SNP5-188995192 molecular marker related to content of notoginsenoside R1 in panax notoginseng and application of SNP5-188995192 molecular marker

Abstract

The invention discloses application of a kit for detecting an SNP (Single Nucleotide Polymorphism) molecular marker related to the content of notoginsenoside R1 in panax notoginseng in character breeding of the content of notoginsenoside R1 in panax notoginseng, the SNP molecular marker is SNP5-188995192 and is located at the 188995192 site basic group of Chr5 chromosome, and the mutation type of the SNP molecular marker is G / C. The KASP primer combination developed by the invention can accurately distinguish pseudo-ginseng with high and low notoginsenoside R1 content, can be applied to pseudo-ginseng molecular-assisted marker breeding and shorten the breeding period of a new variety, and has the advantages of low detection cost, no environmental limitation, high detection result accuracy and easy repetition. The method has important theoretical and practical guiding significance for accelerating the genetic improvement process of panax notoginseng breeding with high notoginsenoside R1 content and improving the breeding selection efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular genetic breeding, and particularly relates to a SNP molecular marker related to the content of notoginseng saponin R1 in Panax notoginseng and an application thereof. Background Art

[0002] Panax notoginseng is a perennial herbaceous plant of the Araliaceae family of the genus Panax. Its roots and rhizomes are used as medicine. It has the effects of dispersing blood stasis, stopping bleeding, reducing swelling and relieving pain. It is one of the precious Chinese medicinal materials unique to my country. Panax notoginseng is increasingly widely used in clinical practice. It is one of the main raw materials for Chinese patent medicines such as Xuesaitong soft capsules, Yunnan Baiyao, Compound Danshen Tablets, Compound Danshen Pills, and Zhangzhou Pien Tze Huang. Panax notoginseng saponins are the main active ingredients in Panax notoginseng. The content and type of saponins are one of the important indicators for evaluating the quality of Panax notoginseng.

[0003] Quality breeding is the core measure of improved variety breeding. Studies have shown that by exploring excellent allelic variations of key genes that control important agronomic traits and developing allele-specific molecular markers, they can be effectively used in molecular marker-assisted selection breeding. The breeding of Panax notoginseng varieties mainly adopts the group mixed selection method, which mainly relies on phenotypic selection to obtain group varieties. It is the main breeding method for Panax notoginseng variety breeding at this stage. However, each generation of Panax notoginseng takes at least 3 years, and the speed of phenotypic separation and population construction is extremely slow. There is also a lack of early selection and identification methods, resulting in a long breeding cycle and low efficiency. It takes 15 to 20 years to cultivate a new variety. At the same time, Panax notoginseng is a cross-pollinated plant, and there is no pure line breeding material so far, which seriously limits the application of hybrid breeding methods in the breeding of Panax notoginseng varieties. Distant hybridization is also difficult to use for Panax notoginseng germplasm improvement.

[0004] With the development of omics technology, molecular genetic breeding of medicinal plants based on molecular markers can greatly improve breeding efficiency, and it is possible to improve the molecular design breeding of active ingredients of medicinal plants. SNP markers (singlenucleotide polymorphism) mainly refer to the polymorphic changes of DNA sequences caused by single nucleotide variations at the genome level. They are the molecular markers with the highest polymorphic coverage and density today. Compared with traditional molecular marker-assisted selection, high-throughput resequencing technology can generate large-scale SNP markers, promote the precise association analysis between markers and traits, and improve the efficiency of molecular-assisted selection breeding. The content and type of saponins in Panax notoginseng should be the core goal of Panax notoginseng variety selection. Therefore, it is particularly important to use known saponin biosynthesis genes and rich Panax notoginseng germplasm resources to explore SNPs significantly associated with the content of Panax notoginseng saponins in Panax notoginseng, develop KASP molecular markers for assisted breeding, and realize early molecular-assisted selection of target traits to improve breeding efficiency. Summary of the invention

[0005] In view of the above problems, the purpose of the present invention is to provide a SNP molecular marker related to the content of notoginseng saponin R1 in Panax notoginseng and its application.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] The present invention provides a kit for detecting SNP molecular markers related to notoginseng saponin R1 content in Panax notoginseng and its application in notoginseng saponin R1 content trait breeding. The SNP molecular marker is SNP5-188995192, located at the 188995192th base of Chr5 chromosome, and its mutation type is G / C.

