A nucleic acid composition and a kit and method for detecting multiple respiratory pathogens in dogs

Abstract

The present invention relates to the field of detection of multiple respiratory pathogens in dogs, and specifically to a nucleic acid composition and a kit and method for detecting multiple respiratory pathogens in dogs. The kit uses RPA amplification reagents to directly and effectively amplify clinical samples, and the amplified products are targetedly cut by CRISPR reagents to generate fluorescent signals, and multiple respiratory pathogens in dogs are qualitatively or quantitatively detected based on the fluorescent signals. The kit and the detection method have high sensitivity, strong specificity, and are simple to operate. The detection personnel only need to add samples to detect, which reduces errors and deviations caused by the liquid preparation process, and does not require professional technicians.

Description

Technical Field

[0001] The present invention relates to the field of detection of multiple respiratory pathogens in dogs, and specifically to a nucleic acid composition and a kit and method for detecting multiple respiratory pathogens in dogs. Background Art

[0002] Called Canine Infectious Respiratory Disease (CIRDC), it is a complex infectious disease with symptoms that present as infectious tracheobronchitis, primarily characterized by a severe, dry cough that may be accompanied by ocular and nasal discharge. The disease is highly contagious and often causes symptoms in entire litters of animals. Transmission of the pathogen includes the aerosol route and can cause subclinical or mild upper respiratory tract symptoms that last an average of 1 to 2 weeks. In the past 20 years, new pathogens have been reported to cause acute onset of clinical signs, including canine herpesvirus-1 and canine influenza virus.

[0003] Among them, canine herpesvirus type 1 ( Canine Herpesvirus 1, CHV-1) is an enveloped double-stranded DNA virus of the genus Varicella virus. The host range of CHV-1 is limited to domestic and wild canines. CHV-1 is common in dogs around the world, and infection causes reproductive disorders and neonatal death in dogs. CHV-1 is mainly excreted through saliva, nasal juices, and urine, and is transmitted through the respiratory, digestive, and reproductive tracts; CHV-1 is transmitted to newborn puppies in the birth canal or through direct contact with mucosal secretions. Clinical symptoms vary depending on the age and immunity of the infected animal. Newborn puppies are particularly susceptible to CHV-1 infection and are prone to developing fatal systemic necrotizing and hemorrhagic diseases due to systemic spread of the virus, characterized by anorexia, dyspnea, abdominal pain, body incoordination, diarrhea, serous or hemorrhagic nasal discharge, and mucosal punctate hemorrhages. In dogs over 21 days of age, asymptomatic or mild and subclinical self-limited infections are most common. Infection in pregnant female dogs leads to fetal death, abortion, mummification, and stillbirth. Respiratory disease, eye symptoms and genital lesions have also been reported. CHV-1, like other herpes viruses, lurks in the nervous tissue. After severe stress or drug-induced immunosuppression, reinfection with the latent virus can occur, and the affected dog will excrete the virus intermittently through respiratory secretions throughout its life. There is currently no effective vaccine. Once canine herpesvirus disease occurs, it will cause serious economic losses to the dog breeding and farming industries.

[0004] At present, the methods for detecting CHV-1 include virus culture, histopathological examination, electron microscopy and the like. However, the existing technologies have low sensitivity in detecting CHV-1, and the operation is complicated and the accuracy of the results is poor. Polymerase chain reaction (PCR) is one of the most sensitive and specific technologies, especially for the detection of latent infection, but there is no PCR method in the art that can detect CHV-1 quickly, accurately, with high specificity and sensitivity.

[0005] Therefore, there is an urgent need in the art for a PCR detection reagent and a detection method for canine herpesvirus type 1 that is time-saving, highly specific, reproducible, and highly sensitive, so as to provide a reliable experimental basis for detecting canine herpesvirus type 1. Summary of the invention

[0006] In view of this, the present invention provides primer pairs, crRNA, nucleic acid compositions for amplifying nucleic acid sequences of multiple canine respiratory pathogens, RPA amplification reagents, CRISPR reagents, detection kits, detection methods and applications, so as to solve at least one of the above-mentioned technical problems to a certain extent.

[0007] One of the purposes of the present invention is to provide a primer pair, wherein the primer pair is shown in SEQ ID NO: 12 and 13, and the primer pair is used to amplify the nucleotide sequence shown in SEQ ID NO: 1.

