Primer probe combination and detection kit for colorectal cancer screening or prediction
Through the combined detection of methylation sites of DPP10-AS1 gene and MIR3681HG gene and combined with ddPCR technology, the problem of insufficient sensitivity and specificity of existing colorectal cancer screening methods was solved, and the effect of efficient early screening of colorectal cancer was achieved.
Patent Information
- Application Number
- CN202411418522.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-12
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2044-10-12
AI Technical Summary
The existing colorectal cancer screening methods are insufficient in sensitivity and specificity, making it difficult to detect colorectal cancer in the early stage, and conventional detection methods have problems such as invasiveness or low detection accuracy.
The combined detection of methylation sites of the DPP10-AS1 gene and MIR3681HG gene was adopted, and the absolute quantitative detection was carried out by developing a specific primer probe combination and combining ddPCR technology to achieve high sensitivity and high specific screening for colorectal cancer.
The sensitivity of colorectal cancer screening has reached more than 90% and specificity has reached more than 95%. It can detect colorectal cancer in the early stage, reduce the traumaticity of the detection to patients, and improve the detection accuracy.
Smart Images

Figure CN119120702B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of gene detection, and in particular to a primer-probe combination and a detection kit for colorectal cancer screening or prediction. Background Art
[0002] Colorectal cancer is a common malignant tumor of the digestive tract. It has the second highest incidence rate and the fifth highest cancer mortality rate in China. Moreover, the incidence rate is showing a clear upward trend and is becoming younger.
[0003] Colorectal cancer is a curable and preventable cancer. Clinical data show that if precancerous lesions are detected through early cancer screening and promptly removed through surgery before colorectal cancer develops, the survival rate can reach 100%. However, for patients diagnosed with stage I colorectal cancer, the survival rate drops to 91.8%, 82.4% for stage II, and 57% for stage III. The survival rate for late-stage stage IV colorectal cancer is only 10.8%, and the mortality rate in late-stage colorectal cancer is extremely high. Colorectal cancer progresses more slowly than other types of cancer and has a clear precancerous stage, providing a valuable window for effective colorectal cancer screening and early intervention.
[0004] While there are numerous clinical methods for detecting colorectal cancer, such as colonoscopy, CT colonography, and stool examination, stool screening currently has extremely limited sensitivity for detecting precancerous lesions. Colonoscopy is invasive and traumatic, resulting in low patient compliance and inability to detect early-stage cancer. Other screening methods, such as the FIT test, are inexpensive and simple, but their sensitivity is low, with a detection rate of only 20%-30% for advanced adenomas.
[0005] In addition, methylation changes occur in the early stages of carcinogenesis. DNA methylation can regulate gene expression, thereby promoting or inhibiting tumor development and metastasis. The accumulation of genetic and epigenetic changes in colorectal cancer leads to significant differences in gene methylation status between colorectal cancer patients and healthy individuals. Tumor development is accompanied by abnormal DNA methylation. After some tumor cells shed, their DNA enters the bloodstream. DNA methylation testing can be used to detect early cancer lesions. Summary of the Invention
[0006] Based on this, it is necessary to provide a primer probe combination and detection kit for colorectal cancer screening or prediction, which can screen early colorectal cancer and have a screening sensitivity of more than 90% and a specificity of more than 95%.
[0007] The present invention adopts the following technical solutions:
[0008] The present invention provides a methylation site combination for colorectal cancer screening or prediction, including a DPP10-AS1 gene methylation site and a MIR3681HG gene methylation site.
[0009] Among them, the methylated region in the DPP10-AS1 gene is chr2:115919287-115920535, especially the Chr2:115919895 methylation site.
[0010] The methylated region in the MIR3681HG gene is Chr2:12245378-12245764, especially the Chr2:12245464 methylation site.
