A molecular marker, primer set for identifying male and female plants of Hippophae gyantsensis and their applications

Abstract

The present invention provides a molecular marker, a primer set and their applications for identifying male and female plants of Hippophae gyantsensis, which relates to the technical field of molecular marker. The molecular marker of the present invention is located in a specific interval of the second chromosome of male Hippophae gyantsensis, and its nucleotide sequence is as shown in SEQ ID NO.1. The nucleotide sequences of the primer set designed for the above-mentioned molecular marker of the present invention are as shown in SEQ ID NO.2 and SEQ ID NO.3. By using the primer set provided by the present invention to amplify the genomic DNA of Hippophae gyantsensis under the given PCR conditions, a specific 341bp band can be obtained in the plants of male Hippophae gyantsensis, while no such specific band is produced in female Hippophae gyantsensis. It shows that the amplification of this molecular marker is stable and can be used for the gender determination of Hippophae gyantsensis plants.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and specifically relates to a molecular marker, a primer set for identifying male and female plants of Hippophae gyantsensis, and their applications. Background Art

[0002] Hippophae gyantsensis has good effects of tolerating barrenness, drought and cold. In addition, it has characteristics such as fast growth rate, strong reproduction and nitrogen fixation ability, and is an excellent native tree species for wind prevention, sand fixation and afforestation in Tibet. Male and female plants of Hippophae gyantsensis have different values. Females are mostly used for producing seeds to ensure genetic diversity, while males can play a greater value in wind prevention and sand fixation due to their higher photosynthetic, transpiration and water use efficiencies. During the ecological restoration process of Hippophae gyantsensis, an appropriate ratio of male and female plants can not only improve the ecological effect but also meet the economic benefits of local people. However, it is difficult to identify the gender of Hippophae gyantsensis at the early stage of individual development, which hinders the breeding and production development of Hippophae gyantsensis.

[0003] Molecular marker primers are specific primers used for PCR (Polymerase Chain Reaction), and they can be used to detect specific DNA fragments in the genome. A molecular marker is a genetic marker, and its essence is a DNA sequence that stably exists in different subgroups of a biological population and is linked and inherited with a characteristic trait. Molecular marker technology is mainly applied in the following aspects: constructing genetic linkage maps; gene / QTL mapping; molecular marker-assisted selection breeding; analysis of plant genetic diversity; identification of variety and quality purity and determination of genetic purity; disease detection. Molecular marker technology can quickly, accurately and efficiently identify individuals with potential special traits.

[0004] With the development of molecular biology, some methods for identifying the dioecy of Hippophae have also been developed at the molecular level. However, the existing molecular markers for identifying the gender of other Hippophae species were designed using techniques from many years ago and have not been widely used. Therefore, it is of great significance to screen out gender-linked molecular markers that can be stably used to identify Hippophae gyantsensis. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a molecular marker, a primer set for identifying male and female plants of Hippophae gyantsensis, and their applications, which can identify the gender of Hippophae gyantsensis seedlings at the seedling stage, improve the directionality and accuracy of seedling raising, and greatly shorten the seedling raising cycle.

[0006] To achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0007] The present invention provides a molecular marker for identifying male and female plants of Hippophae gyantsensis, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1.

[0008] The present invention also provides a primer set for identifying male and female plants of Hippophae gyantsensis, and upstream and downstream primers of the primer set are designed according to the molecular marker; the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.3.

[0009] The present invention also provides a kit for identifying male and female plants of Hippophae gyantsensis, and the kit includes the primer set.

[0010] The present invention also provides an application of the molecular marker or the primer set or the kit in identifying male and female plants of Hippophae gyantsensis.

[0011] The present invention also provides a method for identifying male and female plants of Hippophae gyantsensis, including the following steps:

[0012] Extracting genomic DNA of a sample to be tested;

[0013] Using the genomic DNA of the above sample as a template, performing PCR amplification with the primer set or the kit, and performing electrophoresis detection on the PCR amplification product;

[0014] Identifying male and female plants of Hippophae gyantsensis according to the electrophoresis band result.