[0008] One of the purposes of the present invention is to provide a crRNA, whose nucleotide sequence is shown in any one of SEQ ID NOs: 4 to 6, and the crRNA is used to guide the targeting of the nuclease Cas13a to guide the targeting of the nuclease Cas13a to the nucleotide sequence shown in SEQ ID NO: 1.

[0009] One of the purposes of the present invention is to provide a nucleic acid composition for detecting multiple respiratory pathogens in dogs, comprising the primer pair and the crRNA.

[0010] One of the purposes of the present invention is to provide an RPA amplification reagent for amplifying nucleic acid sequences of multiple canine respiratory pathogens, comprising: 75 mM Tris, 50 mM potassium acetate, 25 mM magnesium acetate, 25 mM β-mercaptoethanol, 3.5% polyethylene glycol-2000, 2 mM ATP, 20 mM polyphosphate, 50 ng / μL polyphosphate kinase, 250 nM of an upstream primer such as SEQ ID NO: 12, 250 nM of a downstream primer such as SEQ ID NO: 13, 300 ng / μL TthRecA protein, 600 ng / μL TthSSB protein and 0.26 U / μL Bst3.0 DNA polymerase.

[0011] One of the purposes of the present invention is to provide a CRISPR reagent for guiding the targeted cleavage of the nuclease Cas13a, comprising 12.5 ng / μL LwaCas13a, 10 ng / μL crRNA as described, 2 μM fluorescent reporter RNA, 5 U / μL T7 RNA polymerase, 1 M HEPES, 1 M solution, 25 mM0 rNTP mix, 40 U / mL 1 μL RNase inhibitor and enzyme-free water.

[0012] Specifically, the CRISPR reagent contains 19 μL of: 2 μL LwaCas13a (12.5 ng / μL), 1 μL crRNA (10 ng / μL), 1.25 μL fluorescent reporter RNA (2 μM), 0.5 μL T7 RNA polymerase (5 U / μL), 0.4 μL HEPES buffer (1 M), 0.18 μL MgCl2 solution (1 M), 0.8 μL rNTP mix (25 mM ATP, GTP, UTP, CTP), 1 μL RNase inhibitor (40 U / mL) and 11.87 μL enzyme-free water.

[0013] One of the purposes of the present invention is to provide a CRISPR reagent for guiding the targeted cleavage of the nuclease Cas13a, comprising 12.5 ng / μL LwaCas13a, 10 ng / μL of the crRNA, 2 μM fluorescent reporter RNA, 5 U / μL T7 RNA polymerase, 1 M HEPES, 1 M solution, 25 mM0 rNTP mix, 40 U / mL 1 μL RNase inhibitor, 10 mM p-aminobenzamide and enzyme-free water.

[0014] Specifically, the CRISPR reagent contains 19 μL of: 2 μL LwaCas13a (12.5 ng / μL), 1 μL of the crRNA (10 ng / μL), 1.25 μL of fluorescent reporter RNA (2 μM), 0.5 μL of T7 RNA polymerase (5 U / μL), 0.4 μL of HEPES buffer (1 M), 0.18 μL of MgCl2 solution (1 M), 0.8 μL of rNTP mix (25 mM ATP, GTP, UTP, CTP), 1 μL of RNase inhibitor (40 U / mL), 1 μL of p-aminobenzamidobenzamide (10 mM) and 10.87 μL of enzyme-free water.

[0015] One of the purposes of the present invention is to provide a detection kit for multiple respiratory pathogens in dogs, comprising 30 μL of the RPA amplification reagent and 19 μL of the CRISPR reagent.

[0016] One of the purposes of the present invention is to provide a method for detecting multiple respiratory pathogens in dogs, comprising: taking 1 μL and adding 30 μL of the RPA amplification reagent and 19 μL of the CRISPR reagent, mixing them thoroughly, adding the reaction system to a fluorescent quantitative PCR tube, and testing on a machine.