[0011] The present invention further provides a primer-probe combination for colorectal cancer screening or prediction, comprising:
[0012] A first upstream primer, a first downstream primer, and a first probe set for detecting DPP10-AS1 gene methylation, wherein the sequence of the first upstream primer is shown in SEQ ID NO.1, the sequence of the first downstream primer is shown in SEQ ID NO.2, and the sequences of the first probe set are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively;
[0013] The second upstream primer, second downstream primer and second probe used to detect methylation of the MIR3681HG gene, the sequence of the second upstream primer is shown in SEQ ID NO.5, the sequence of the second downstream primer is shown in SEQ ID NO.6, and the sequences of the second probe group are shown in SEQ ID NO.7 and SEQ ID NO.8 respectively.
[0014] In some embodiments, the reporter fluorescent group of the above-mentioned probe is selected from any one of FAN and HEX, and the reporter quencher group is selected from any one of BHQ1, BHQ2, BHQ3, TAMRA, and MGB.
[0015] In some embodiments, the final concentration of the primers for colorectal cancer screening or prediction is 100-500 nM, and the concentration of the probe is 50-100 nM.
[0016] The present invention provides an application of a primer-probe combination for colorectal cancer screening or prediction in preparing a detection kit.
[0017] The present invention further provides a detection kit for colorectal cancer screening or prediction, comprising the above-mentioned primer-probe combination for colorectal cancer screening or prediction.
[0018] Furthermore, the detection kit may also include one or more combinations of a positive control, a negative control, a free DNA extraction reagent, a sulfite conversion reagent, and a ddPCR amplification reagent.
[0019] The positive control includes the nucleotide sequence shown in SEQ ID NO.9 and the nucleotide sequence shown in SEQ ID NO.10.
[0020] The negative control is normal human WBC cell DNA.
[0021] The detection process of the detection kit includes: obtaining a blood sample, extracting free DNA, and performing sulfite conversion; using template DNA, a first upstream primer, a first downstream primer, and a first probe for detecting the methylated region chr2:115919287-115920535 in the DPP10-AS1 gene, and a second upstream primer, a second downstream primer, and a second probe for detecting the methylated region Chr2:12245378-12245764 in the MIR3681HG gene to prepare a reaction system, and performing ddPCR amplification; obtaining the methylation rates of the DPP10-AS1 gene and the MIR3681HG gene.
[0022] Furthermore, when the detection kit for colorectal cancer screening or prediction of the present invention is used, the method for predicting colorectal cancer positivity comprises the following steps: if the methylation rate of the Chr2:115919895 site of the DPP10-AS1 gene is ≥40% or the methylation rate of the Chr2:12245464 site of the MIR3681HG gene is ≤30%, then the sample is jointly predicted to be colorectal cancer positive; otherwise, the sample is jointly predicted to be colorectal cancer negative.
[0023] Compared with the prior art, the core advantages of the present invention are:
[0024] The present invention first discovered through extensive research that combined detection of DPP10-AS1 gene methylation and MIR3681HG gene methylation can be used for early screening of colorectal cancer. The present invention specifically developed a primer-probe combination targeting these gene methylation sites. Combined detection can achieve a sensitivity of over 90% and a specificity of over 95% for colorectal cancer detection at these dual-methylation sites.
[0025] In addition, it is worth mentioning that the current methods for detecting or predicting colorectal tumors are mostly based on qPCR methods; the present invention uses ddPCR, an absolute quantitative technology that can detect single copies. Its accuracy and sensitivity are higher than qPCR, and it can count mutation rates and detect low abundance without the need for a standard curve. The detection limit can be as low as a single copy, is independent of the ct value, is independent of the amplification efficiency, and can overcome the influence of PCR inhibitors. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 This is the ROC curve diagram for the combined detection of Chr2:115919895 and Chr2:12245464. DETAILED DESCRIPTION
[0027] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly. The following embodiments are only used to illustrate the present invention, but are not limited to limiting the scope of the present invention. Based on the specific embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. In the embodiments of the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art; in the embodiments of the present invention, unless specifically specified, the technical means used are conventional means well known to those skilled in the art.
