An InDel molecular marker, primer set and application thereof for identifying farnesol-type Cinnamomum camphora

Abstract

The present invention provides an InDel molecular marker, a primer set and an application thereof for identifying farnesol-type Cinnamomum camphora, and relates to the technical field of molecular markers. The nucleotide sequence of the molecular marker of the present invention is shown in SEQ ID NO.1, and there is a deletion of 27 bases at the 358th base of the sequence. The present invention designs a primer set for the above molecular marker, and the primer set includes an upstream primer and a downstream primer, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3. The primer set of the present invention can obtain a specific 384bp long band in Cinnamomum camphora plants with non-high farnesol content through PCR amplification, and the corresponding band cannot be obtained in Cinnamomum camphora plants of farnesol type. The molecular marker amplification of the present invention is relatively stable and can be used for the identification of Cinnamomum camphora plants of farnesol type.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and specifically relates to an InDel molecular marker, a primer set and application thereof for identifying farnesol-type Cinnamomum camphora. Background Art

[0002] Plant essential oils are a class of secondary metabolites produced in plants with important physiological effects. Farnesol is one of the main essential oil components of some spice plants and an important active ingredient of some Chinese herbal medicines. It is widely present in the flowers, leaves, stems and other parts of the plant body. Farnesol has a mild and delicate floral scent with the characteristics of lily of the valley. It has been widely used in the fields of medicine, pesticides, cosmetics and daily chemicals. Therefore, it plays an important role and has development prospects in the spices and pharmaceutical industries.

[0003] Cinnamomum tenuipile Kosterm. is a plant of the genus Cinnamomum, belonging to the genus Cinnamomum of the family Lauraceae. It is distributed in the bushes, sparse forests or dense forests of valleys or valleys at an altitude of 580-2100 meters in southern and western Yunnan. Its flowering period is from February to April, and its fruiting period is from June to October. The leaf essential oil content and purity of some of its plants are very high, and it is an important spice plant. There is a type of leaf essential oil of Cinnamomum tenuipile Kosterm. In it, farnesol accounts for a very high proportion, and because Cinnamomum tenuipile Kosterm. grows faster, has stronger germination power, can be continuously updated and continuously utilized, can be used to produce farnesol on a large scale at low cost, and has important economic value and development potential. However, existing studies have shown that the polymorphism of the main components of Cinnamomum tenuipile Kosterm. leaf essential oil is affected by multiple factors such as habitat, individual differences, and growth period, and especially there will be large differences between different individuals. The leaf essential oil of Cinnamomum camphora with a tree age of less than two years usually contains mixed essential oil components. Judging from the proportion of each component, there is no obvious main component. The main component of the leaf essential oil of different individuals in the plant group over two years old can reach 60%-99%, which may be linalool, geraniol, farnesol, 1,8-cineole, camphor, borneol, citral, phellandrene, elemene, elemene, methyl eugenol, etc. In addition, Cinnamomum camphora is a cross-pollinated plant with a very low natural fruiting rate. The chemical composition of sexual offspring will vary. For example, about 56% of the sexual offspring of geraniol-type Cinnamomum camphora can maintain the characteristics of the mother parent and can differentiate into 8 chemical types. About 50% of the sexual offspring of farnesol-type Cinnamomum camphora can maintain the characteristics of the mother parent and can differentiate into 1,8-eugenol, geraniol and other chemical types, and cannot stably inherit the essential oil component traits of the parent. The above problems limit the development and utilization of Cinnamomum camphora.

[0004] At present, there is no convenient and effective method to quickly identify the main components of the leaf essential oil of Cinnamomum quinquefolium seedlings after two years of maturity. In order to determine whether the leaf essential oil of Cinnamomum quinquefolium plants has a high content of farnesol, a large number of leaves from individuals over two years old can only be taken, and the total leaf essential oil can be extracted by steam distillation and other methods, and then the specific components and corresponding contents of the leaf essential oil can be identified by gas chromatography-mass spectrometry and other equipment. The whole process is time-consuming, inefficient, and expensive, and cannot meet the urgent needs of modern industrial production.

