Detection primer and evaluation method for clopidogrel resistance risk gene

Abstract

The invention belongs to the fields of molecular biology and bioinformatics. The invention provides seven gene polymorphic sites (SNP sites) for predicting clopidogrel resistance related to a PCI (percutaneous coronary intervention) operation. The invention also provides a primer composition and a probe composition for predicting the gene polymorphic sites related to the clopidogrel resistance after the PCI operation. The invention also provides an evaluation method for predicting the clopidogrel resistance risk after the PCI operation. A risk model is constructed according to seven SNP mutation results in combination with the age and gender of people, a P value is calculated according to a detection result in combination with age and gender parameters, so that the clopidogrel drug resistance or sensitivity of a patient is evaluated, if the patient is in a resistance type, clopidogrel drug should not be used, and if the patient is in a sensitivity type, clopidogrel drug should not be used. Therefore, adverse drug response events of PCI patients are avoided or reduced.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and bioinformatics, and in particular relates to a method for detecting multiple SNPs based on chip detection technology, and by constructing a logistic regression prediction model, assigning different weights to the included SNP sites, scoring them, and ultimately classifying and evaluating the clopidogrel resistance risk of the sample to be tested. Background Art

[0002] Clopidogrel is a widely used antiplatelet drug in cardiovascular diseases. Clopidogrel treatment can significantly improve the major cardiovascular prognosis of patients after percutaneous coronary intervention (PCI), but 5% to 15% of patients will still experience clinical endpoint events including death, myocardial infarction and stroke within 1 year.

[0003] At present, clinically, platelet function can be tested to determine the platelet reaction of patients after medication to identify the potential risk of increased cardiovascular or bleeding events, such as turbidimetric determination of platelet aggregation rate (LTA) and rapid platelet function determination (Verify-Now). Studies have shown that the risk of thrombosis in PCI patients guided by antiplatelet therapy through platelet function testing is 8 times lower than that in the control group. It is temporarily considered to be a more accurate method at present. The European Society of Cardiology Antithrombotic Expert Group also recommends that the high-risk threshold for thrombotic events Verify-Now is ≥208PRU, VASP is ≥50%PRI, and Multiplate is ≥46U. The LTA method is not standardized and currently lacks a unified threshold. However, the biggest limitation of this method is that it is tested after medication, and it needs to be tested repeatedly, and then the drug is adjusted according to the results. At this time, adverse drug reactions have already occurred. In addition, the in vitro detection of platelets also requires strict blood collection, transportation and testing processes to ensure the reliability of the results.

[0004] PRU is the current gold standard for testing the antiplatelet function of clopidogrel. This is a post-evaluation. That is, the drug is used first, and then tested to see if it effectively inhibits platelet aggregation. If the effect is not good, it means that it is clopidogrel resistance and the drug needs to be changed. However, adverse drug reactions may have occurred at this time. In severe cases, the patient may have coagulation again. This is a post-drug test, not a risk prediction.

[0005] The transformation of clopidogrel from a prodrug to its antiplatelet aggregation effect requires the participation of multiple genes, including genes affecting clopidogrel absorption (ABCB1), metabolic activation genes (CYP2C19, CYP2C9, CYP2B6, CYP3A4, CYP1A2 and CYP3A5) and antiplatelet aggregation genes (PON1, P2RY1, P2RY6, P2RY12, PEAR1 and ITGB3), among which CYP2C19 is a key enzyme in the activation process of clopidogrel.

[0006] Therefore, some patents use CYP2C19 gene polymorphism to predict or guide the use of clopidogrel, for example:

[0007] 1. Patent CN105861690A uses PNA Clamp LAMP technology to detect CYP2C19*2 and CYP2C19*3, two subtypes, but it is only a single site test and does not mention the adjustment of clopidogrel medication corresponding to different test results.

[0008] 2. Patent application number ZL202110256473.8 also predicts the efficacy of clopidogrel based on the four subtypes of CYP2C19 gene *1, *2, *3, and *17. Related patents such as CN106399561A, CN109402249A, CN103923988B, and CN116103389A all use different technologies to detect different subtypes of CYP2C19 *1, *2, *3, and *17. However, according to Wang Lina's related research, CYP2C19 gene polymorphism can only explain about 12% of clopidogrel unresponsiveness (the article was published in "Chinese Medical Journal", 2015, 95(41): 3393-3395). In short, the sensitivity is low. In addition, age, diabetes, renal insufficiency, drug-drug interactions, smoking, body mass index, etc. can all affect the response to antiplatelet drugs. The existing clinical evidence is not sufficient for clinicians to guide individualized clopidogrel treatment based on a single CYP2C19 gene polymorphism.

