SNP 5-188995192 related to content of notoginsenoside R1 in panax notoginseng and application thereof

Abstract

The application discloses an application of a kit for detecting a SNP molecular marker related to the content of ginsenoside R1 in Panax notoginseng to breeding of the content of ginsenoside R1 in Panax notoginseng, wherein the SNP molecular marker is SNP5-188995192, is located at the base of 188995192 of Chr5 chromosome, and the mutation type is G / C. The KASP primer combination developed in the application can accurately distinguish Panax notoginseng with high and low contents of ginsenoside R1, and can be applied to molecular assisted marker breeding of Panax notoginseng, shortens the breeding cycle of new varieties, and has low detection cost, is not limited by environment, has high accuracy of detection results, and is easy to repeat. The application has important theoretical and practical guiding significance for accelerating the genetic improvement process of Panax notoginseng with high content of ginsenoside R1 and improving the selection efficiency of breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics and breeding technology, and specifically relates to an SNP molecular marker related to the content of notoginsenoside R1 in Panax notoginseng and its application. Background Technology

[0002] Panax notoginseng is a perennial herb belonging to the Araliaceae family of the ginseng genus. Its roots and rhizomes are used medicinally, possessing properties that disperse blood stasis, stop bleeding, reduce swelling, and relieve pain. It is one of my country's unique and precious traditional Chinese medicinal materials. Panax notoginseng is increasingly widely used clinically and is one of the main raw materials for several proprietary Chinese medicines, including Xue Sai Tong soft capsules, Yunnan Baiyao, Compound Danshen tablets, Compound Danshen dripping pills, and Zhangzhou Pian Zai Huang. Panax notoginseng saponins are the most important active ingredients in Panax notoginseng, and their content and types are important indicators for evaluating its quality.

[0003] Quality breeding is the core measure for selecting superior varieties. Studies have shown that identifying superior allelic variations of key genes controlling important agronomic traits and developing allelic-specific molecular markers can be effectively utilized for marker-assisted selection breeding. Currently, Panax notoginseng variety breeding mainly employs the group mixed selection method, relying primarily on phenotypic selection to obtain population varieties, which is the main breeding approach at present. However, each generation of Panax notoginseng requires at least 3 years, resulting in extremely slow phenotypic segregation and population construction. Furthermore, the lack of early selection and identification methods leads to a long breeding cycle and low efficiency, requiring 15-20 years to develop a new variety. Simultaneously, Panax notoginseng is a cross-pollinated plant, and to date, there are no pure-line breeding materials, severely limiting the application of hybridization breeding methods in Panax notoginseng variety selection. Distant hybridization is also difficult to use for Panax notoginseng germplasm improvement.

[0004] With the development of omics technologies, molecular genetic breeding of medicinal plants based on molecular markers can greatly improve breeding efficiency and make molecular design breeding for targeted enhancement of the effective components of medicinal plants possible. SNP markers (single nucleotide polymorphisms) mainly refer to DNA sequence polymorphisms caused by single nucleotide variations at the genome level, and are currently the molecular markers with the highest polymorphism coverage and density. Compared with traditional marker-assisted selection, high-throughput resequencing technology can generate large-scale SNP markers, promoting precise association analysis between markers and traits and improving the efficiency of molecularly assisted selection breeding. The content and types of saponins in Panax notoginseng should be the core target for Panax notoginseng variety selection. Therefore, utilizing known saponin biosynthesis genes and abundant Panax notoginseng germplasm resources, it is particularly important to identify SNPs significantly associated with the content of Panax notoginseng saponins, develop KASP molecular markers for assisted breeding, and achieve early molecularly assisted selection of target traits to improve breeding efficiency. Summary of the Invention

[0005] To address the above problems, the purpose of this invention is to provide an SNP molecular marker related to the content of notoginsenoside R1 in Panax notoginseng and its application.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] This invention provides a kit for detecting SNP molecular markers related to the content of notoginsenoside R1 in Panax notoginseng, and its application in breeding for the trait of notoginsenoside R1 content in Panax notoginseng. The SNP molecular marker is SNP5-188995192, located at base 188995192 on chromosome 5, and its mutation type is G / C.

[0008] Preferably, in SNP5-188995192, the content of Panax notoginseng saponin R1 in the CC genotype is higher than that in the GG / GC genotype.

