells were fully grown, ISG15-(H4)2-IFN-λ3 recombinant protein was added in a gradient manner: 10 ng, 50 ng, 100 ng, 200 ng, 500 ng, and 1000 ng. 40 ng of IFN-α was added as a positive control, and the group without IFN was used as a negative control. 1000 ng of ISG15 protein was added as an irrelevant control. The untreated group (MOCK) was used as a blank control. The cells were placed in a 37°C incubator for 12 h.

[0112] (3) After 12 hours of treatment, NDV-GFP was added to the cells at an MOI of 1. After 24 hours to 36 hours of infection, the fluorescence was observed under a microscope. The highest dilution that could inhibit the appearance of NDV-GFP by 50% was taken as an IFN activity unit (U).

[0113] To further verify the activity of ISG15-(H4)2-IFN-λ3 recombinant protein, Newcastle disease virus (NDV) carrying green fluorescent protein (GFP) as a reporter gene was used for detection. After stimulating CRL2843 cells with ISG15-(H4)2-IFN-λ3 recombinant protein at different gradients for 12 hours, 1 MOI of NDV-GFP was added. At the same time, cells treated with commercial recombinant porcine IFN-α were used as positive controls, untreated cells were used as blank controls (MOCK), and cells treated with an equal amount of NDV-GFP were used as negative controls. 1000 ng of ISG15 protein was added as an irrelevant control. Fluorescence was observed under a microscope after 24h-36h. Figure 4As shown, ISG15-(H4)2-IFN-λ3 recombinant protein can inhibit the proliferation of NDV-GFP, and its inhibitory effect on NDV-GFP is positively correlated with the action gradient. The inhibitory effect gradually increases with the increase of dosage, and the blank control, positive control, negative control and irrelevant control are all established. The experimental results show that 50ng of ISG15-(H4)2-IFN-λ3 recombinant protein can inhibit 50% of NDV-GFP infection, so 50ng is taken as an IFN activity unit (U). The above experimental results show that ISG15-IFN-λ3 recombinant protein can be used to prepare drugs for preventing and / or treating NDV infection.

[0114] 2.3 Application of ISG15-(H4)2-IFN-λ3 recombinant protein in inhibiting PRRSV virus replication

[0115] 2.3.1 Cell treatment

[0116] (1) Plate: 4×10 cells / well of a 24-well cell culture plate 5 PAMs cells were cultured in 1640 medium containing 10% FBS serum in a 37°C incubator for 3-4 hours and used after the cells adhered to the wall.

[0117] (2) Add ISG15-(H4)2-IFN-λ3 recombinant protein to 1.5 mL EP tubes according to the gradient: 1000 units (50 μg), 500 units (25 μg), and 250 units (12.5 μg). Add 0.2 MOI of PRRSV JXA1 virus solution to each tube, mix well, add to the cells, and culture in a 37°C incubator for 24 h.

[0118] 2.3.2 Western Blot detection of anti-PRRSV activity of ISG15-(H4)2-IFN-λ3 recombinant protein

[0119] (1) Sample treatment: Treat PAMs cells according to step 2.3.1. After treatment, pipette the culture medium into a 1.5 mL EP tube, centrifuge at 300 × g for 8 min, and collect the cell pellet. Add 50 μL 2×sample buffer to the wells of the culture plate where the cells remain. Pipet and aspirate repeatedly until all the sample is added to the cell pellet to obtain the whole cell lysate. Vortex to mix well, and boil in boiling water for 12 min.

[0120] (2) Gel preparation and electrophoresis, see 1.2.3;

[0121] (3) Transfer membrane, see 1.2.4;

[0122] (4) Closed, see 1.2.4;

[0123] (5) Primary antibody: 6D10 (monoclonal antibody against PRRSV-N protein, preserved by the laboratory of Northwest Agriculture and Forestry University) was diluted with PBS at a ratio of 1:1000, and the PVDF membrane was incubated in a constant temperature incubator at 25°C for 1 h.