[0009] 3. The invention of 201611254359.7, "CYP2C19 and ABCB1 Gene Detection Kit", provides a primer composition for detecting gene polymorphic sites associated with clopidogrel resistance, wherein the sites include CYP2C19*2, *3, *4, *5, *17 and ABCB1 3435C>T polymorphic sites. The present invention uses multiple PCR primers to first amplify the gene fragment where the relevant gene site is located, and then the amplified product is treated and then single-base extended to the site to be tested, and the extended product is used for molecular weight difference detection using time-of-flight mass spectrometry, and through data analysis, the results of the patient's clopidogrel resistance-related genes are quickly detected.

[0010] 4. CN107904306B provides a nucleic acid mass spectrometry detection kit and application for detecting gene polymorphism sites related to personalized medication of clopidogrel. The invention uses nucleic acid mass spectrometry detection technology to detect 15 sites at one time. However, the patent indicates that the invention does not involve how to determine the dosage of clopidogrel, nor does it belong to a disease diagnosis method. Simply put, the patent uses nucleic acid mass spectrometry to detect 15 sites and types these 15 sites, but it does not involve whether the typing results are related to clopidogrel medication and how to judge whether it is resistant or sensitive. Of course, no relevant model has been established and there is no judgment threshold. After the test, just a bunch of wild and heterozygous data are thrown to the clinical pharmacist. The clinical pharmacist needs to judge whether clopidogrel is resistant or sensitive by himself. There is no standard, which means that different pharmacists will have different judgment results.

[0011] Therefore, guidance on the use of clopidogrel urgently requires a relatively standard evaluation method with reliable results, high sensitivity and specificity, which can be reproduced by various laboratories and can be used as a reference by clinical pharmacists. Summary of the invention

[0012] The technical problem to be solved by the present invention is to provide a primer for detecting clopidogrel resistance risk gene and an evaluation method.

[0013] In order to solve the above technical problems, the present invention provides a gene polymorphism site (SNP site) for predicting clopidogrel resistance after PCI, which is the following 7 SNP sites:

[0014] rs1045642, rs4148727, rs12248560, rs4986893, rs4244285, rs2254638, rs662.

[0015] The present invention also provides a primer combination for predicting clopidogrel resistance-related gene polymorphic sites after PCI, which is the following 7 pairs of primers:

[0016] Amplification primer name Sequence (5'-3') rs1045642-F TCGATGAAGGCATGTATGTTGG rs1045642-R TGGTCCTGAAGTTGATCTGTGAA rs4148727-F GCAGGCTTGAAAGCACTAATCA rs4148727-R CCTACACCTTAGCAAAAAGATCACA rs12248560-F GTTTGGAAGTTGTTTTGTTTTGCTA rs12248560-R GCTGGCAGAACTGGGATTTG rs4986893-F GAAAACATCAGGATTGTAAGCACC rs4986893-R GAAGCCTGATCTATATTGGGATATTC rs4244285-F TCTTAGATATGCAATAATTTTCCCAC rs4244285-R CGATTCTTGGTGTTCTTTTACTTTCT rs2254638-F TCATCCCCATTAAAAAGATCAGC rs2254638-R AACCTCTGGAGCTTGTCACTGG rs662-F ACAACATACGACCACGCTAAACC rs662-R CCTGTAATGTTCAATACCTTCACCTT

[0017] The present invention also provides a probe composition for predicting clopidogrel resistance-related gene polymorphic sites (SNP sites) after PCI, which is the following 7 pairs of probes:

[0018]

[0019]

[0020] Each SNP site includes two probes, one for detecting the wild type and the other for detecting the mutant type (-A and -G represent the wild type and the mutant type, respectively).

[0021] The present invention also provides an evaluation method for predicting the risk of clopidogrel resistance after PCI, using the above primer combination and probe combination, comprising the following steps:

[0022] 1) DNA amplification

[0023] DNA from subjects after PCI was extracted as samples and amplified to obtain PCR amplification products of 7 sites in each sample;

[0024] The primers used for amplification were as described above;

[0025] 2) Hybridization, color development and chip preparation of PCR amplification products:

[0026] 2.1) Prepare 0.1 μM detection probe mixture;

[0027] The probes used were as described above;

[0028] 2.2) Hybridization reagent configuration:

[0029] Take 20 μL of PCR amplification product obtained in step 1), 5 μL of 0.1 μM detection probe mixture, and 1 μL of reaction solution B, add them to 174 μL of hybridization buffer, mix well, and add them to the hybridization reaction solution position of the 8-strip tube of immunochromogenic reagent; dilute the antibody in the immunochromogenic reagent with antibody diluent at 1:1000, and then add it to the antibody solution position of the 8-strip tube, and add the color development solution to the color development solution position of the 8-strip tube;