[0015] Preferably, the identification criteria are as follows: if a characteristic band with a length of 341 bp appears in the PCR amplification product, then Hippophae gyantsensis is male; if the 341 bp characteristic band does not appear in the PCR amplification product, then Hippophae gyantsensis is female.

[0016] Preferably, the reaction system of the PCR amplification is 20 μL in total: 1 μL of DNA template, 0.8 μL of upstream primer, 0.8 μL of downstream primer, 10 μL of 2×TaqMasterMix, ddH 2 O 7.4 μL.

[0017] Preferably, the reaction procedure of the PCR amplification is as follows: the first stage, 95 °C, 5 min; the second stage, 95 °C, 30 s, 60 °C, 30 s, 72 °C, 1 min, for a total of 35 cycles; the third stage, 72 °C, 10 min; store at 12 °C.

[0018] Preferably, the sample to be tested is a leaf of Hippophae gyantsensis.

[0019] More preferably, the leaf is a leaf at the seedling stage.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] Compared with the existing methods for determining the gender of Hippophae gyantsensis, which require waiting for the flowering and fruiting periods of the plants to accurately identify the gender, using the primers provided by the present invention, only a few milligrams of leaves are needed to extract DNA as the template for the PCR reaction. It can be detected in various tissues and developmental stages of the plant body, without being restricted by seasons and environments, and there is no need to wait for the saplings to grow and flower. The primer set of the present invention can obtain a specific 341bp band through PCR amplification in male Hippophae gyantsensis plants, and the corresponding band cannot be obtained in female Hippophae gyantsensis plants. It shows that the molecular marker of the present invention has stable amplification, high specificity and sensitivity of the primer set, and can be used for gender identification of Hippophae gyantsensis plants. The application of the molecular marker of the present invention to the screening of Hippophae gyantsensis seedlings can improve the directionality and accuracy of seedling raising, greatly shorten the seedling raising cycle, and lay a foundation for large-scale ecological restoration using Hippophae gyantsensis. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is the agarose gel electrophoresis result of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0023] The present invention provides a molecular marker for identifying male and female plants of Hippophae gyantsensis, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. In the present invention, the molecular marker is located in the specific interval Chr02:34465460-34465800 of the second chromosome of male Hippophae gyantsensis. This interval contains a conserved male-specific gene, named Hgym02g1365. The male-specific gene specifically exists in male Hippophae gyantsensis plants and does not exist in female Hippophae gyantsensis plants. This male-specific gene is the molecular marker of the present invention, and its nucleotide sequence is:

[0024] TCGATCGCCACATACTGCTCGGATGCGGAAAATACCATAGGAGAAATCACC

[0025] ATCCTTCGGTAAATCAAATTTATCTACTTTTTCTGCTCTAGAATATTCATATC

[0026] AACATTCATATATTTGTTCCTTTTACGTTATTGCCTTTCTGATATCATCGTCTT

[0027] TAAGCATGATGATTGATTATTTCGCATGTTTGTAGCCTCCAGCCTACTGTCA

[0028] ACTATGTCAGAGTGATCAGTCATGCTCACCTGCTGAAGGGAAGTAGCTTTA

[0029] GGTAAATTTCTGAAATTTCCAATTTGATTGAAGTTGAACACTTGTCTTTTTTTCACTCCGATCCCCTCTTTGCCATGCAA(SEQ ID NO.1).

[0030] The present invention also provides a primer set for identifying male and female plants of Hippophae gyantsensis. The upstream primer and the downstream primer of the primer set are designed according to the molecular marker Hgym02g1365. The nucleotide sequence of the upstream primer is preferably 5'-TCGATCGCCACATACTGCTC-3' (SEQ ID NO.2). The nucleotide sequence of the downstream primer is preferably 5'-TTGCATGGCAAAGAGGGGAT-3' (SEQ ID NO.3). The amplification product of the primer set designed by the present invention is 341bp, and the amplified sequence is as shown in SEQ ID NO.1.

[0031] The present invention also provides a kit for identifying male and female plants of Hippophae gyantsensis, and the kit includes the above-mentioned primer set.