[0017] One of the purposes of the present invention is to provide the use of the primer, the crRNA, the RPA amplification reagent or the CRISPR reagent in the preparation of a kit for detecting multiple respiratory pathogens in dogs.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The primers for detecting multiple respiratory pathogens of dogs provided by the present invention amplify the special sequence (SEQ ID NO: 1) of UL54 gene, and the amplification has strong specificity and high sensitivity, and can be used for detecting nucleic acids of multiple respiratory pathogens of dogs.

[0020] The crRNA for guiding the targeted cleavage of the nuclease Cas13a provided by the present invention has strong targeting (targeting the SEQ ID NO: 1 region), and can effectively guide the nuclease Cas13a to perform targeted cleavage and then be amplified to produce a strong fluorescent signal. Moreover, it has stronger targeting and specificity than the crRNA targeting the SEQ ID NO: 7 region.

[0021] The RPA reagent and CRISPR reagent provided by the present invention can be prepared into freeze-dried products, which are easy to transport and can be transported at room temperature and stored at low temperature. The freeze-dried products include primers for detecting multiple canine respiratory pathogens, which can be used for the detection of nucleic acids of multiple canine respiratory pathogens after reconstitution and are easy to use.

[0022] The kit for detecting multiple respiratory pathogens in dogs provided by the present invention can directly and effectively amplify clinical samples using RPA amplification reagents, and the amplification products are targetedly cut by CRISPR reagents to generate fluorescent signals, and multiple respiratory pathogens in dogs are qualitatively or quantitatively detected according to the fluorescent signals. The kit is easy to use and operate, and the test personnel only need to add samples to perform the test, which reduces the errors and deviations caused by the liquid preparation process, and does not require professional technicians.

[0023] The detection kit and detection method provided by the present invention have high sensitivity and can detect a minimum of 1×10 -9 ng / μL of nucleic acid samples of multiple canine respiratory pathogens.

[0024] The detection kit and the detection method provided by the present invention have strong specificity, can effectively identify and detect multiple canine respiratory pathogens, have a high detection rate, can avoid and reduce the interference of adenovirus type 2 and canine parainfluenza virus, and have high detection specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The electrophoretic diagrams of double restriction enzyme digestion of pET-15b-UL54 (lane 1) and pET-15b-UL53 (lane 2) were shown.

[0026] Figure 2The fluorescence ratios of Ex / Em=485 / 520nm when CRISPR / Cas13a used crRNA1~3 to cut pET-15b-UL54 with different concentrations at 30 min, and the fluorescence ratios of Ex / Em=485 / 520nm when CRISPR / Cas13a used crRNA4~5 to cut pET-15b-UL53 with different concentrations at 30 min.

[0027] Figure 3 The CRISPR / Cas13a detection system with different LwaCas13a protein concentrations was 1×10 -7 ng / μL detection results of pET-15b-UL54.

[0028] Figure 4 CRISPR / Cas13a detection system and improved group for different crRNA concentrations 1×10 -7 ng / μL detection results of pET-15b-UL54.

[0029] Figure 5 These are the results of using RPA amplification reagents and CRISPR reagents to detect positive samples, negative samples, CAV-2 samples, and FPV-1 samples, respectively.

[0030] Figure 6 These are the results of using RPA amplification reagents and improved CRISPR reagents to detect positive samples, negative samples, CAV-2 samples, and FPV-1 samples, respectively.

[0031] Figure 7 These are the results of testing positive samples using RPA amplification reagent and CRISPR reagent (CRISPR-1) and using RPA amplification reagent and improved CRISPR reagent (CRISPR-2).

[0032] Figure 8 The intra-batch coefficient of variation of positive samples was tested using RPA amplification reagent and CRISPR reagent (CRISPR-1) and RPA amplification reagent and improved CRISPR reagent (CRISPR-2). DETAILED DESCRIPTION

[0033] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The reagents not described separately in detail in the present invention are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0034] Construction of prokaryotic expression vector

[0035] (1) PCR amplification to obtain the UL54 sequence

[0036] Phanta Super-Fidelity DNA polymerase was used to perform PCR amplification on the UL54 sequence of CHV-1 (SEQ ID NO: 1). The reaction system contained 25 μL 2× Phanta Max Buffer, 1 μL Phanta Super-Fidelity DNA Polymerase, 1 μL dNTPMix (10 mM), 1 μL template, 2 μL upstream primer (10 μM, GG CTCGAG TAATACGACTCACTATAGGGccagctaaacacgctccagg, SEQ ID NO: 2, underlined XOt I restriction site, bold is T7 promoter sequence), 2 μL downstream primer (10 μM, CC GGATCC ttactctggacggtcgtcga, SEQ ID NO: 3, underlined Bam HI restriction site) and the rest of ddH2O. The reaction program of Phanta Super-Fidelity DNA polymerase: 95℃ pre-denaturation for 30s, 95℃ denaturation for 15s, 56~72℃ annealing for 15s, 35 reaction cycles; 72℃ extension at 1kb / min, 72℃ full extension for 5min, 16℃ cooling for 10min.