[0030] Note: Reaction solution B, hybridization buffer, antibodies, antibody diluent, etc. are all provided by the immunochromogenic kit;

[0031] 2.3) Set the capture chips corresponding to the 7 sites;

[0032] 2.4) Hybridization color reaction:

[0033] Load the capture chip set in step 2.3) and the 8-strip tube prepared in step 2.2) correctly according to the manual of the fully automatic nucleic acid molecular hybridization instrument, and start the hybridization according to the hybridization program compiled in the manual;

[0034] 3) Interpretation of results:

[0035] Obtain the signal values ​​of the wild-type probe and mutant-type probe for each SNP site, so as to determine whether the SNP site belongs to the homozygous mutant type, homozygous wild type, or heterozygous type;

[0036] 4) Assign values ​​and calculate the clopidogrel resistance probability value P of the sample to be tested according to the formula:

[0037] According to the test results of the 7 SNP loci, the homozygous wild type was assigned a value of 0, the heterozygous type was assigned a value of 1, and the homozygous mutant type was assigned a value of 2; thus, the values ​​of the 7 SNP loci were obtained: rs1045642, rs662, rs4244285, rs4986893, rs2254638, rs12248560, rs4148727, age represents the patient's age, sex represents the gender, male is assigned a value of 1, and female is assigned a value of 2;

[0038] The calculation formula is:

[0039] 1 / (1+exp(-(-0.96458+1.67991*rs4244285+0.74857*rs4986893-0.59104*rs1045642+0.82454*rs2 254638+0.07620*rs662-1.61536*rs12248560+0.17365*rs4148727-0.02366*age+0.88445*sex)));

[0040] Result judgment criteria:

[0041] Set P = 0.45 ~ 0.5;

[0042] When the data obtained by the calculation formula is ≥ P, the patient after PCI is determined to be clopidogrel resistant;

[0043] When the data obtained by the calculation formula is less than P, the patient after PCI is determined to be non-clopidogrel resistant, that is, clopidogrel sensitive.

[0044] As an improvement of the evaluation method for predicting the risk of clopidogrel resistance after PCI of the present invention:

[0045] The amplification system (25 μL) of step 1) is:

[0046] Primer mixture (100 μM) 2.5 μL;

[0047] 2X SU7PCR premix 12.5μL

[0048] Water (pure water) 8 μL;

[0049] DNA (10-50 ng / μL) 2 μL;

[0050] Amplification Procedure:

[0051]

[0052] As a further improvement of the evaluation method for predicting the risk of clopidogrel resistance after PCI surgery of the present invention: in step 3), according to the signal values ​​of the wild-type probe and the mutant-type probe of each SNP site, the following judgment rules are set:

[0053] ① When the signal values ​​of the wild-type probe and the mutant probe are both ≤50, it is a gray area and needs to be retested;

[0054] Otherwise, proceed to the following step ②;

[0055] ② When the signal value of only the wild-type probe is ≤50, the site is determined to be a homozygous mutant.

[0056] When the signal value of only the mutant type is ≤50, the site is determined to be homozygous wild type;

[0057] Otherwise, proceed to the following step ③;

[0058] ③. Calculate the ratio of the signal value of the wild-type probe and the signal value of the mutant probe according to the smaller value / larger value:

[0059] When the ratio is greater than 0.6, it is heterozygous;

[0060] When the ratio is between 0.4 and 0.6, it is in the gray area and needs to be retested;

[0061] When the ratio is <0.4, the signal value of the probe corresponding to the small value is regarded as 0; that is, when the small value corresponds to the wild-type probe, the site is judged to be a homozygous mutant, and when the small value corresponds to the mutant probe, the site is judged to be a homozygous wild-type.

[0062] The present invention proposes a method for obtaining potential disease-associated genes based on multi-site information fusion. First, the gene sites related to clopidogrel sensitivity are queried based on non-related literature, and then these gene sites are simultaneously detected through gene chip hybridization technology. Then, based on the logistic regression prediction model algorithm, corresponding weights are assigned to these sites, and scores are performed, and finally the clopidogrel sensitivity of the sample to be tested is evaluated.

[0063] The invention process of the present invention includes the following contents:

[0064] Step 1: Based on non-related literature knowledge, search for gene loci related to clopidogrel use reported at home and abroad, and whose frequency in the Chinese population is more than one thousandth.

[0065] Step 2: Synthesize chips for the included gene loci and use existing chip technology to conduct detection.