[0005] Molecular marker primers are specific primers used in PCR (polymerase chain reaction), which can be used to detect specific DNA fragments in the genome. Molecular markers are a type of genetic marker, which is essentially a DNA sequence that exists stably in different subgroups of a biological population and is linked to characteristic traits. Molecular marker technology is mainly used in the following areas: construction of genetic linkage maps; gene / QTL positioning; molecular marker-assisted selection breeding; plant genetic diversity analysis; variety and quality purity identification and genetic purity determination; disease detection. Molecular marker technology can quickly, accurately and efficiently identify potential individuals with special traits.

[0006] Therefore, it is of great significance to discover molecular markers linked to farnesol chemotypes and apply them to the screening of Cinnamomum quinquefolium seedlings. Summary of the invention

[0007] In view of this, the object of the present invention is to provide an InDel molecular marker, a primer set and an application thereof for identifying farnesol-type Cinnamomum camphora. The molecular marker amplification is stable and can be used for the identification of farnesol-type Cinnamomum camphora plants.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The invention provides an InDel molecular marker for identifying farnesol-type Cinnamomum camphora, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1.

[0010] The present invention also provides a primer set for identifying farnesol-type Cinnamomum camphora, wherein the primer set is designed with an upstream primer and a downstream primer according to the InDel molecular marker; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0011] The present invention also provides a kit for identifying farnesol-type Cinnamomum camphora, and the kit comprises the primer set.

[0012] The present invention also provides the use of the molecular marker, the primer set or the kit in identifying farnesol-type Cinnamomum camphora.

[0013] The present invention also provides the use of the molecular marker, the primer set or the kit in the directional breeding of farnesol-type Cinnamomum camphora

[0014] The present invention also provides a method for identifying farnesol-type Cinnamomum camphora, comprising the following steps:

[0015] Extracting genomic DNA from the sample to be tested;

[0016] Using the genomic DNA of the sample as a template, performing PCR amplification using the primer set or the kit, and performing electrophoresis detection on the PCR amplification product;

[0017] Farnesol-type Cinnamomum camphora was identified based on the electrophoresis band results.

[0018] Preferably, the identification criteria are as follows: if no insert fragment of 384 bp is amplified in the PCR amplification product, the sample to be tested is farnesol-type Cinnamomum camphora; if a 384 bp insert fragment is amplified in the amplification product, the sample to be tested is non-farnesol Cinnamomum camphora.

[0019] Preferably, the reaction system of the PCR amplification is as follows in 20 μL: 1 μL of 15-25 ng DNA template, 1 μL of 0.1-0.3 μM upstream primer, 1 μL of 0.1-0.3 μM downstream primer, 10 μL of 2×TaqMasterMix, supplemented with ddH2O to 20 μL.

[0020] Preferably, the reaction procedure of the PCR amplification is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 32 amplification cycles; extension at 72°C for 5 min; and storage at 4°C.

[0021] More preferably, the farnesol-type Cinnamomum quinoa refers to Cinnamomum quinoa leaf essential oil extracted by steam distillation, in which the content of farnesol is higher than 60%.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] (1) The existing method for determining the main components of the essential oil of Cinnamomum pubescens leaves requires that the seedlings with stable leaf essential oil properties be used as materials, and a large number of leaves are taken to extract the leaf essential oil, and the components are identified by methods such as gas chromatography-mass spectrometry, which is extremely cumbersome, time-consuming and laborious. Using the primer set provided by the present invention, only a few milligrams of leaf-extracted DNA is needed as a template for the PCR reaction, and all tissues and developmental stages of the plant body can be detected, without being restricted by seasons and the environment, and there is no need to wait for the seedlings to grow to two years old, thereby improving the directionality of seedling cultivation, greatly shortening the seedling cultivation cycle, being easy to operate, and being able to save a lot of manpower and material resources.