[0008] Preferably, in the SNP5-188995192, the notoginsenoside R1 content of the CC genotype is higher than that of the GG / GC genotype.

[0009] The present invention also provides an application of a KASP primer pair for detecting SNP molecular markers related to the notoginseng saponin R1 content in Panax notoginseng in breeding for the notoginseng saponin R1 content trait in Panax notoginseng. The KASP primers include an upstream primer SNP5-F1 for detecting the SNP5-188995192, an upstream primer SNP5-F2 and a downstream primer SNP5-R.

[0010] Preferably,

[0011] The SNP5-F1: 5'-GAAGGTGACCAAGTTCATGCTTTTTTCAATTGAGGTTGTCACGTG-3';

[0012] The SNP5-F2: 5'-GAAGGTCGGAGTCAACGGATTTTTTTCAATTGAGGTTGTCACGTC-3';

[0013] The SNP5-R: 5'-CAGCAATATTCAAAGAGTCACGTCA-3'.

[0014] The present invention also provides a method for detecting the content of notoginsenoside R1 in Panax notoginseng, comprising the following steps:

[0015] (1) extracting DNA from a Panax notoginseng sample to be tested as a template;

[0016] (2) performing PCR amplification on the template using the KASP primers described in claim 3 or 4;

[0017] (3) After PCR amplification, the fluorescence signal was read and analyzed and converted by the high-throughput genotyping system GeneMatrix, and the molecular marker loci SNP5-188995192 of the sample to be identified for the content of notoginseng saponin R1 were genotyped;

[0018] (4) The method for determining the phenotype of the notoginseng saponin R1 content trait of the Panax notoginseng to be identified in step (3) is as follows: if the identified genotype is CC, it is determined that the notoginseng saponin R1 content in the Panax notoginseng sample is high; if the identified genotype is GG / GC, it is determined that the notoginseng saponin R1 content in the Panax notoginseng sample is low.

[0019] Preferably, the PCR amplification program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 sec; annealing at 61-55°C for 40 sec, reducing 0.6°C in each cycle, 10 cycles; denaturation at 95°C for 20 sec, annealing at 55°C for 40 sec, 40 cycles.

[0020] Preferably, the PCR amplification system is: 1 μL of 15 ng / μL DNA template; 1 μL of 2×KASP Master mix; 0.01 μL of KASP mixed primers, wherein the volume ratio of upstream primer SNP5-F1, upstream primer SNP2-F5 and downstream primer SNP5-R is 1:1:3.

[0021] The present invention has the following beneficial effects:

[0022] The SNP significantly associated with the notoginseng saponin R1 content in Panax notoginseng provided by the present invention is obtained by performing association analysis on 236 natural populations of Panax notoginseng, using the SNP site as genotype data, using the notoginseng saponin R1 content as its phenotypic data, and using EMMAX software and a mixed linear model (MLM) to perform genome-wide association (GWAS) analysis screening. The SNP molecular marker SNP5-188995192 is located at the 188995192th base of the Chr5 chromosome, and provides technical support for molecular marker-assisted breeding of the notoginseng saponin R1 content trait in Panax notoginseng.

[0023] The KASP primer combination developed by the present invention can directly distinguish and detect the G or C base of the mutation site of SNP5-188995192 specifically. When the KASP primer combination is used to identify the high and low content of notoginseng saponin R1, the two genotypes can be clearly separated. In the molecular marker SNP5-188995192, the dot close to the Y axis is a CC allele variation site, the genotype is CC, and the notoginseng saponin R1 content of the genotype notoginseng is relatively high; the dot close to the X axis is a GG allele variation site, the genotype is GG, and the notoginseng saponin R1 content of the genotype notoginseng is relatively low; the KASP primer combination developed by the present invention has good application value, can realize the pre-selection of the notoginseng saponin R1 content trait of Panax notoginseng and molecular assisted breeding, and has important theoretical and practical guiding significance for the genetic improvement process of notoginseng saponin R1 content breeding of Panax notoginseng and improving the breeding selection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Manhattan and QQ-plot of GWAS results of notoginseng saponin R1 in Panax notoginseng;

[0025] Figure 2 This is a statistical diagram of the allelic variation of notoginseng saponin R1 content and phenotypic significance in Panax notoginseng;

[0026] Figure 3 The genotyping results of different Panax notoginseng samples using KASP special primers. DETAILED DESCRIPTION

[0027] The following is further described in conjunction with the specific embodiments of the present invention. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0028] Example 1

[0029] Obtaining nucleotide mutation sites (SNPs) related to notoginsenoside R1 content in Panax notoginseng

[0030] (1) DNA extraction and high-throughput sequencing:

[0031] 236 samples of natural populations of Panax notoginseng were collected, and genomic DNA was extracted using the CTAB method, and 10X whole genome resequencing was performed.