[0066] Step 3: Perform logistic regression analysis on a large number of samples and use computational tools such as bioinformatics to build a computational model, that is, the corresponding calculation formula.

[0067] Step 4: Analyze the samples and set the threshold, and evaluate the sensitivity, specificity, accuracy, etc. under the threshold.

[0068] One of the inventive points of the present invention is to establish an evaluation model with a clear threshold and judgment criteria. It should be emphasized that the number of detection sites is not the more the better. Some mutations with low frequencies do not need to be detected, and some mutations that are not helpful for model calculations will also be removed. In fact, the present invention included more than 30 sites during research and development. After modeling, it was found that more than 20 sites did not need to be included, and 7 sites were sufficient for calculation.

[0069] The technical advantage of the present invention is that it not only detects 7 SNPs and gives mutation results; the present invention also constructs a risk model based on the 7 SNP mutation results, combined with the age and gender of the person, and calculates a P value based on the test results and combined with the age and gender parameters to evaluate the patient's clopidogrel resistance or sensitivity. If it is a resistance type, it means that clopidogrel should not be used, thereby avoiding or reducing adverse drug reaction events in PCI patients.

[0070] Most of the existing patents are based on SNP typing, and neither build models nor perform typing in combination with age or gender factors. However, although a person's genotype remains unchanged throughout life, the risk of clopidogrel use will change with age. The present invention can effectively solve the above problems. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0072] Figure 1 It is a probe distribution map of a chip; 0 represents a positive probe, and a signal must appear; blank represents a negative probe, and there must be no signal value.

[0073] Figure 2 The actual fluorescence signal of a single sample (upper figure) and the corresponding signal value automatically identified by the software (lower figure). The signal value is the average of 3 points. DETAILED DESCRIPTION

[0074] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0075] Case collection and gold standard testing

[0076] 1.1. Inclusion and exclusion standards

[0077] The enrolled patients were 500 patients diagnosed with coronary heart disease in the Department of Cardiology of Guangdong Provincial People's Hospital between October 2018 and January 2020.

[0078] The inclusion criteria were: confirmed coronary heart disease (with ≥50% vascular stenosis) by coronary angiography; PCI and standard dual antiplatelet therapy (clopidogrel + aspirin); unrelated Chinese Han people aged 40-80 years.

[0079] Exclusion criteria (patients who met any of the following criteria were excluded): (1) patients who had received anticoagulant therapy within 10 days before PCI and whose international normalized ratio was >1.5; (2) patients who were not suitable for clopidogrel and aspirin treatment; (3) patients with poor compliance and who took other anticoagulants without authorization; (4) patients with a history of systemic bleeding, coagulation disorders, or a high bleeding tendency; (5) patients with advanced cancer, severe infection, liver or kidney failure, or other terminal diseases.

[0080] 1.2 Gold standard detection

[0081] The VerifyNow Therapeutic Detection System is used to detect the antiplatelet efficacy of clopidogrel, and the measured P2Y12 Reaction Units (PRU) reflect the residual platelet activity of clopidogrel users. The larger the PRU, the greater the residual platelet activity, and the worse the antiplatelet efficacy of clopidogrel. According to the reference, PRU>208 is considered clopidogrel resistance.

[0082] A total of 305 subjects were included, of whom 165 were clopidogrel-resistant and the other 140 were clopidogrel-sensitive.

[0083] Embodiment 1,

[0084] 1) Site inclusion

[0085] A total of 7 SNP loci ( Table 1 ) were included for subsequent model construction;

[0086] Table 1

[0087] serial number Site (rs number) Mutation information 1 rs1045642 c.3435T>C 2 rs4148727 c.458+2795A>G 3 rs12248560 c.-806C>T 4 rs4986893 c.636G>A 5 rs4244285 c.681G>A 6 rs2254638 c.135-890A>G 7 rs662 c.575A>G

[0088] 2) 7 pairs of primers and 14 probes were designed for these seven loci;

[0089] The primer design principles are: the length of the amplified product is 150-300bp, the primer is between 19-23bp, the GC content is 40-60%, the Tm value is 60±10℃, and there are no four consecutive identical bases.

[0090] The sequences of the 7 pairs of primers are shown in Table 2 below:

[0091] Table 2

[0092]

[0093]

[0094] Where F represents the forward primer, and R represents the reverse primer. The 5' end of the reverse primer requires biotin, i.e., conventional biotin modification.

[0095] Hybridization probe sequence design principle: There is a 18-30bp sequence at the 5' end that is reverse complementary to the capture sequence on the chip, and is connected to a 12-15bp polyT, followed by an 18-25bp specific sequence. The SNP site to be detected is placed in the middle. Each SNP site includes two probes, one for detecting the wild type and the other for detecting the mutant type. All probes are shown in Table 3 below:

[0096] Table 3

[0097]

[0098] All primers and probes were synthesized by General Biotechnology Co., Ltd.