[0028] Through a large number of experimental investigations, the present invention found that the combined detection of DPP10-AS1 gene methylation and MIR3681HG gene methylation can be used for early screening of colorectal cancer.
[0029] Among them, the methylated region in the DPP10-AS1 gene is chr2:115919287-115920535, especially the Chr2:115919895 methylation site.
[0030] The methylated region in the MIR3681HG gene is Chr2:12245378-12245764, especially the Chr2:12245464 methylation site.
[0031] The primer-probe combination preferably developed by the present invention includes:
[0032] The sequences of the first upstream primer DPP10-AS1-F, the first downstream primer DPP10-AS1-R, and the first probe set for detecting methylation at Chr2:115919895 of the DPP10-AS1 gene are shown in the table below:
[0033]
[0034] The second upstream primer, second downstream primer, and second probe set used to detect methylation at Chr2:12245464 of the MIR3681HG gene are shown in the following table:
[0035]
[0036] It is worth noting that the region for detecting DPP10-AS1 gene methylation in the present invention is selected from UCSC GenomeBrowser on Human (GRCh37 / hg19) U, hg19_dna range = chr2:115919287-115920535 region, and the nucleotide sequence is:
[0037]
[0038] The nucleotide sequence of the DPP10-AS1 (chr2:115919287-115920535) gene containing the methylation site Chr2:115919895 after bisulfite modification is as follows:
[0039] TTTGGGTGGCGGGGGGCGGGGAGAGCGGGGAGTTAGAGGGTTTGCGGTGGTCGAGGGAGGGATTTTACGACGGGGAGTTCGTTCGGTGTCGTTTTTTTTTTTTTTTTCGTTTTTTCGTTTTTTTTATTTCGTTTTTTTCGTCGATTTCGGGAGCGACGGGCGTTCGTGATTTGCGAACGTTGTTAAGTGACGGTTTTCGAGTTTGAAGCGTTCGCGAGGAAGCGAGCGTTAGCGCGGGTCGTCGGCGATGACGGTCGCGAAGTAGGAGTCGTAGTTTATTTCGGGGGTTAGGGCGAGTTAGGCGTAGTCGGCGGATTAGGTGAGAGTCGGTAGTCGCGGTTAGGTTTTTTCGGGAGGGGTGGTTTTAGTGCGCGTTTCGTTCGTTTTTCGTTTTTTAGGTTGGGTTTTCGCGTTTTTTTTTTTTTATTTTTTTTCGTTTCGTTTTAGTTTTAGGTTTTTTTGTTTTTTTACGGATTTTGCGGGAAGTTAGAGTTTTTGCGTGCGTTTCGGGGTTCGGCGAGAGGATGCGTAAGGTGGAGAGTCGCGGGGAAGGGGGTAGAGAGGTAAAGGTTGAAGGTGTTTCGGGGAATTTCGGCGGGCGGTTTAT CGAGGGAGGGAGAGGCGGTCGGGATTAAGGAATGGGGTTTTTTGGTTTTTTATTAACGTACGTTGAAGAAATTTGTTGCGTTTTTGACGGTCGTTTATCGGGTTCGAGTTTCGTTTTTTTATAGTCGGGGCGTTCGTTGGTTAAAGCGATTCGAGTAGGCGAATGATTTTTAGGCGGACGGGGTTTTTTTTTTGTTTTTTTGTTTTTTTTGAGGAGACGGGTGTGTGTTTGTGAGGTGGGGATGGGGGAAGAGTGTTTTAGATATTCGTAGTTTGTTGAGCGGAACGGAGTTTGGGGAGCGGCGAGGTATTAACGATTAAGTGGAGTCGGGAAGGCGTTGGTTTTGGTGATGTGTTGGGTTTGGATGTGTCGCGTTTGTATAGATGAGGTGTTTTGCGTGGGTTGAGGGTTATTTTTGTTTTTTTTTCGTTCGTTTATATTCGTTAATTTTTTTTTGTTTTGGTTTTTAGAAATTTGTAGTATAATCGTATCGTCGTGGATTTTTATTTCGTTTTTGTTTTTGATTTGGGGTGATTTGGGATTTCGGTGTCGTTTTTTTTTTAAAGTTGGAGGGTCGGGAGCGTCGAGATATTTTGGCGAGGAGGAGGAGGAGGAGGAGGGAGGTTGCGTTGAGTCGGGTGTA(SEQ ID NO.9).