[0124] (6) Washing the membrane: Wash three times with PBS, 5 min each time;

[0125] (7) Secondary antibody: Dilute Goat@Mouse-HRP antibody (Quanshijin Biotechnology Co., Ltd., catalog number: HS201-01) with PBS at a ratio of 1:5000, and incubate the PVDF membrane in a constant temperature incubator at 25°C for 1 h;

[0126] (8) Washing the membrane: Wash with PBS 3 times, 5 min each time;

[0127] (9) Color development: Soak the PVDF membrane in 10 mL of ECL luminescent solution for 1 min and expose it to the gel imager.

[0128] 2.3.3 Detection of anti-PRRSV activity of ISG15-(H4)2-IFN-λ3 recombinant protein by quantitative PCR

[0129] (1) Sample treatment: Treat cells according to the method in 2.3.1. Pipette the cell culture medium into a 1.5 mL EP tube, add an equal amount of Trizol into the tube, and shake to mix;

[0130] (2) Extracting viral RNA from the supernatant;

[0131] (3) Reverse transcription: The reverse transcription system is as follows: template (RNA) 8 μL, 5× PrimeScript RT Master Mix 2 μL, RNase Free H2O Up to 10 μL; reverse transcription program: 37°C 25 min, 85°C 5 s, 4°C insulation;

[0132] (4) PCR: Dilute the reverse transcribed cDNA 10 times. The quantification procedure and system are the same as those in step 2.1.3. The upstream primer (5'-3') of the quantitative primer sequence of the PRRSV N gene is: CGGCAATTGTGTCTGTCGTC, and the downstream primer (5'-3') is: TCATGCTGAGGGTGATGATGCTGTG.

[0133] To verify the inhibitory ability of ISG15-(H4)2-IFN-λ3 recombinant protein on PRRSV replication, ISG15-(H4)2-IFN-λ3 recombinant protein was mixed with PRRSV JXA10.2 MOI in a gradient of 1000 units (50 μg), 500 units (25 μg), and 250 units (12.5 μg) and then infected with cells for 24 h. At the same time, a negative control group infected with PRRSV without ISG15-IFN-λ3 treatment was set up; Figure 5 As shown, both Western Blot and fluorescence quantitative PCR results showed that the inhibitory effect of ISG15-(H4)2-IFN-λ3 recombinant protein on PRRSV replication increased with increasing doses. The PRRSV replication level in the group treated with ISG15-(H4)2-IFN-λ3 recombinant protein was lower than that in the negative control group, indicating that ISG15-(H4)2-IFN-λ3 recombinant protein can inhibit the replication of PRRSV in PAMs cells and has anti-PRRSV activity.

Claims

1. An ISG15-(H4)2-IFN-λ3 recombinant protein for activating the JAK / STAT signaling pathway of cells and inducing the production of ISGs, characterized in that: The ISG15-(H4)2-IFN-λ3 recombinant protein connects ISG15 and IFN-λ3 via a connecting peptide (H4)2. The amino acid sequence of the ISG15-(H4)2-IFN-λ3 recombinant protein is shown in SEQ ID NO:

1.

2. A polynucleotide, characterized in that The polynucleotide encodes the ISG15-(H4)2-IFN-λ3 recombinant protein according to claim 1, and the polynucleotide has a nucleotide sequence as shown in SEQ ID NO:

2.

3. A polynucleotide construct, characterized in that The polynucleotide construct contains the polynucleotide according to claim 2.

4. A host cell, characterized in that The host cell contains the polynucleotide according to claim 2.

5. The recombinant vector pET-28a-ISG15-(H4)2-λ3 is characterized by: The recombinant vector pET-28a-ISG15-(H4)2-λ3 contains the polynucleotide as claimed in claim 2.

6. A recombinant strain, characterized in that The recombinant strain contains the recombinant vector pET-28a-ISG15-(H4)2-λ3 as described in claim 5.

7. The recombinant strain according to claim 6, characterized in that The recombinant strain is Escherichia coli.

Images