[0099] Note: -A and -G represent wild type and mutant type respectively. After subsequent testing, AA represents homozygous wild type, AG represents heterozygous type, and GG represents homozygous mutant type.

[0100] 3) Extraction and amplification of genomic DNA from blood samples;

[0101] Genomic DNA was extracted from peripheral blood using a blood extraction kit from Qiagen. The amplification kit included a product from Suzhou Xinhai Biotechnology Co., Ltd. SU7 PCR master mix.

[0102] Template amplification uses asymmetric multiplex PCR, and the amplification reagents provided by the kit contain 4 components: SU7 PCR master mix, primer mixture, template, pure water;

[0103] The amplification system and amplification procedure are as follows:

[0104] Primer Mix:

[0105]

[0106]

[0107] The amplification system is:

[0108]

[0109] Amplification Procedure:

[0110]

[0111] The amplified product is a mixed solution of PCR products containing 7 sites for each sample. Since asymmetric PCR is used, the antisense strand containing biotin label is much more than the sense strand, which is used in the following hybridization step.

[0112] 4) Hybridization, color development and chip preparation of PCR amplification products

[0113] The hybridization kit and color development kit mentioned below can be purchased from the hybridization color development kit (BST03021) produced by Shanghai Bio-Tech Co., Ltd.

[0114] 4.1. Preparation of probe combination mixture

[0115] Provides 7 sites, a total of 14 probe combination mixtures; other hybridization and colorimetric reagents (such as hybridization buffer, reaction solution B, antibody diluent, etc.) are provided by the matching BioAo hybridization and colorimetric kit, and the chip is equipped with BioAo universal chip (type I, 20 sets of probe combinations).

[0116] Preparation of 0.1 μM detection probe mixture:

[0117]

[0118]

[0119] Note: -A and -G represent the wild type and mutant type respectively.

[0120] 4.2. Hybridization reagent configuration:

[0121] Take 20 μL of PCR amplification product (obtained in step 3), 5 μL of 0.1 μM detection probe mixture, and 1 μL of reaction solution B, add them to 174 μL of hybridization buffer, mix well and add them to the 8-strip hybridization reaction solution position of the immunochromogenic reagent, dilute the antibody in the immunochromogenic reagent with antibody diluent at 1:1000, and then add it to the antibody solution position of the 8-strip tube, and add the colorimetric solution to the colorimetric solution position of the 8-strip tube.

[0122] 4.3 Chip Fabrication

[0123] We commissioned BioAo to produce the detection chip. The capture chips corresponding to the 7 sites are as follows: Figure 1 As shown:

[0124] Figure 1 middle:

[0125] Probe No. 1——rs1045642-A Probe No. 2 - rs1045642-G Probe No. 3 - rs4148727-A Probe No. 4 - rs4148727-G Probe No. 5——rs12248560-C Probe No. 6——rs12248560-T Probe No. 15——rs4986893-G Probe No. 16——rs4986893-A Probe No. 9——rs4244285-G Probe No. 10——rs4244285-A Probe No. 11——rs2254638-A Probe No. 12 - rs2254638-G Probe No. 13 - rs662-T Probe No. 14 - rs662-C

[0126] Note: 0 represents the quality control probe, i.e. the positive control, 'blank' represents no probe, i.e. the blank control, and although there are probes at positions 7, 8, 17, 18, 19, and 20, there are no corresponding detection hybridization probes in this experiment, so these positions are negative controls.

[0127] That is, this chip provides 20 points, and theoretically can detect 10 SNPs (because each SNP includes wild type and mutant type, it occupies two positions), so the present invention has 7 SNPs, and you only need to arbitrarily select 14 numbers to use.

[0128] 4.4. Hybridization color reaction:

[0129] Load the above nucleic acid chip and the prepared 8-tube strip correctly according to the manual of the fully automatic nucleic acid molecular hybridization instrument, compile the following hybridization program according to the manual, and start the hybridization:

[0130]

[0131] 5) Interpretation of results

[0132] The Biochip reader is used to read the hybridized chip, and the software is used to detect the signal value of the wild-type probe and mutant probe of the SNP site. The judgment rules are set as follows:

[0133] ① When the signal values ​​of the wild-type probe and the mutant probe are both ≤50, it is a gray area and needs to be retested;

[0134] Otherwise, proceed to the following step ②;

[0135] ② When the signal value of only the wild-type probe is ≤50, the site is determined to be a homozygous mutant.