[0032] (2) Determination of notoginsenoside R1 content:

[0033] The Panax notoginseng sample was dried at a constant temperature of 50°C to constant weight, crushed with a pulverizer, and passed through a No. 4 sieve for later use. 0.6g of the sample was accurately weighed with an analytical balance, 50ml of methanol was added, weighed, the bottle mouth was sealed with a sealing film, ultrasonicated for 30min, taken out and allowed to stand for 20h, the sealing film was removed, the weight was determined, the lost weight was supplemented with methanol, shaken, and 1ml of the test solution was obtained by filtering with a 0.22μm microporous filter membrane. The Panax notoginseng saponin R1 was quantitatively analyzed using high performance liquid chromatography (HPLC) and the external standard method. The chromatographic column was Agilent ZORBAX SB-AQ (3.5 μm, 4.6×150 mm), the flow rate was 0.7 ml / min, the column temperature was 30°C, the injection volume was 10 μl; the detection wavelength was 203 nm; the mobile phase was acetonitrile (A) and H2O (B), and the elution gradient was: 0-12 min, 19% (A); 12-60 min, 19-36% (A). The compound was identified according to its retention time, and the external standard method was used for quantification, with the peak area as the quantitative basis.

[0034] (3) Genome-wide association study (GWAS)

[0035] Using SNP loci as genotype data and notoginseng saponin R1 content as phenotypic data, EMMAX software and mixed linear model (MLM) were used to perform genome-wide association study (GWAS). Figure 1 As shown. Using -log10(P)>6 as the threshold, the SNP molecular marker SNP5-188995192, which is significantly associated with notoginseng saponin R1, is located at the 188995192th base of chromosome Chr11. Comparing the reference genome of Panax notoginseng, the sequence allele variation of SNP was extracted, and the notoginseng saponin R1 content of the population material was combined for joint analysis. SNP5-188995192 has three genotypes: GG, CC, and GC. After using the T test, it was found that the notoginseng saponin R1 content in the CC genotype was higher, which was the dominant genotype ( Figure 2 ).

[0036] The gene sequence including 100 bp before and after SNP5-188995192 is shown in SEQ ID NO.1:

[0037] TTATATATTATATTTTACTTCAGTGATCGAAATTTTAATTTTATCAATTAGATGATTGAACTATTAATTTTTTTAATTTTTTCAATTGAGGTTGTCACGT[G / C]AGAAATTGATGACGTGACTCTTTGAATATTGCTGA CGTGACTCTTTGGATAGGCCATTATTTAACTGATGTGTAATTAAAAAAGTAGTATTTTAATGTTT(SEQ ID NO.1)

[0038] Example 2

[0039] Development of specific primers for SNP marker KASP

[0040] Using the Primer-BLAST function of NCBI, three primers were designed according to the sequence of SEQ ID NO.1, namely, upstream primer F1, upstream primer SNP5-F2 and downstream primer R, wherein SNP5-F1 and SNP5-F2 respectively contain FAM and HEX fluorescent linker sequences (underlined), and the sequences are as follows:

[0041] SNP5-F1:5'- GAAGGTGACCAAGTTCATGC TTTTTTCAATTGAGGTTGTCACGTG-3'

[0042] SNP5-F2:5'- GAAGGTCGGAGTCAACGGAT TTTTTTCAATTGAGGTTGTCACGTC-3'

[0043] SNP5-R:5'-CAGCAATATTCAAAGAGTCACGTCA-3'

[0044] Example 3

[0045] Detection of genotypes of SNP loci in different Panax notoginseng samples and its application

[0046] The authenticity of SNP5-188995192 in the natural population of Panax notoginseng was verified by the high-throughput genotyping system GeneMatrix (GM). 94 individual Panax notoginseng plants were randomly selected, and genomic DNA of the samples was extracted respectively. The genomic DNA was used as a template and the SNP marker KASP specific primers developed in Example 2 were used for PCR amplification.