[0037] (2) Double restriction enzyme digestion of UL54 sequence and pET-15b plasmid

[0038] The restriction endonucleases from ThermoFisher were used to perform double digestion on the UL54 sequence amplified in step (1) and the pET-15b plasmid (LM-1192, LMAI Bio). The digestion system contained 4 μL of 10× Green Buffer, 3 μg of the DNA fragment of the UL54 sequence or the pET-15b plasmid, and 13 μL of XOt I. 23 μL Bam HI and the balance ddH2O. The enzyme digestion reaction system was reacted in a 37°C water bath for 3 hours, and then gel running was performed for verification, and the bands that were verified to be correct were recovered by gel. After recovery, they were placed in a 4°C refrigerator for later use.

[0039] (3) Enzyme-linked ligation of UL54 sequence with pET-15b plasmid

[0040] ThermoFisher's T4 DNA ligase was used for enzyme chain reaction. The enzyme chain reaction system contained 1 μL 10×T4 DNA Buffer, 1 μL T4 DNA ligase, 100 ng double-digested pET-15b plasmid linearized fragment, 300 ng double-digested UL54 sequence and the remainder ddH2O in 10 μL. The reaction was carried out at 22°C for 3 h, and the enzyme-linked product was transformed. The DNA connection fragment of UL54 sequence and pET-15b plasmid was obtained by gel recovery.

[0041] (4) Conversion

[0042] Take out the competent cells of Escherichia coli DH5α (Cat. No. BTN12-11y, Biolabs) from the -80℃ freezer and place them on ice to melt for 30 minutes. Add the DNA connection fragments of the UL54 sequence and the pET-15b plasmid to the competent cells, flick to mix, and let stand on ice for 30 minutes. Heat shock at 42℃ for 90 seconds. Ice bath for 2 minutes. Add LB medium without resistance and shake at 37℃ for 1 hour. Spread on a plate with the corresponding resistance of the recombinant plasmid, and when the plate is blown dry, place it in a 37℃ incubator for overnight culture. Centrifuge the overnight cultured bacterial solution at 12000rpm for 1 minute, pour off the supernatant and invert it on a paper towel to fully remove the LB medium, collect the bacterial precipitate, break the bacteria, and extract the prokaryotic expression vector (pET-15b-UL54) of the UL54 sequence. Figure 1 As shown, after enzyme digestion electrophoresis detection and sequencing identification, it can be known that the prokaryotic expression vector of the UL54 sequence was successfully constructed.

[0043] 2. CRISPR / Cas13a protein cleavage activity of UL54 sequence

[0044] (1) Synthesizing crRNA

[0045] According to the UL54 sequence as shown in SEQ ID NO: 1, crRNA was designed in the region near its 3' end, and the crRNA with better cleavage activity was screened out as the detection crRNA.

[0046] Table 1 crRNA

[0047]

[0048] (2) Detection of protein activity

[0049] Preparation of CRISPR / Cas13a detection system:

[0050] 2 μL LwaCas13a (25 ng / μL, Z03486-1mg, GenScript), 1 μL crRNA (10 ng / μL, as shown in Table 1), 1.25 μL fluorescent reporter RNA (2 μM, 5′-FAM-UUUUU-BHQ-3′, produced by Sangon Biotechnology (Shanghai) Co., Ltd.), 0.5 μL T7 RNA polymerase (5 U / μL), 0.4 μL HEPES buffer (1 M), 0.18 μL MgCl2 solution (1 M), 0.8 μL rNTP mix (25 mM ATP, GTP, UTP, CTP), 1 μL RNase inhibitor (40 U / mL), and 11.87 μL nuclease-free water, with a total volume of 19 μL.