[0136] When the signal value of only the mutant type is ≤50, the site is determined to be homozygous wild type;

[0137] Otherwise, proceed to the following step ③;

[0138] ③. Calculate the ratio of the signal value of the wild-type probe and the signal value of the mutant probe according to the smaller value / larger value:

[0139] When the ratio is greater than 0.6, it is heterozygous;

[0140] When the ratio is between 0.4 and 0.6, it is in the gray area and needs to be retested;

[0141] When the ratio is <0.4, the signal value of the probe corresponding to the small value is regarded as 0; that is, when the small value corresponds to the wild-type probe, the site is judged to be a homozygous mutant, and when the small value corresponds to the mutant probe, the site is judged to be a homozygous wild-type.

[0142] The present invention uses 116 chips to detect 116 samples, and randomly selects the test results of a 44-year-old male sample, such as Figure 2 , Figure 2 Each point in the image represents the signal value of a site. The built-in software will automatically identify the signal values ​​of these points. Yellow points visible to the naked eye represent strong signals; otherwise, weak signals or no signals. However, the human eye is only for reference, and the final signal value is subject to the automatic recognition of the software.

[0143] The signal values ​​of the positive control were all around 250, and the signal values ​​of the blank control and the negative control were 0.

[0144] The results are shown in Table 4 below.

[0145] Table 4

[0146]

[0147] 6): Assign a value and calculate the clopidogrel resistance probability value P of the sample according to the following formula:

[0148] Assignment: rs1045642, rs662, rs4244285, rs4986893, rs2254638, rs12248560, rs4148727, refers to the test results of 7 SNPs, among which the homozygous wild type, that is, no mutation, is assigned 0, the heterozygous mutation is assigned 1, and the homozygous mutation is assigned 2; age indicates the patient's age, sex indicates the gender, male is assigned 1, and female is assigned 2;

[0149] The calculation formula is:

[0150] 1 / (1+exp(-(-0.96458+1.67991*rs4244285+0.74857*rs4986893-0.59104*rs1045642+0.82454*rs 2254638+0.07620*rs662-1.61536*rs12248560+0.17365*rs4148727-0.02366*age+0.88445*sex)))

[0151] Result judgment standard: set P = 0.5;

[0152] When the data obtained by the calculation formula is ≥ P, the patient after PCI is determined to be clopidogrel resistant;

[0153] When the data obtained by the calculation formula is less than P, the patient after PCI is determined to be non-clopidogrel resistant, that is, clopidogrel sensitive.

[0154] The results of the 7 SNP tests for a 44-year-old male are shown in Table 5:

[0155] Table 5

[0156] rs1045642 rs662 rs4244285 rs4986893 rs2254638 rs12248560 rs4148727 age sex 0 0 1 0 1 1 0 44 1

[0157] According to the formula 1 / (1+exp(-(-0.96458+1.67991*rs4244285+0.74857*rs4986893-0.59104*rs1045642+0.82454*rs2254638+0.07620*rs662-1.61536*rs12248560+0.17365*rs4148727-0.02366*age+0.88445*sex)))

[0158] =1 / (1+exp(-(-0.96458+1.67991*1+0.74857*0-0.59104*0+0.82454*1+ 0.07620*0-1.61536*1+0.17365*0-0.02366*44+0.88445*1)))=0.442239

[0159] Less than 0.5, according to the judgment results, the sample is clopidogrel sensitive.

[0160] In order to verify the effectiveness of the present invention, the present invention designed several groups of experiments to verify

[0161] Experiment 1:

[0162] From the Department of Cardiology of Guangdong Provincial People's Hospital, 58 patients with clinically confirmed clopidogrel-resistant coronary heart disease and 58 patients with clear non-clopidogrel-resistant coronary heart disease (the confirmation standard is that the PRU value of these samples detected by the Verifynow method is greater than 208) were collected. According to the method described in Example 1, the detection results of the 7 SNP sites of the above 116 samples were obtained accordingly. At the same time, the PRU values ​​of these samples were detected by the Verifynow method. The results are shown in Table 6 below:

[0163] Table 6: Detection results of 7 SNPs in 58 patients and 58 normal controls

[0164]

[0165]

[0166]

[0167]

[0168] Note: 116 samples, IDs range from 1 to 148, some patients were lost in the middle, so they are missing. A total of 116 cases were included. rs1045642, rs662, rs4244285, rs4986893, rs2254638, rs12248560, rs4148727 refer to the test results of 7 SNPs, where 0 means no mutation, 1 means heterozygous mutation, and 2 means homozygous mutation; PRU refers to the result of Verifynow test for platelet residual activity, age means patient age, sex means gender, 1 means male, 2 means female;