[0024] (2) The primer set of the present invention can obtain a specific 384 bp long band by PCR amplification in Cinnamomum camphora plants without high farnesol content, but no corresponding band can be obtained in Cinnamomum camphora plants with farnesol content. The molecular marker amplification of the present invention is relatively stable and can be used for the identification of Cinnamomum camphora plants with farnesol content. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The electrophoresis diagram is the result of PCR reaction of 146 Cinnamomum quinquefolium genomes using the primers provided by the present invention. DETAILED DESCRIPTION

[0026] The invention provides a molecular marker for identifying farnesol-type camphor trees. The nucleotide sequence of the molecular marker is TGTTTGGCGTAGCCCTTGATCCTTGATCGAACTAGATCAATCTTCAATGGGATTGATCGAATCCAAGGATGAATTTTGAAAACTAGAACACACTCCCACTAATGGGAAACACCATATTGAAGAGAAACTCAGATAAATTATCGATTAATTGTAATGAGCATGTCTTACAATGAAGCATTGGACTTCCTTATATAGTTTAGTAGACTT GATCCCTAAGCAACAAAACTTTCTATATCTGACTAATCTTAATTAAAATATAAAACTTGCTAATATTAATCCTAATCAAATAATAATTAGAAATAGGGATATAGTTAGAAGTCCGCAAAAGCTCTCTGTCCAATTGGGCCTGTGGCTGAACCCAATGGATCGGTTTGACCAATTGGG (SEQ ID NO.1), and the molecular marker is named as Ct09del-nFar. The molecular marker of the present invention has a 27 base deletion at position 358. The molecular marker of the present invention has a 27 base deletion at position 33856150 bp of chromosome 9 in the genome of Cinnamomum pubescens.

[0027] The present invention also provides a primer set for identifying farnesol-type Cinnamomum camphora, wherein the primer set is designed with an upstream primer and a downstream primer according to the molecular marker; the nucleotide sequence of the upstream primer is TGTTTGGCGTAGCCCTTGA (SEQ ID NO.2); the nucleotide sequence of the downstream primer is CCCAATTGGTCAAACCGATCCA (SEQ ID NO.3).

[0028] The present invention also provides a kit for identifying farnesol-type Cinnamomum camphora, and the kit comprises the primer set.

[0029] The present invention also provides the use of the molecular marker, the primer set or the kit in identifying farnesol-type Cinnamomum camphora.

[0030] The present invention also provides the use of the molecular marker, the primer set or the kit in the directional breeding of farnesol-type Cinnamomum camphora

[0031] The present invention also provides a method for identifying farnesol-type Cinnamomum camphora, which preferably comprises the following steps:

[0032] Extracting genomic DNA from the sample to be tested;

[0033] Using the genomic DNA of the sample as a template, performing PCR amplification using the primer set or the kit, and performing electrophoresis detection on the PCR amplification product;

[0034] Farnesol-type Cinnamomum camphora was identified based on the electrophoresis band results.

[0035] In the present invention, the method for extracting genomic DNA from the sample to be tested can be conventionally selected according to needs. In the present invention, the CTAB method is preferably used to extract genomic DNA from the leaves of Cinnamomum quinquefolium plants.

[0036] In the present invention, the identification criteria are preferably as follows: if no insert fragment of 384 bp is amplified in the PCR amplification product, the sample to be tested is farnesol-type Cinnamomum camphora; if an insert fragment of 384 bp is amplified in the amplification product, the sample to be tested is non-farnesol Cinnamomum camphora.

[0037] In the present invention, the reaction system of the PCR amplification is preferably calculated as follows: 1 μL of 15-25 ng DNA template, 1 μL of 0.1-0.3 μM upstream primer, 1 μL of 0.1-0.3 μM downstream primer, 10 μL of 2×Taq MasterMix, supplemented with ddH2O to 20 μL. In the present invention, the concentrations of the upstream primer and the downstream primer are both final concentrations.

[0038] In the present invention, the reaction procedure of the PCR amplification is preferably as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 32 amplification cycles; extension at 72°C for 5 min; and storage at 4°C.

[0039] In the present invention, the essential oil of Cinnamomum camphora leaves is extracted by conventional steam distillation, and the steps are as follows: take fresh Cinnamomum camphora leaves, chop them and add ultrapure water, steam distill and extract for 2-5 hours, collect the distillate, and dry it with anhydrous sodium sulfate to obtain the Cinnamomum camphora leaf essential oil. The present invention analyzes and identifies the components of the Cinnamomum camphora essential oil, and defines the plants whose main compound of the leaf essential oil is farnesol and whose content accounts for more than 60% as farnesol-type Cinnamomum camphora, and the remaining plants are defined as non-farnesol-type Cinnamomum camphora. That is, the farnesol-type Cinnamomum camphora in the present invention refers to the Cinnamomum camphora leaf essential oil extracted by steam distillation, in which the content of farnesol accounts for more than 60%. In the present invention, the essential oil components are preferably identified by an internationally accepted method, specifically: by comparing the gas chromatography (GC) retention index RI (retention index) of each component of the sample calculated by the present invention, matching the retention index published by the NIST Chemistry WebBook of the National Institute of Standards and Technology (National Institute of Standards and Technology), and comparing the NIST08 mass spectrometry database with published mass spectrometry data to analyze and identify the chemical components of the essential oil.