[0051] Sample: 1 μL of 1 × 10 -7 ng / μL, 1×10 -8 ng / μL and 1×10 -9 ng / μL of pET-15b-UL54 or pET-15b-UL53.

[0052] In addition, as a control, a prokaryotic expression vector (pET-15b-UL53) carrying the UL53 sequence (SEQ ID NO: 7) was also designed and synthesized according to the above method. The upstream primer involved was: GG CTCGAG TAATACGACTCACTATAGGGccgtttcaatcataa, underlined XOt I restriction site, bold is T7 promoter sequence, SEQ ID NO: 8. Downstream primers are: CC GGATCC gtcaagcatatatctggtgtg, the underscore is Bam HI restriction site, SEQ ID NO: 9. In addition, crRNA4 and crRNA5 were designed for the UL53 sequence (as shown in Table 1).

[0053] Detection: The above CRISPR / Cas13a detection system is used as a detection system for one reaction, and the corresponding detection system is configured according to the number of tests. The configured detection system is transferred to a 96-well ELISA plate, and 1 μL of the prokaryotic expression vector of the UL54 sequence is added to each reaction system. Incubate at 37°C, and use a multifunctional microplate reader to collect the fluorescence intensity. Every 3 minutes, the fluorescence signal of each reaction well is collected under the conditions of Ex / Em=485 / 520nm (Gain=650), and the detection time is 30 minutes. Using this reaction system, the shearing activity and detection limit of the CRISPR / Cas13a detection system are evaluated respectively.

[0054] (3) Detection limit evaluation

[0055] The prokaryotic expression vectors of these UL54 sequences were added to the above-mentioned CRISPR / Cas13a detection system respectively. Each group of experiments was repeated three times. At the same time, a negative control group with water as the template was set up to compare the fluorescence ratio at 30 min of detection. The ones with statistical differences compared with the negative control were positive (P<0.05), and those with no statistical differences were negative (P>0.05). The lowest concentration at which the fluorescence ratio was statistically different from the negative control was the detection limit of this method.

[0056] Figure 2 The fluorescence ratios of Ex / Em=485 / 520nm at 30 min when CRISPR / Cas13a used crRNA1~3 to cut different concentrations of pET-15b-UL54, and the fluorescence ratios of Ex / Em=485 / 520nm at 30 min when CRISPR / Cas13a used crRNA4~5 to cut different concentrations of pET-15b-UL53. In the figure, "*" indicates that there is a significant difference (p<0.05 or p<0.01) relative to both crRNA4 and crRNA5 at the same concentration, and "*" indicates that there is a significant difference (p<0.05 or p<0.01) relative to both crRNA1 and crRNA3 at the same concentration. Figure 1 It can be seen that crRNA4 and crRNA5 cannot guide CRISPR / Cas13a to 1×10 -9 ng / μL concentration of pET-15b-UL53 for efficient cleavage, while crRNA1, crRNA2, and crRNA3 were able to guide CRISPR / Cas13a 1×10 -9 ng / μL concentration of pET-15b-UL54 was cut, and the fluorescence ratio was detected at 30 min. This shows that the present invention uses UL54 as the target sequence and crRNA1, crRNA2 and crRNA3 as guide RNAs to guide CRISPR / Cas13a to cut the target sequence at a lower concentration, indicating that the target sequence and crRNA of the present invention have lower detection sensitivity.

[0057] in addition, Figure 2 It was also shown that crRNA4 and crRNA5 can guide CRISPR / Cas13a to 1×10 -7 ng / μL, 1×10 -8ng / μL concentration of pET-15b-UL53 was used for cutting, but its fluorescence ratio at 30 min was low, and the detection effect was not as good as that of using UL54 as the target sequence and crRNA1, crRNA2 and crRNA3 as guide RNA. In addition, using UL54 as the target sequence and crRNA2 as the guide RNA had greater CRISPR / Cas13a detection activity, which was more conducive to actual CHV-1 Detection.

[0058] 3. Determination of CRISPR / Cas13a detection system

[0059] According to the crRNA obtained above, combined with Cas protein, Cas enzyme and reporter RNA, a CRISPR detection reaction system is constructed in sequence to achieve targeted cutting. In order to obtain the best detection effect, the embodiment optimizes the concentration of Cas protein and crRNA in the CRISPR detection reaction system, and evaluates the specificity and sensitivity of the CRISPR detection reaction system.