[0169] By the calculation formula of the present invention (1 / (1+exp(-(-0.96458+1.67991*rs4244285+0.74857*rs4986893-0.59104*rs1045642+0.82454*rs2254638+0.07620*rs662-1.61536*rs12248560+0.17365*rs4148727-0.02366*age+0.88445*sex)))), the clopidogrel resistance probability P is obtained, and according to the judgment method, resistance is greater than or equal to 0.5, and the results are as follows:

[0170]

[0171]

[0172]

[0173]

[0174] total Predict positive Predict negative Gold standard positive 58 44 14 Gold standard negative 58 11 47 total 116 55 61

[0175] but:

[0176] The value calculated by the formula of the present invention is 0.5. Specificity 47 / (47+11)＝81.03％ Sensitivity 44 / (44+14)＝75.86％ accuracy (44+47) / 116＝78.45％ Kappa value 56.9％

[0177] Since the present invention is to predict risks and avoid adverse drug use, sensitivity is the most important, and the sensitivity of the present invention can reach 75.86%.

[0178] Comparative case 1:

[0179] Referring to patent application number 201711121223.3, the *2, *3, and *17 subtypes of CYP2C19 were detected by QFPCR. The judgment principle is that if CYP2C19 is a combination of *2 and *3, it is clopidogrel-resistant, that is, it is not suitable for clopidogrel. If it is not a combination of *2 and *3 (including the three combinations of *2, *2, *2, *3, and *3, *3), it is sensitive. According to this judgment principle, CYP2C19*2 and *3 of the above 116 samples were tested, and the results are as follows: (CYP2C19, combinations other than *2 and *3 are not listed).

[0180]

[0181]

[0182]

[0183]

[0184] The specificity and other results of case 1 are as follows:

[0185] total Predict positive Predict negative Gold standard positive 58 15 43 Gold standard negative 58 1 57 total 116 16 100

[0186] Using CYP2C19*2*3 isoforms to determine clopidogrel resistance Specificity 57 / (57+1)＝98.28％ Sensitivity 15 / (15+43)＝25.86％ accuracy (15+57) / 116＝62.07％ Kappa value 24.14％

[0187] Judging from the above judgment results, the specificity is good, but the sensitivity is very poor, only 25.8%. As a result, a large number of people with clopidogrel resistance cannot be detected in advance, and the use of clopidogrel will cause drug side effects.

[0188] The sensitivity of the method of the present invention reaches 75.86%, and can better screen out people who are resistant to clopidogrel.

[0189] The threshold of the present invention is not fixed. The present invention can also improve the sensitivity by adjusting the threshold. For example, under the premise that there are multiple statins available, more people with clopidogrel resistance can be screened out by appropriately increasing the tolerance for false positives. The specific example is as follows: Experiment 2

[0190] Experiment 2: Compared with Example 1, "set P = 0.5" is changed to "set P = 0.45", and the rest is the same as Example 1. That is, when the data obtained by the calculation formula is ≥ 0.45, the subject after PCI surgery is determined to be clopidogrel resistant; otherwise, it is sensitive.

[0191] According to this method, the 116 samples of Experiment 1 were tested and the results were corrected as follows:

[0192]

[0193]

[0194]

[0195]

[0196] total Predict positive Predict negative Gold standard positive 58 47 11 Gold standard negative 58 16 42 total 116 63 53

[0197] but:

[0198] The value calculated by the formula of the present invention has a threshold value of 0.45 Specificity 43 / (43+16)＝72.41％ Sensitivity 47 / (47+11)＝81.03％ accuracy (44+47) / 116＝76.72％ Kappa value 53.45％

[0199] Compared with Experiment 1, although the specificity of Experiment 2 dropped from 81.03% to 72.41%, the sensitivity increased from 75.86% to 81.03%. This is of great significance in some clinical screening scenarios, that is, it is better to have some false positives than too many false negatives. Because there is no need to be afraid of false positives, there are subsequent methods to verify or adjust. False negatives, on the other hand, will be ignored, resulting in drug side effects.

[0200] The technical advantage of the present invention is that, through the combined detection of multiple indicators and clinical testing, a calculation formula for predicting risk is obtained, which can predict clopidogrel resistance before medication, and can save a large number of patients from the ineffective use of clopidogrel and the side effects it brings. Of course, the present invention can also obtain different specificities and sensitivities by setting different thresholds to adapt to different application scenarios. For example, when doing screening, a lower threshold can be set to allow some false positives to exist, but the sensitivity is further improved to reduce the possibility of missed detection. In some retrospective studies, we can set a higher threshold to make the specificity better and sacrifice a certain sensitivity.