[0040] The region for detecting the methylation of the MIR3681HG gene in the present invention is selected from UCSC Genome Browser on Human (GRCh37 / hg19), the hg19_dna range = Chr2: 12245378 - 12245764 region, and the nucleotide sequence is:
[0041] AGTGTACAGATGAGCCCCCAAGGGTGATTCTGCACTGGGTACCTGAATCAGGGATGGGCGAGAGGCTTCGTGTCCACTGAATTGTCGCCAAATGCCCCATAGCATTGCCCGGGTTTGAGCGCATAGTAGGCATTCAATAAATACTGGCTTTCTTCCATAGAGCACGTAGAGCTGGAAGGTATCTAAGATCTTCACAAGCCCAAACTTCCCCCTGTAGAAAGTGGGAGTTGAGGCCCAAGGAGGTGAAATGAGTTGCAGATCTGGAGCTCCCGACTCCAGGTCGGTAATGCTGAGTTCTATTCTCTGCCTTTCTCAGGTGCTGGTTCTCTGGTGCTGGGAGTGAAAATAAAAATGGTGTACCACAGGCCATAGATGAGACACTTGAGCC。
[0042] The nucleotide sequence after bisulfite modification of the MIR3681HG (Chr2: 12245378-12245764) gene containing the methylation site Chr2: 12245464 is as follows:
[0043] AGTGTATAGATGAGTTTTTAAGGGTGATTTTGTATTGGGTATTTGAATTAGGGATGGGCGAGAGGTTTCGTGTTTATTGAATTGT CG TTAAATGTTTTATAGTATTGTTTGGGTTTGAGTGTATAGTAGGTATTTAATAAATATTGGTTTTTTTTTATAGAGTACGTAGAGTTGGAAGGTATTTAAGATTTTTATAAGTTTAAATTTTTTTTTGTAGAAAGTGGGAGTTGAGGTTTAAGGAGGTGAAATGAGTTGTAGATTTGGAGTTTTCGATTTTAGGTCGGTAATGTTGAGTTTTATTTTTTGTTTTTTTTAGGTGTTGGTTTTTTGGTGTTGGGAGTGAAAATAAAAATGGTGTATTATAGGTTATAGATGAGATATTTGAGTT(SEQ ID NO.10).
[0044] Among them, the underlined part in the above gene sequence is the methylation site.
[0045] The following is an example.
[0046] Example 1
[0047] This embodiment provides a method for screening methylation sites of genes associated with colorectal cancer, comprising:
[0048] Methylation libraries were constructed for more than 6,000 methylated gene sites in colorectal cancer patients and normal controls, and NGS sequencing was performed. Methylation differences were obtained through analysis and calculation, and sites with methylation gene sites with a difference of more than 20% between colorectal cancer patients and normal controls were selected for subsequent analysis.
[0049] Two methylation gene sites with differences greater than 20% were screened out: the Chr2:115919895 methylation site in the chr2:115919287-115920535 region of the DPP10-AS1 gene and the Chr2:12245464 methylation site in the Chr2:12245378-12245764 region of the MIR3681HG gene.
[0050] Example 2
[0051] By constructing methylation libraries for colorectal cancer cell lines (hct116) and normal human WBC cell lines, the methylation rates of Chr2:12245464 in the Chr2:12245378-12245764 region of the MIR3681HG gene and Chr2:115919895 in the Chr2:115919287-115920535 region of the DPP10-AS1 gene in hct116 and WBC cells were obtained respectively by NGS sequencing.