[0040] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0041] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0042] Example 1 Identification of farnesol-type Cinnamomum camphora and non-farnesol-type Cinnamomum camphora

[0043] In this example, the leaf essential oil of each individual plant of a group consisting of 146 Cinnamomum quinquefolium individuals planted in Xishuangbanna Tropical Botanical Garden of the Chinese Academy of Sciences was extracted and the components were identified. The germplasm resource information and identification results of the 146 Cinnamomum quinquefolium are shown in Table 1:

[0044] Table 1146 Cinnamomum quinquefolium germplasm resource information and identification results

[0045]

[0046]

[0047]

[0048]

[0049] In this population, 12 C. quinquefolia individuals had a farnesol content higher than 61.6% in their leaf essential oils, and the proportion of farnesol in the leaf essential oils of the other 134 plants was less than 2.7%. Therefore, the 12 C. quinquefolia individuals with a farnesol content higher than 61.6% in their leaf essential oils were considered farnesol-type C. quinquefolia, and the remaining 134 plants were considered non-farnesol-type C. quinquefolia.

[0050] Example 2 Screening of InDel molecular markers for identifying farnesol-type Cinnamomum camphora

[0051] In this example, the CTAB method was used to extract genomic DNA from each individual in a population of 146 Cinnamomum quinquefolium planted in the Xishuangbanna Tropical Botanical Garden of the Chinese Academy of Sciences.

[0052] The whole genome of the above-mentioned Cinnamomum quinquefolium population was resequenced using the MGI second-generation sequencing platform.

[0053] The applicant used the Oxford Nanopore Technology third-generation sequencing platform to sequence the whole genome of Cinnamomum wiltii, and used the third-generation sequencing data as the input file of the NextDenovo software to assemble the genome de novo to obtain a preliminary assembled genome; then the third-generation sequencing data and the second-generation sequencing data were used as input files of the NextPolish software to correct the errors of the preliminary assembled genome; then the sequencing data of the chromosome conformation capture technology (Hi-C) and the preliminary assembled genome after error correction were used as input files of the juicer / 3D-DNA process for chromosome construction, and finally the chromosome-level genome sequence of Cinnamomum wiltii was obtained.

[0054] Using the chromosome-level genome sequence of Cinnamomum quinquefolium as the reference genome, the population resequencing data was aligned to the reference genome using Bowtie2 to obtain an alignment file; the alignment file was then used as input to the GATK software to detect the variant sites in the population; then, using the main component of the leaf essential oil obtained in Example 1 as the trait, the Plink2 software was used to calculate the population differentiation index Fst and conduct related population analysis on this Cinnamomum quinquefolium population.

[0055] In the genome of farnesol-type Cinnamomum camphora, an InDel mutation site with a 27-base deletion was found at 33856150bp on chromosome 9. The deletion sequence in farnesol-type Cinnamomum camphora is CCAATGGATCGGTTTGACCAATTGGGTC (SEQ ID NO.4), while that in farnesol-type Cinnamomum camphora is C. The nucleotide sequence of the molecular marker finally determined by the present invention is as SEQ ID NO.1, and there is a 27-base deletion at position 358 of the sequence.

[0056] Example 3 Primer design for identifying farnesol-type Cinnamomum camphora

[0057] A primer set was designed according to the molecular marker obtained in Example 2, the primer set comprising an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer was TGTTTGGCGTAGCCCTTGAT (SEQ ID NO. 2); the nucleotide sequence of the downstream primer was CCCAATTGGTCAAACCGATCCA (SEQ ID NO. 3)

[0058] Example 4 Kit for identifying farnesol-type Cinnamomum camphora

[0059] A kit for identifying farnesol-type Cinnamomum camphora, comprising the primer set described in Example 3, 2×TaqMasterMix (novoprotein), and ddH2O.