[0009] This invention also provides the application of KASP primer pairs for detecting SNP molecular markers related to the content of notoginsenoside R1 in Panax notoginseng in breeding for the trait of notoginsenoside R1 content in Panax notoginseng. The KASP primers include upstream primer SNP5-F1, upstream primer SNP5-F2 and downstream primer SNP5-R for detecting SNP5-188995192.

[0010] Preferred,

[0011] The SNP5-F1:5'-GAAGGTGACCAAGTTCATGCTTTTTTCAATTGAGGTTGTCACGTG-3';

[0012] The SNP5-F2: 5'-GAAGGTCGGAGTCAACGGATTTTTTTCAATTGAGGTTGTCACGTC-3';

[0013] The SNP5-R:5'-CAGCAATATTCAAAGAGTCACGTCA-3'.

[0014] This invention also provides a method for detecting the content of notoginsenoside R1 in Panax notoginseng, comprising the following steps:

[0015] (1) Extract DNA from the Panax notoginseng sample to be tested as a template;

[0016] (2) Perform PCR amplification of the template using the KASP primers described in claim 3 or 4;

[0017] (3) After PCR amplification, the fluorescence signal was read and converted by the high-throughput genotyping system GeneMatrix. The fluorescence signal was analyzed and converted to perform genotyping on the SNP5-188995192 molecular marker site of the sample to be identified for the content of Panax notoginseng saponins R1.

[0018] (4) The method for determining the phenotypic trait of the content of notoginsenoside R1 in step (3) is as follows: If the identified genotype is CC, it is determined that the content of notoginsenoside R1 in the notoginseng sample is high; if the identified genotype is GG / GC, it is determined that the content of notoginsenoside R1 in the notoginseng sample is low.

[0019] Preferably, the PCR amplification program is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 sec; annealing at 61–55℃ for 40 sec, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 95℃ for 20 sec, annealing at 55℃ for 40 sec, for 40 cycles.

[0020] Preferably, the PCR amplification system is as follows: 1 μL of 15 ng / μL DNA template; 1 μL of 2×KASP Master mix; 0.01 μL of KASP mixed primers, wherein the volume ratio of upstream primer SNP5-F1, upstream primer SNP2-F5 and downstream primer SNP5-R is 1:1:3.

[0021] The present invention has the following beneficial effects:

[0022] The SNPs significantly associated with the content of notoginsenoside R1 in Panax notoginseng provided by this invention were obtained through association analysis of 236 natural Panax notoginseng populations. SNP loci were used as genotype data, and notoginsenoside R1 content was used as phenotypic data. Genome-wide association analysis (GWAS) was performed using EMMAX software with a mixed linear model (MLM). The SNP molecular marker SNP5-188995192, located at base 188995192 on chromosome 5, provides technical support for marker-assisted breeding of the notoginsenoside R1 content trait in Panax notoginseng.

[0023] The KASP primer combination developed in this invention can directly and specifically distinguish and detect the G or C bases at the mutation site of SNP5-188995192. When using this KASP primer combination to identify the content of Panax notoginseng saponin R1, it can clearly separate the two genotypes. In the molecular marker SNP5-188995192, the dots near the Y-axis indicate the CC allelic variant site, with the genotype CC, and the Panax notoginseng with this genotype has a relatively high content of Panax notoginseng saponin R1; the dots near the X-axis indicate the GG allelic variant site, with the genotype GG, and the Panax notoginseng with this genotype has a relatively low content of Panax notoginseng saponin R1. The KASP primer combination developed in this invention has good application value, enabling pre-selection and molecular-assisted breeding of the Panax notoginseng saponin R1 content trait. It has important theoretical and practical guiding significance for the genetic improvement process of breeding for Panax notoginseng with high Panax notoginseng saponin R1 content and for improving breeding selection efficiency. Attached Figure Description

[0024] Figure 1 Manhattan and QQ-plots of GWAS results for notoginsenoside R1 in Panax notoginseng;

[0025] Figure 2 A statistical graph showing the allelic variation and phenotypic significance of the content of notoginsenoside R1 in Panax notoginseng;

[0026] Figure 3 Genotyping results of different Panax notoginseng samples using KASP-specific primers. Detailed Implementation

[0027] The following description, in conjunction with specific embodiments of the present invention, provides further details. It should be noted that these descriptions are intended to aid in understanding the invention but do not constitute a limitation thereof. Furthermore, the technical features described in the various embodiments of the invention below can be combined with each other as long as they do not conflict with each other.