[0052] The statistical results are shown in the following table:
[0053]
[0054] Based on the above test results, it is speculated that:
[0055] If the methylation rate of Chr2:12245464 in the Chr2:12245378-12245764 region of the MIR3681HG gene is ≤30%, the site is methylated positive.
[0056] If the methylation rate of Chr2:115919895 in the chr2:115919287-115920535 region of the DPP10-AS1 gene is ≥40%, the site is methylated positive;
[0057] This example further targets the differential site detection results of the methylation rates of the above-mentioned regions in the MIR3681HG gene and the DPP10-AS1 gene, uses primer5 software to design and optimize the primer probes for the methylation sites of the above-mentioned genes, and uses DNA from colorectal cancer-positive cell lines and normal human WBC cell lines as templates to construct methylation ddPCR detection systems for the Chr2:12245378-12245764 region of the MIR3681HG gene and the Chr2:115919287-115920535 region of the DPP10-AS1 gene. FAM and HEX are used as fluorescent signal detection objects, and the primer probes and reaction systems of the two genes are optimized to obtain the above-mentioned preferred primer probe combination (SEQ ID NO.1 to SEQ ID NO.8).
[0058] In addition, for the sulfite-modified nucleotide sequence of the Chr2:12245378-12245764 region (including the Chr2:12245464 methylation site) of the MIR3681HG gene, non-preferred primer-probe combinations found during the experiment include:
[0059] MIR3681HG-F-2:GAGGTTTCGTGTTTATTGAATT(SEQ ID NO.11);
[0060] MIR3681HG-R-2: TGAGTTTGGGTTTGTT (SEQ ID NO. 12);
[0061] MIR3681HG-M probe: TTGTCGTTAAATGTTT (SEQ ID NO. 13); MIR3681HG-uM probe: TTGTTGTTAAATGTTT (SEQ ID NO. 14);
[0062] MIR3681HG-F-3: TGGGCGAGAGGTTTCGT (SEQ ID NO. 15);
[0063] MIR3681HG-R-3: CCCAAACAATACTATAA (SEQ ID NO. 16); MIR3681HG-M probe: TTGTCGTTAAATGTTT (SEQ ID NO. 17); MIR3681HG-uM probe: TTGTTGTTAAATGTTT (SEQ ID NO. 18);
[0064] MIR3681HG-F-4: TTCGTGTTTATTGA (SEQ ID NO. 19);
[0065] MIR3681HG-R-4:TTTTTTTCTTAAAT (SEQ ID NO. 20);
[0066] MIR3681HG-M probe: TTGTCGTTAAATGTTT (SEQ ID NO. 21); MIR3681HG-uM probe: TTGTTGTTAAATGTTT (SEQ ID NO. 22).
[0067] For the sulfite-modified nucleotide sequence of the DPP10-AS1 gene chr2:115919287-115920535 region (including the Chr2:115919895 methylation site), non-preferred primer and probe combinations found during the experiment include:
[0068] DPP10-AS1-F2: AAGGTGGAGAGT (SEQ ID NO. 23);
[0069] DPP10-AS1-R2:CCCACCTCACAACACACACC (SEQ ID NO. 24);
[0070] DPP10-AS1-M probe: TTATCGAGGGAGGGAGAGG (SEQ ID NO. 25);
[0071] DPP10-AS1-uM probe: TTATTGAGGGAGGGAGAGG (SEQ ID NO.26); DPP10-AS1-F3: ATTTTGCGGGAAGTTAGAG (SEQ ID NO.27); DPP10-AS1-R3: CCCGTCCGCCAAAAAACA (SEQ ID NO.28); DPP10-AS1-M probe: TTATCGAGGGAGGGAGAGG (SEQ ID NO.27); NO.29);
[0072] DPP10-AS1-uM probe: TTATTGAGGGAGGGAGAGG (SEQ ID NO. 30); DPP10-AS1-F4: TAGTTTTAGGTTTTTTTGTTT (SEQ ID NO. 31);
[0073] DPP10-AS1-R4:GACTATAAAAAAACGAAACT(SEQ ID NO.32) 。
[0074] The above non-preferred primer-probe combination can also be used for early screening of colorectal cancer, but its sensitivity is 80% and its specificity is 85%, which is slightly lower than the preferred probe combination.