[0032] The present invention also provides an application of the above-mentioned molecular marker, or the above-mentioned primer set, or the above-mentioned kit in identifying male and female plants of Hippophae gyantsensis.

[0033] The present invention also provides a method for identifying male and female plants of Hippophae gyantsensis, including the following steps:

[0034] Extract the genomic DNA of the sample to be tested;

[0035] Using the genomic DNA of the above sample as a template, perform PCR amplification with the above-mentioned primer set or the above-mentioned kit, and perform electrophoresis detection on the PCR amplification product;

[0036] Identify male and female plants of Hippophae gyantsensis according to the results of the electrophoresis bands.

[0037] In the present invention, the method for extracting the genomic DNA of the sample to be tested can be conventionally selected as needed. The present invention preferably uses the CTAB method to extract the genomic DNA of Hippophae gyantsensis plants.

[0038] In the present invention, the criteria for identification are preferably as follows: if a characteristic band with a length of 341bp appears in the PCR amplification product, then Hippophae gyantsensis is male; if the 341bp characteristic band does not appear in the PCR amplification product, then Hippophae gyantsensis is female.

[0039] In the present invention, the reaction system for PCR amplification preferably has the following components in a 20 μL reaction system: 1 μL of DNA template, 0.8 μL of upstream primer, 0.8 μL of downstream primer, 10 μL of 2× TaqMasterMix, and 7.4 μL of ddH 2 O

[0040] In the present invention, the reaction program for PCR amplification is preferably as follows: In the first stage, at 95 °C for 5 min; in the second stage, at 95 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min, for a total of 35 cycles; in the third stage, at 72 °C for 10 min; and store at 12 °C.

[0041] In the present invention, the sample to be tested is preferably the leaves of Hippophae gyantsensis.

[0042] In the present invention, the leaves are preferably seedling-stage leaves.

[0043] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0044] In the following embodiments, the experimental methods are all conventional methods unless otherwise specified. The test materials used in the following embodiments are all commercially available products unless otherwise specified.

[0045] Example 1 Screening of Molecular Markers for Identifying Male and Female Plants of Hippophae gyantsensis

[0046] The genomic DNA of 10 female and 10 male Hippophae gyantsensis individuals collected from Jiangzi County, Tibet was extracted using the CTAB method. The collection information of Hippophae gyantsensis resources is shown in Table 1:

[0047] Table 1 Collection Information of 20 Hippophae gyantsensis Resources

[0048] Number 1 2 3 4 5 6 7 8 9 10 Gender Female Female Female Female Female Female Female Female Female Female Collection Location Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Number 11 12 13 14 15 16 17 18 19 20 Gender Male Male Male Male Male Male Male Male Male Male Collection Location Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse

[0049] The whole-genome resequencing of the above 20 Hippophae gyantsensis plants was performed using the MGI second-generation sequencing platform.

[0050] The whole-genome sequencing of male and female Hippophae gyantsensis plants was performed using the Oxford Nanopore Technology third-generation sequencing platform. The third-generation sequencing data was used as the input file for the NextDenovo software to perform de novo assembly of the genome, and a preliminary assembled genome was obtained; subsequently, the third-generation sequencing data and the second-generation sequencing data were used as the input file for the NextPolish software to correct the preliminary assembled genome; then, the sequencing data of the chromosome conformation capture technology (Hi-C) and the corrected preliminary assembled genome were used as the input file for the juicer / 3D-DNA process to construct chromosomes, and finally, the chromosome-level genome sequences of male and female Hippophae gyantsensis plants were obtained.

[0051] Using the chromosome-level genome sequences of male and female Hippophae gyantsensis as the reference genomes, the population resequencing data was aligned to the reference genomes using Bowtie2 to obtain the alignment files. Subsequently, the alignment files were used as the input for the IGV software for visualization to find specific regions.

[0052] A 5.75-MB male-specific region was found in the male genome of Hippophae gyantsensis. This region was extracted, and the female resequencing data was again aligned to this region to find the regions that were not aligned at all. Based on the visualization results, a conserved male-specific gene was identified in this region, named Hgym02g1365, and the male-specific gene was used as a molecular marker for distinguishing male and female Hippophae gyantsensis. Its nucleotide sequence is shown in SEQ ID NO.1.