[0028] Example 1

[0029] Nucleotide mutation sites (SNPs) related to the content of notoginsenoside R1 in Panax notoginseng were obtained.

[0030] (1) DNA extraction and high-throughput sequencing:

[0031] We collected 236 natural populations of Panax notoginseng, extracted genomic DNA using the CTAB method, and performed 10X whole-genome resequencing.

[0032] (2) Determination of Panax notoginseng saponin R1 content:

[0033] The Panax notoginseng sample was dried at 50℃ to constant weight, pulverized using a pulverizer, and passed through a No. 4 sieve for later use. 0.6 g of the sample was accurately weighed using an analytical balance, 50 ml of methanol was added, and the mixture was weighed again. The bottle was sealed with sealing film, sonicated for 30 min, and allowed to stand for 20 h. The sealing film was removed, and the sample was weighed again. The lost weight was replenished with methanol, and the mixture was shaken well. 1 ml of the test solution was obtained by filtration through a 0.22 μm microporous membrane. The saponin R1 of Panax notoginseng was quantitatively analyzed using high performance liquid chromatography (HPLC) with the external standard method. The chromatographic column was an Agilent ZORBAX SB-AQ (3.5 μm, 4.6 × 150 mm), the flow rate was 0.7 mL / min, the column temperature was 30 °C, and the injection volume was 10 μL. The detection wavelength was 203 nm. The mobile phase was acetonitrile (A) and H₂O (B), with the elution gradient as follows: 0–12 min, 19% (A); 12–60 min, 19–36% (A). Compounds were identified based on their retention time, and quantification was performed using the external standard method, with peak area as the quantification basis.

[0034] (3) Genome-wide association analysis (GWAS)

[0035] Using SNP loci as genotypic data and the content of Panax notoginseng saponin R1 as phenotypic data, genome-wide association studies (GWAS) were performed using EMMAX software with a mixed linear model (MLM). The results are as follows: Figure 1 As shown. Using -log10(P)>6 as the threshold, the SNP molecular marker SNP5-188995192, which is significantly associated with Panax notoginseng saponin R1, is located at base 188995192 on chromosome Chr11. By comparing with the Panax notoginseng reference genome, the sequence allelic variations of the SNPs were extracted, and combined with the content of Panax notoginseng saponin R1 in the population material for joint analysis. SNP5-188995192 has three genotypes: GG, CC, and GC. After t-test, it was found that the CC genotype had a higher content of Panax notoginseng saponin R1, making it the dominant genotype. Figure 2 ).

[0036] The gene sequence containing 100 bp before and after the SNP5-188995192 site is shown in SEQ ID NO.1:

[0037] TTATATATTATATTTTACTTCAGTGATCGAAATTTTAATTTTATCAATTAGATGATTGAACTATTAATTTTTTTAATTTTTTCAATTGAGGTTGTCACGT[G / C]AGAAATTGATGACGTGACTCTTTGAATATTGCTGA CGTGACTCTTTGGATAGGCCATTATTTAACTGATGTGTAATTAAAAAAGTAGTATTTTAATGTTT(SEQ ID NO.1)

[0038] Example 2

[0039] Development of SNP-labeled KASP-specific primers

[0040] Using NCBI's Primer-BLAST function, three primers were designed based on the sequence SEQ ID NO.1: upstream primer F1, upstream primer SNP5-F2, and downstream primer R. SNP5-F1 and SNP5-F2 contain FAM and HEX fluorescent linker sequences (underlined), respectively. The sequences are as follows:

[0041] SNP5-F1:5'- GAAGGTGACCAAGTTCATGC TTTTTTCAATTGAGGTTGTCACGTG-3'

[0042] SNP5-F2:5'- GAAGGTCGGAGTCAACGGAT TTTTTTCAATTGAGGTTGTCACGTC-3'

[0043] SNP5-R:5'-CAGCAATATTCAAAGAGTCACGTCA-3'

[0044] Example 3

[0045] Genotyping of SNP loci in different Panax notoginseng samples and its application

[0046] The authenticity of SNP5-188995192 in the natural population of Panax notoginseng was verified using the high-throughput genotyping system GeneMatrix (GM). Genomic DNA was extracted from 94 randomly selected Panax notoginseng single plants. Using the genomic DNA as a template, PCR amplification was performed using the SNP marker KASP-specific primers developed in Example 2.