[0075] Example 3
[0076] This example tests blood samples from 20 colorectal cancer patients and 20 healthy controls (negative controls). The specific steps are as follows:
[0077] (1) Sample processing, DNA extraction and transformation
[0078] 5 mL of fresh blood was collected and centrifuged at 4°C and 1400 g to separate the serum. Serum free DNA was extracted using the Eppendorf cell-free DNA extraction kit, and the extracted serum free DNA was subjected to sulfite conversion using the Zymo methylation conversion kit.
[0079] (2) ddPCR amplification and detection
[0080] Using hct116 cell line DNA as a template, ddPCR amplification was performed using a preferred MIR3681HG gene primer probe combination (SEQ ID NOs. 5 to 8) and a preferred DPP10-AS1 primer probe combination (SEQ ID NOs. 1 to 4). The ddPCR amplification reagent used was a Bio-Rad ddPCR amplification kit. The ddPCR reaction system included:
[0081]
[0082]
[0083] Each time a ddPCR amplification test is performed, a positive quality control and a negative quality control should be included. The positive quality control is the cell line DNA with methylation at the MIR3681HG site and the cell line DNA with methylation at the DPP10-AS1 site (colorectal cancer cell line); the negative quality control is the WBC (white blood cell) DNA with unmethylation at the MIR3681HG site and the DPP10-AS1 site.
[0084] Place the droplet generator card into the droplet generator, divide 20 μL of reaction solution into 20,000 droplets, and move the droplets to a 96-well plate for PCR amplification. The ddPCR amplification procedure is as follows:
[0085]
[0086] The 96-well plate was transferred to a microdroplet analyzer for fluorescence reading and the methylation rate of the sample was calculated: the methylation rate was calculated as: the copy number of the methylated site obtained by ddPCR / (the copy number of the methylated site + the copy number of the unmethylated site).
[0087] The statistical test results are as follows:
[0088] Statistics of double-site methylation rates in 20 healthy people
[0089]
[0090]
[0091] The methylation rates of the Chr2:12245464 site in the Chr2:12245378-12245764 region of the MIR3681HG gene in the above 20 healthy people were between 50% and 54%, and the methylation rates of the Chr2:115919895 site in the chr2:115919287-115920535 region of the DPP10-AS1 gene were between 17% and 22%.
[0092] Statistics of double-site methylation rates and prediction results of 20 colorectal cancer patients (blood samples)
[0093]
[0094] As can be seen from the above table, among the 20 clinical colorectal tumor patient samples, only 1 sample detected the methylation rate of Chr2:12245464 in MIR3681HG greater than 30%, and 2 samples detected the methylation rate of Chr2:115919895 in DPP10-AS1 less than 40%, which is inconsistent with the predicted results (methylation rate of Chr2:12245464 in MIR3681HG ≤30%, methylation rate of Chr2:115919895 in DPP10-AS1 ≥40%).
[0095] The detection results of the above samples were further analyzed by AUC and other calculations. The results are as follows Figure 1 As shown, the AUC of the clinical samples was 0.961, 95% CI: 0.951-0.971, and the diagnostic results were good.
[0096] Example 4
[0097] Referring to the method steps of Example 3, this example further verifies the reliability of the screening results for 100 blood samples from colorectal cancer patients. The statistical results of the two-site methylation rate statistics and predictions (based on the methylation rate of Chr2:115919895 in DPP10-AS1 being ≥40% and the methylation rate of Chr2:12245464 in MIR3681HG being ≤30%) are shown in the following table:
[0098]
[0099] As can be seen from the table above, by expanding the test validation results of the patient group, it was found that:
[0100] The combined quantitative detection of the DPP10-AS1 gene methylation site Chr2:115919895 and the MIR3681HG gene methylation site Chr2:12245464 in the Chr2:12245378-12245764 region has an overall positive coincidence rate of up to 96%, which can predict or detect colorectal cancer and is suitable for early screening of colorectal cancer.