[0060] (1) Determination of the optimal LwaCas13a protein concentration

[0061] The purified LwaCas13a protein (25 ng / μL) was sequentially diluted by 2-fold gradient (12.5 ng / μL, 6.25 ng / μL, 3.1 ng / μL, 1.6 ng / μL and 0.8 ng / μL) for a total of 6 concentration gradients to prepare the detection system: 2 μL LwaCas13a, 1 μL crRNA1 (10 ng / μL, as shown in Table 1), 1.25 μL fluorescent reporter RNA (2 μM), 0.5 μL T7 RNA polymerase (5 U / μL), 0.4 μL HEPES buffer (1 M), 0.18 μL MgCl2 solution (1 M), 0.8 μL rNTP mix (25 mM ATP, GTP, UTP, CTP), 1 μL RNase inhibitor (40 U / mL) and 11.87 μL enzyme-free water, with a total volume of 19 μL.

[0062] Sample: 1 μL of 1×10 -7 ng / μL of pET-15b-UL54.

[0063] After thorough mixing, add the reaction system into the fluorescent quantitative PCR tube and test on the machine. The test conditions are the same as above.

[0064] The results are as follows Figure 3As shown: when the concentration of LwaCas13a protein is 12.5 ng / μL, the fluorescence intensity has no significant decrease compared with the high concentration LwaCas13a protein but is higher than the low concentration LwaCas13a protein.

[0065] (2) Determination of optimal crRNA concentration

[0066] The crRNA2 was diluted in a 2-fold gradient (20 ng / μL, 10 ng / μL, 5 ng / μL, 2.5 ng / μL, 1.25 ng / μL), for a total of 5 concentration gradients.

[0067] Prepare the detection system: 2 μL LwaCas13a (7.9 ng / μL), 1 μL crRNA1, 1.25 μL fluorescent reporter RNA (2 μM), 0.5 μL T7 RNA polymerase (5 U / μL), 0.4 μL HEPES buffer (1 M), 0.18 μL MgCl2 solution (1 M), 0.8 μL rNTP mix (25 mM ATP, GTP, UTP, CTP), 1 μL RNase inhibitor (40 U / mL) and 11.87 μL enzyme-free water, with a total volume of 19 μL.

[0068] Sample: 1 μL of 1×10 -7 ng / μL of pET-15b-UL54.

[0069] After thorough mixing, add the reaction system into the fluorescent quantitative PCR tube and test on the machine. The test conditions are the same as above.

[0070] The results are as follows Figure 4 As shown: when the crRNA2 concentration is 10 ng / μL, the fluorescence intensity has no obvious decrease but is higher than other concentrations.

[0071] additive

[0072] Based on the above optimization results, the experimental group obtained the CRISPR detection reaction system as follows:

[0073] 2 μL LwaCas13a (12.5 ng / μL), 1 μL crRNA2 (10 ng / μL), 1.25 μL fluorescent reporter RNA (2 μM), 0.5 μL T7 RNA polymerase (5 U / μL), 0.4 μL HEPES buffer (1 M), 0.18 μL MgCl2 solution (1 M), 0.8 μL rNTP mix (25 mM ATP, GTP, UTP, CTP), 1 μL RNase inhibitor (40 U / mL) and 11.87 μL enzyme-free water, the total volume is 19 μL.

[0074] As the improved group, the obtained CRISPR detection reaction system was: 2 μL LwaCas13a (12.5 ng / μL), 1 μL crRNA2 (10 ng / μL), 1.25 μL fluorescent reporter RNA (2 μM), 0.5 μL T7 RNA polymerase (5 U / μL), 0.4 μL HEPES buffer (1 M), 0.18 μL MgCl2 solution (1 M), 0.8 μL rNTP mix (25 mM ATP, GTP, UTP, CTP), 1 μL RNase inhibitor (40 U / mL), 1 μL p-aminobenzamide (10 mM) and 10.87 μL enzyme-free water, with a total volume of 19 μL.