[0060] Example 5

[0061] In this example, the genomic DNAs of 146 Cinnamomum quinquefolium obtained in Example 1 were used as templates and the primers obtained in Example 3 were used to perform PCR reactions.

[0062] The configuration of 20 μL PCR reaction system is shown in Table 2:

[0063] Table 2 PCR reaction system

[0064] Reagents Dosage 20ng Template 1μL 0.2 μM upstream primer 1μL 0.2 μM downstream primer 1μL 2×TaqMasterMix(novoprotein) 10μL <![CDATA[ddH2O]]> 7μL

[0065] After the configuration is completed, cover the PCR tube tightly, shake and mix, and centrifuge. Perform the PCR reaction using the following conditions. The PCR reaction conditions are shown in Table 3:

[0066] Table 3 PCR reaction conditions

[0067]

[0068] Electrophoresis of PCR products:

[0069] The electrophoresis was performed using 0.8% agarose gel at 165 V for 30 minutes and observed under UV light.

[0070] Taking the PCR results of 12 farnesol-type Cinnamomum camphora genomic DNAs and 134 random non-farnesol-type Cinnamomum camphora genomic DNAs as examples, the electrophoresis results showed that ( Figure 1 ), lanes 1-12 are farnesol-type Cinnamomum quinquefolium, and no 384 bp insert was amplified in the PCR amplification product thereof, and lanes 13-146 are non-farnesol-type Cinnamomum quinquefolium, and a 384 bp insert was amplified in the PCR amplification product thereof.

[0071] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer set for identifying farnesol-type Cinnamomum camphora, characterized in that: The primer set includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3; The farnesol-type Cinnamomum pubescens refers to Cinnamomum pubescens leaf essential oil extracted by steam distillation, in which the content of farnesol is higher than 60%.

2. A kit for identifying farnesol-type Cinnamomum camphora, characterized in that: The kit comprises the primer set according to claim 1, The farnesol-type Cinnamomum pubescens refers to Cinnamomum pubescens leaf essential oil extracted by steam distillation, in which the content of farnesol is higher than 60%.

3. Use of the primer set according to claim 1 or the kit according to claim 2 in identifying farnesol-type Cinnamomum camphora, characterized in that: The farnesol-type Cinnamomum pubescens refers to Cinnamomum pubescens leaf essential oil extracted by steam distillation, in which the content of farnesol is higher than 60%.

4. Use of the primer set according to claim 1 or the kit according to claim 2 in the directional breeding of farnesol-type Cinnamomum camphora, characterized in that: The farnesol-type Cinnamomum pubescens refers to Cinnamomum pubescens leaf essential oil extracted by steam distillation, in which the content of farnesol is higher than 60%.

5. A method for identifying farnesol-type Cinnamomum camphora, characterized in that: The steps include: Extracting genomic DNA from the sample to be tested; Using the genomic DNA of the sample as a template, performing PCR amplification using the primer set of claim 1 or the kit of claim 2, and performing electrophoresis detection on the PCR amplification product; Identify farnesol-type Cinnamomum camphora based on the electrophoresis band results; The farnesol-type Cinnamomum camphora refers to Cinnamomum camphora leaf essential oil extracted by steam distillation, in which the content of farnesol is higher than 60%; The identification criteria are as follows: if no insertion fragment of 384 bp is amplified in the PCR amplification product, the sample to be tested is farnesol-type Cinnamomum camphora; if an insertion fragment of 384 bp is amplified in the amplification product, the sample to be tested is non-farnesol Cinnamomum camphora.

6. The identification method according to claim 5, characterized in that: The reaction system of the PCR amplification is calculated as follows in 20 μL: 1 μL of 15-25 ng DNA template, 1 μL of 0.1-0.3 μM upstream primer, 1 μL of 0.1-0.3 μM downstream primer, 10 μL of 2×Taq MasterMix, and ddH2O is added to 20 μL.

7. The identification method according to claim 5, characterized in that: The reaction procedure of the PCR amplification is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 32 amplification cycles; extension at 72°C for 5 min; and storage at 4°C.

Images