[0053] Example 2 Primer set for identifying male and female Hippophae gyantsensis

[0054] According to the molecular marker screened in Example 1, a primer set was designed, including an upstream primer and a downstream primer.

[0055] Hgym02g1365-F (upstream primer): 5’-TCGATCGCCACATACTGCTC-3’ (SEQ ID NO.2);

[0056] Hgym02g1365-R (downstream primer): 5’-TTGCATGGCAAAGAGGGGAT-3’ (SEQ ID NO.3).

[0057] Example 3 Kit for identifying male and female Hippophae gyantsensis

[0058] A kit for identifying male and female Hippophae gyantsensis includes the primer set described in Example 2, 2×TaqMaster Mix (novoprotein), and ddH 2 O.

[0059] Example 4

[0060] In this example, the DNA of known male and female Hippophae gyantsensis plant individuals collected in Gyantse County, Shigatse, Tibet was used as the template, including 10 males and 10 females, and the primer set of Example 2 was used for PCR reaction.

[0061] Configuration of the 20-μL PCR reaction system:

[0062] Using 100 ng of Hippophae gyantsensis DNA as the template, the PCR reaction system was configured in a PCR tube according to the formula in Table 2.

[0063] Table 2 PCR reaction system

[0064]

[0065]

[0066] The PCR reaction conditions are shown in Table 3:

[0067] Table 3 PCR reaction conditions

[0068]

[0069] Electrophoresis was performed using a 1.5% agarose gel at 135 V for 20 min and observed under ultraviolet light.

[0070] According to Figure 1 the electrophoresis results showed that no PCR products were generated from the DNA of 10 female Hippophae rhamnoides subsp. gyantsensis, and a 341-bp PCR product was generated from the DNA of 10 male Hippophae rhamnoides subsp. gyantsensis.

[0071] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A molecular marker for identifying male and female plants of Hippophae rhamnoides L. in Jiangzi, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1.

2. A primer set for identifying male and female plants of Hippophae rhamnoides L. in Gyangze, characterized in that: The primer set is designed with an upstream primer and a downstream primer according to the molecular marker according to claim 1; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

3. A kit for identifying male and female plants of Hippophae rhamnoides L. in Jiangzi, characterized in that: The kit comprises the primer set according to claim 2.

4. Use of the primer set according to claim 2 or the kit according to claim 3 in identifying male and female plants of Hippophae rhamnoides L.

5. A method for identifying male and female plants of Gyangze seabuckthorn, characterized in that: The steps include: Extracting genomic DNA from the sample to be tested; Using the genomic DNA of the sample as a template, performing PCR amplification using the primer set of claim 2 or the kit of claim 3, and performing electrophoresis detection on the PCR amplification product; The male and female plants of Hippophae rhamnoides L. in Gyangze are identified according to the electrophoresis band results.

6. The identification method according to claim 5, characterized in that: The identification criteria are as follows: if the PCR amplification product shows a characteristic band of 341 bp in length, the Jiangzi seabuckthorn is male; if the PCR amplification product does not show a characteristic band of 341 bp, the Jiangzi seabuckthorn is female.

7. The identification method according to claim 5, characterized in that: The reaction system of the PCR amplification is calculated as 20 μL: 1 μL of DNA template, 0.8 μL of upstream primer, 0.8 μL of downstream primer, 10 μL of 2×Taq Master Mix, and 7.4 μL of ddH2O.

8. The identification method according to claim 5, characterized in that: The reaction procedure of the PCR amplification is as follows: the first stage, 95°C, 5 min; the second stage, 95°C, 30 s, 60°C, 30 s, 72°C, 1 min, a total of 35 cycles; the third stage, 72°C, 10 min; and storage at 12°C.

9. The identification method according to claim 5, characterized in that: The sample to be tested is the leaves of Hippophae rhamnoides L. from Gyantse.

10. The identification method according to claim 9, characterized in that: The leaves are leaves at the seedling stage.

Images