[0047] The PCR amplification reaction system consisted of: 1 μL of 15 ng / μL DNA template; 1 μL of 2×KASP Master mix; and 0.01 μL of KASP mixed primers, with the volume ratio of upstream primer SNP5-F1, upstream primer SNP5-F2, and downstream primer SNP5-R being 1:1:3. The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec; annealing at 61–55℃ for 40 sec, decreasing by 0.6℃ per cycle, for 10 cycles; followed by 95℃ denaturation for 20 sec and 55℃ annealing for 40 sec, for 40 cycles. After PCR amplification, the fluorescence signal was read, analyzed, and converted. The fluorescence scan results were automatically converted into graphs, and both pairs of labeled primers clearly separated the two genotypes.

[0048] In the molecular marker SNP5-188995192, the dots closer to the Y-axis represent sites carrying the CC allelic variant, with the genotype CC. Panax notoginseng with this genotype has a relatively high content of notoginsenoside R1. The dots closer to the X-axis represent sites carrying the GG allelic variant, with the genotype GG. Panax notoginseng with this genotype has a relatively low content of notoginsenoside R1. Figure 3 ).

[0049] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. The application of a kit for detecting SNP molecular markers related to the content of notoginsenoside R1 in Panax notoginseng in breeding for the trait of notoginsenoside R1 content in Panax notoginseng, characterized in that: The SNP molecular marker is SNP5-188995192, located at base 188995192 on chromosome Chr5. Its mutation type is G / C. The gene sequence containing 100 bp before and after the SNP5-188995192 site is shown in SEQ ID NO.1 and SEQ ID NO.

2. In SNP5-188995192, the content of Panax notoginsenoside R1 in the CC genotype is higher than that in the GG genotype.

2. The application of the KASP primer pair for detecting the SNP5-188995192 molecular marker associated with the content of notoginsenoside R1 in Panax notoginseng as described in claim 1 in the breeding of notoginsenoside R1 content in Panax notoginseng, characterized in that: The KASP primers include upstream primer SNP5-F1, upstream primer SNP5-F2, and downstream primer SNP5-R for detecting SNP5-188995192; in SNP5-188995192, the content of Panax notoginseng saponin R1 in the CC genotype is higher than that in the GG genotype. The SNP5-F1:5'-GAAGGTGACCAAGTTCATGCTTTTTTCAATTGAGGTTGTCACGTG-3'; The SNP5-F2: 5'-GAAGGTCGGAGTCAACGGATTTTTTTCAATTGAGGTTGTCACGTC-3'; The SNP5-R is: 5'-CAGCAATATTCAAAGAGTCACGTCA-3'.

3. A method for detecting the content of notoginsenoside R1 in Panax notoginseng, characterized in that: Includes the following steps: (1) Extract DNA from the Panax notoginseng sample to be tested as a template; (2) PCR amplification of the template using the KASP primers described in claim 2; (3) After PCR amplification, the fluorescence signal was read by the high-throughput genotyping system GeneMatrix, the fluorescence signal was analyzed and converted, and the genotyping of the content of notoginsenoside R1 in the sample to be identified was performed on the SNP5-188995192 molecular marker site as described in claim 1. (4) The method for determining the phenotypic trait of the content of notoginsenoside R1 in the sample to be identified in step (3) is as follows: if the identified genotype is CC, then the content of notoginsenoside R1 in the sample is high; if the identified genotype is GG, then the content of notoginsenoside R1 in the sample is low.

4. The method according to claim 3, characterized in that, The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec; 61-55℃ annealing for 40 sec, decreasing by 0.6℃ per cycle, for 10 cycles; 95℃ denaturation for 20 sec, 55℃ annealing for 40 sec, for 40 cycles.

5. The method according to claim 4, characterized in that, The PCR amplification system consisted of: 1 μL of 15 ng / μL DNA template; 1 μL of 2×KASP Master mix; and 0.01 μL of KASP mixed primers, wherein the volume ratio of upstream primer SNP5-F1, upstream primer SNP5-F2, and downstream primer SNP5-R was 1:1:3.

Images