[0201] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. Genetic polymorphisms for predicting clopidogrel resistance after PCI, characterized in that The 7 SNP sites are as follows: rs1045642, rs4148727, rs12248560, rs4986893, rs4244285, rs2254638, rs662.

2. A primer composition for predicting clopidogrel resistance-related gene polymorphic sites after PCI, characterized in that There are 7 pairs of primers as follows: 。 3. A probe composition for predicting clopidogrel resistance-related gene polymorphic sites after PCI, characterized in that There are 7 pairs of probes as follows:

4. An assessment method for predicting the risk of clopidogrel resistance after PCI, characterized in that: Utilizing the primer combination of claim 2 and the probe combination of claim 3, comprising the following steps: 1) DNA amplification DNA from subjects after PCI was extracted as samples and amplified to obtain PCR amplification products of 7 sites in each sample; The primers used for amplification are as described in claim 2 above; 2) Hybridization, color development and chip preparation of PCR amplification products: 2.1) Prepare 0.1 μM detection probe mixture; The probe used is as described in claim 3 above; 2.2) Hybridization reagent configuration: Take 20 μL of PCR amplification product obtained in step 1), 5 μL of 0.1 μM detection probe mixture, and 1 μL of reaction solution B, add them to 174 μL of hybridization buffer, mix well, and add them to the hybridization reaction solution position of the 8-strip tube of immunochromogenic reagent; dilute the antibody in the immunochromogenic reagent with antibody diluent at 1:1000, and then add it to the antibody solution position of the 8-strip tube, and add the color development solution to the color development solution position of the 8-strip tube; 2.3) Set the capture chips corresponding to the 7 sites; 2.4) Hybridization color reaction: Load the capture chip set in step 2.3) and the 8-strip tube prepared in step 2.2) correctly according to the manual of the fully automatic nucleic acid molecular hybridization instrument, and start the hybridization according to the hybridization program compiled in the manual; 3) Interpretation of results: Obtain the signal values ​​of the wild-type probe and mutant-type probe for each SNP site, so as to determine whether the SNP site belongs to the homozygous mutant type, homozygous wild type, or heterozygous type; 4) Assign values ​​and calculate the clopidogrel resistance probability value P of the sample to be tested according to the formula: According to the test results of the 7 SNP loci, the homozygous wild type was assigned a value of 0, the heterozygous type was assigned a value of 1, and the homozygous mutant type was assigned a value of 2; thus, the values ​​of the 7 SNP loci were obtained: rs1045642, rs662, rs4244285, rs4986893, rs2254638, rs12248560, rs4148727, age represents the patient's age, sex represents the gender, male is assigned a value of 1, and female is assigned a value of 2; The calculation formula is: 1 / (1+exp(-(-0.96458+1.67991*rs4244285+0.74857*rs4986893-0.59104*rs1045642+0.82454*rs2 254638+0.07620*rs662-1.61536*rs12248560+0.17365*rs4148727-0.02366*age+0.88445*sex))); Result judgment criteria: Set P = 0.45 ~ 0.5; When the data obtained by the calculation formula is ≥ P, the patient after PCI is determined to be clopidogrel resistant; When the data obtained by the calculation formula is less than P, the patient after PCI is determined to be non-clopidogrel resistant, that is, clopidogrel sensitive.

5. The method for predicting the risk of clopidogrel resistance after PCI according to claim 4, characterized in that: The amplification system of step 1) is: Primer mixture 2.5 μL; 2X SU7PCR premix 12.5μL water 8μL; DNA 2 μL; Amplification Procedure:

6. The method for predicting the risk of clopidogrel resistance after PCI according to claim 4 or 5, characterized in that: In step 3), according to the signal values ​​of the wild-type probe and mutant-type probe matched to each SNP site, the following judgment rules are set: ① When the signal values ​​of the wild-type probe and the mutant probe are both ≤50, it is a gray area and needs to be retested; Otherwise, proceed to the following step ②; ② When the signal value of only the wild-type probe is ≤50, the site is determined to be a homozygous mutant. When the signal value of only the mutant type is ≤50, the site is determined to be homozygous wild type; Otherwise, proceed to the following step ③; ③. Calculate the ratio of the signal value of the wild-type probe and the signal value of the mutant probe according to the smaller value / larger value: When the ratio is greater than 0.6, it is heterozygous; When the ratio is between 0.4 and 0.6, it is in the gray area and needs to be retested; When the ratio is <0.4, the signal value of the probe corresponding to the small value is regarded as 0; that is, when the small value corresponds to the wild-type probe, the site is judged to be a homozygous mutant type, and when the small value corresponds to the mutant probe, the site is judged to be a homozygous wild type.

Images