[0101] In addition, it is worth emphasizing that the combined detection of methylation at the Chr2:115919895 site in the chr2:115919287-115920535 region of the DPP10-AS1 gene and the Chr2:12245464 site in the Chr2:12245378-12245764 region of the MIR3681HG gene can achieve low requirements for cfDNA input (only 1 ng is required for detection) and high sensitivity and specificity of detection, with a sensitivity of more than 95% and a specificity of more than 95%.
[0102] It is important to note that the above embodiments are intended only to further illustrate and describe the technical solutions of the present invention and are not intended to further limit the technical solutions of the present invention. The methods of the present invention are merely preferred implementations and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.
Claims
1. A primer-probe combination for colorectal cancer screening or prediction, characterized in that: include: A first upstream primer, a first downstream primer, and a first probe set for detecting DPP10-AS1 gene methylation, wherein the sequence of the first upstream primer is shown in SEQ ID NO. 1, the sequence of the first downstream primer is shown in SEQ ID NO. 2, and the sequences of the first probe set are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively; And a second upstream primer, a second downstream primer and a second probe group for detecting methylation of the MIR3681HG gene, the sequence of the second upstream primer is shown in SEQ ID NO.5, the sequence of the second downstream primer is shown in SEQ ID NO.6, and the sequences of the second probe group are shown in SEQ ID NO.7 and SEQ ID NO.8 respectively.
2. The primer-probe combination for colorectal cancer screening or prediction according to claim 1, characterized in that: The reporter fluorescent group of the first probe and the second probe is selected from any one of FAM and HEX, and the reporter quencher group is selected from any one of BHQ1, BHQ2, BHQ3, TAMRA, and MGB.
3. The primer-probe combination for colorectal cancer screening or prediction according to claim 1, characterized in that: Primers for colorectal cancer screening or prediction are used at a final concentration of 100-500 nM, and / or probes at a concentration of 50-100 nM.
4. Use of the primer-probe combination for colorectal cancer screening or prediction according to any one of claims 1 to 3 in the preparation of a detection kit.
5. A detection kit for colorectal cancer screening or prediction, characterized in that: Comprising the primer-probe combination for colorectal cancer screening or prediction according to any one of claims 1 to 3.
6. The detection kit for colorectal cancer screening or prediction according to claim 5, characterized in that: Also include positive and / or negative controls; The positive control includes the nucleotide sequence shown in SEQ ID NO.9 and the nucleotide sequence shown in SEQ ID NO.10; The negative control is normal human WBC cell DNA.
7. The detection kit for colorectal cancer screening or prediction according to claim 5 or 6, characterized in that: It also includes one or more combinations of free DNA extraction reagents, sulfite conversion reagents, and ddPCR amplification reagents.
8. The detection kit for colorectal cancer screening or prediction according to claim 5 or 6, characterized in that: The detection process of the detection kit includes: Obtain blood samples, extract cell-free DNA, and perform sulfite conversion; A reaction system was prepared using template DNA, a first upstream primer, a first downstream primer, and a first probe set for detecting methylation of the DPP10-AS1 gene, and a second upstream primer, a second downstream primer, and a second probe set for detecting methylation of the MIR3681HG gene, and ddPCR amplification was performed. Obtain the methylation rates of the DPP10-AS1 gene and the MIR3681HG gene.
Citation Information
Patent Citations
LncRNA (Ribonucleic Acid) marker related to lung cancer auxiliary diagnosis and application of lncRNA marker
CN106755293A
Use of cancer cell expression of cadherin 12 and cadherin 18 to treat muscle invasive and metastatic bladder cancers
US20240115699A1