[0075] After thorough mixing, add the reaction system into the fluorescent quantitative PCR tube and test on the machine. The test conditions are the same as above.

[0076] The results are as follows Figure 4 As shown, the fluorescence intensity of the improved group was relatively higher than that of the experimental group.

[0077] 4. Testing of clinical blood samples

[0078] (1) Samples and sample processing

[0079] Five canine throat swab CHV-1 positive samples and five canine throat swab CHV-1 negative samples were collected. Adenovirus type 2 (abbreviated as ‌CAV-2, catalog number V0011, Biowit). Feline herpesvirus ( Felid herpesvirus 1 , Referred to as FPV-1, VR-636™, ATCC). The lyophilized samples or strains were added with tris(2-carboxyethyl)phosphine (TCEP) and ethylenediaminetetraacetic acid (EDTA) in a biosafety environment to make the final concentrations of 100 mmol / L and 1 mmol / L, respectively, and heated at 95°C for 10 min to inactivate the ribonuclease in the samples, and then directly used as templates for RPA amplification.

[0080] (2) RPA amplification reagent

[0081] Recombinase polymerase amplification (RPA) can shorten the detection time to 15-30 minutes and is known as a nucleic acid detection technology that can replace PCR. RPA is used as an amplification system to achieve large-scale amplification of CHV-1 virus target sequences in dog throat swabs.

[0082] The RPA amplification reagent contained 75 mM Tris, 50 mM potassium acetate, 25 mM magnesium acetate, 25 mM β-mercaptoethanol, 3.5% polyethylene glycol-2000, 2 mM ATP, 20 mM polyphosphate, 50 ng / μL polyphosphate kinase, 250 nM upstream primer, 250 nM downstream primer, 300 ng / μL TthRecA protein, 600 ng / μL TthSSB protein and 0.26 U / μL Bst3.0 DNA polymerase in 30 μL.

[0083] Among them, primers were designed for the UL54 sequence as the target sequence. RPA-F1: TAATACGACTCACTATAGGG ccagctaaacacgctccagg, SEQ ID NO.12, the underline is the T7 promoter sequence. RPA-R1: ttactctggacggtcgtcga, SEQ ID NO.13.

[0084] Primers were designed with UL53 sequence as the target sequence. RPA-F2: TAATACGACTCACTATAGGG ccgtttcaatcataa, SEQ ID NO.14, the underline is the T7 promoter sequence. RPA-R2: gtcaagcatatatctggtgtg, SEQ ID NO.15.

[0085] (3) CRISPR reagents

[0086] The large amount of target sequences obtained by RPA amplification are then cut using CRISPR reagents to generate fluorescent signals. By detecting the fluorescent signals, the CHV-1 virus in the sample to be tested can be effectively detected. Among them, the RPA reagent and the CRISPR reagent can be added separately or simultaneously.

[0087] CRISPR reagents: 2 μL LwaCas13a (12.5 ng / μL), 1 μL crRNA2 (10 ng / μL), 1.25 μL fluorescent reporter RNA (2 μM), 0.5 μL T7 RNA polymerase (5 U / μL), 0.4 μL HEPES buffer (1 M), 0.18 μL MgCl2 solution (1 M), 0.8 μL rNTP mix (25 mM ATP, GTP, UTP, CTP), 1 μL RNase inhibitor (40 U / mL) and 11.87 μL enzyme-free water. or 2 μL LwaCas13a (12.5 ng / μL), 1 μL crRNA2 (10 ng / μL), 1.25 μL fluorescent reporter RNA (2 μM), 0.5 μL T7 RNA polymerase (5 U / μL), 0.4 μL HEPES buffer (1 M), 0.18 μL MgCl2 solution (1 M), 0.8 μL rNTP mix (25 mM ATP, GTP, UTP, CTP), 1 μL RNase inhibitor (40 U / mL), 1 μL p-aminobenzamide (10 mM), and 10.87 μL enzyme-free water (improved group).