[0047] The reaction system for PCR amplification is: 1 μL of 15 ng / μL DNA template; 1 μL of 2×KASP Master mix; 0.01 μL of KASP mixed primers, in which the volume ratio of upstream primer SNP5-F1, upstream primer SNP5-F2 and downstream primer SNP5-R is 1:1:3. The PCR amplification program is: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec; 61~55℃ annealing for 40 sec, each cycle decreases by 0.6℃, 10 cycles; 95℃ denaturation for 20 sec, 55℃ annealing for 40 sec, 40 cycles. After PCR amplification is completed, the fluorescence signal is read, analyzed and converted, and the results of fluorescence scanning are automatically converted into graphics. Both pairs of labeled primers can clearly separate the two genotypes.

[0048] In the molecular marker SNP5-188995192, the dots close to the Y axis are the CC allele variant sites, the genotype is CC, and the notoginseng saponin R1 content of this genotype of Panax notoginseng is relatively high; the dots close to the X axis are the GG allele variant sites, the genotype is GG, and the notoginseng saponin R1 content of this genotype of Panax notoginseng is relatively low ( Figure 3 ).

[0049] The above is a detailed description of the embodiments of the present invention, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the scope of protection of the present invention.

Claims

1. Application of a kit for detecting SNP molecular markers related to the content of notoginseng saponin R1 in Panax notoginseng in breeding for the content of notoginseng saponin R1 in Panax notoginseng, Features: The SNP molecular marker is SNP5-188995192, located at the 188995192th base of Chr5 chromosome, and its mutation type is G / C.

2. The use according to claim 1, It is characterized in that In the SNP5-188995192, the notoginseng saponin R1 content of the CC genotype is higher than that of the GG / GC genotype.

3. Application of KASP primer pair for detecting SNP molecular markers related to notoginseng saponin R1 content in notoginseng in breeding for notoginseng saponin R1 content in notoginseng, Features: The KASP primers include an upstream primer SNP5-F1, an upstream primer SNP5-F2 and a downstream primer SNP5-R for detecting the SNP5-188995192.

4. The use according to claim 3, It is characterized in that The SNP5-F1: 5'-GAAGGTGACCAAGTTCATGCTTTTTTCAATTGAGGTTGTCACGTG-3'; The SNP5-F2: 5'-GAAGGTCGGAGTCAACGGATTTTTTTCAATTGAGGTTGTCACGTC-3'; The SNP5-R: 5'-CAGCAATATTCAAAGAGTCACGTCA-3'.

5. A method for detecting the content of notoginseng saponin R1 in Panax notoginseng, Features: The steps include: (1) extracting DNA from a Panax notoginseng sample to be tested as a template; (2) performing PCR amplification on the template using the KASP primers described in claim 3 or 4; (3) After PCR amplification, the fluorescence signal was read and analyzed and converted by the high-throughput genotyping system GeneMatrix, and the molecular marker loci SNP5-188995192 of the sample to be identified for the content of notoginseng saponin R1 were genotyped; (4) The method for determining the phenotype of the notoginseng saponin R1 content trait of the Panax notoginseng to be identified in step (3) is as follows: if the identified genotype is CC, it is determined that the notoginseng saponin R1 content in the Panax notoginseng sample is high; if the identified genotype is GG / GC, it is determined that the notoginseng saponin R1 content in the Panax notoginseng sample is low.

6. The method according to claim 5, It is characterized in that The PCR amplification procedure is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 sec; annealing at 61-55°C for 40 sec, decreasing by 0.6°C in each cycle, 10 cycles; denaturation at 95°C for 20 sec, annealing at 55°C for 40 sec, 40 cycles.

7. The method according to claim 5, It is characterized in that The PCR amplification system is: 1 μL of 15 ng / μL DNA template; 1 μL of 2×KASP Master mix; 0.01 μL of KASP mixed primers, wherein the volume ratio of upstream primer SNP5-F1, upstream primer SNP5-F2 and downstream primer SNP5-R is 1:1:3.

Images