[0088] (4) Specificity test

[0089] Use 5 processed canine throat swab CHV-1 positive samples, 5 canine throat swab CHV-1 negative samples, CAV-2 samples and FPV-1 samples, take 1μL of each and add 30μL of RPA amplification reagent and 19μL of CRISPR reagent. After fully mixing, add the reaction system to the fluorescent quantitative PCR tube and test on the machine. The detection conditions are the same as above. Among them, when RPA-F1 and RPA-R1 are used as primer pairs in the RPA reagent, crRNA1~3 are used for detection in the CRISPR reagent. When RPA-F2 and RPA-R2 are used as primer pairs in the RPA reagent, crRNA4~5 are used for detection in the CRISPR reagent. 5 canine throat swabs CHV-1 The positive samples were tested and the average value of the fluorescence ratio of Ex / Em=485 / 520nm was taken. The 5 negative samples of CHV-1 from dog throat swabs were tested and the average value of the fluorescence ratio of Ex / Em=485 / 520nm was taken. The CAV-2 samples and FPV-1 samples were tested 5 times each and the average value of the fluorescence ratio of Ex / Em=485 / 520nm was taken.

[0090] Figure 5The results of using RPA amplification reagent and CRISPR reagent to detect positive samples, negative samples, CAV-2 samples and FPV-1 samples are shown. In the figure, "*" indicates that there is a significant difference (p<0.05 or p<0.01) relative to both crRNA4 and crRNA5.

[0091] like Figure 5 As shown, the results of the detection using the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent containing crRNA1~3 (crRNA1~3 groups in the figure) at 30min Ex / Em=485 / 520nm average fluorescence ratio are significantly higher than the results of the detection using the RPA amplification reagent containing RPA-F2 and RPA-R2 and the CRISPR reagent containing crRNA4~5 (crRNA4~5 groups in the figure) at 30min Ex / Em=485 / 520nm average fluorescence ratio for positive samples, indicating that the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent containing crRNA1~3 provided by the present invention are effective for canine throat swabs. CHV-1 Positive samples have a higher detection effect.

[0092] like Figure 5 As shown in the figure, the results of the detection using RPA amplification reagents containing RPA-F1 and RPA-R1 and CRISPR reagents containing crRNA1~3 (crRNA1~3 groups in the figure) show that except for a small amount of fluorescence ratio in crRNA1 group, crRNA2 group and crRNA3 group are both positive for canine throat swabs. CHV-1 There is no obvious fluorescence ratio detected in the positive sample. This shows that the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent containing crRNA2~3 provided by the present invention can be used to determine whether the sample contains the virus based on the detected 30min Ex / Em=485 / 520nm fluorescence ratio. CHV-1 Virus, to qualitatively characterize the sample, or when the 30min Ex / Em=485 / 520nm fluorescence ratio is lower than the fluorescence ratio of crRNA1 (111, for example 100), it is determined to be a negative sample.

[0093] like Figure 5As shown, the results of the detection using the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent containing crRNA1~3 (crRNA1~3 groups in the figure) for CAV-2 samples and FPV-1 samples, there is no 30min Ex / Em=485 / 520nm fluorescence ratio. However, the results of the detection using the RPA amplification reagent containing RPA-F2 and RPA-R2 and the CRISPR reagent containing crRNA4~5 (crRNA4~5 groups in the figure) for CAV-2 samples and FPV-1 samples, both have a significant 30minEx / Em=485 / 520nm fluorescence ratio. This shows that the detection using the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent containing crRNA1~3 provided by the present invention CHV-1 virus, with high specificity, and no detection reaction was detected for CAV-2 samples and FPV-1 samples.

[0094] Figure 6 The results of using RPA amplification reagent and improved CRISPR reagent to detect positive samples, negative samples, CAV-2 samples and FPV-1 samples are shown. In the figure, "*" indicates that there is a significant difference (p<0.05 or p<0.01) relative to crRNA4 and crRNA5.

[0095] like Figure 6 As shown, the results of the detection using the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent containing the improved group of crRNA1~3 (crRNA1~3 groups in the figure) at 30min Ex / Em=485 / 520nm average fluorescence ratio are significantly higher than the results of the detection using the RPA amplification reagent containing RPA-F2 and RPA-R2 and the CRISPR reagent containing the improved group of crRNA4~5 (crRNA4~5 groups in the figure) at 30min Ex / Em=485 / 520nm average fluorescence ratio for positive samples, indicating that the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent containing the improved group of crRNA1~3 provided by the present invention are effective for canine throat swabs CHV-1 Positive samples have a higher detection effect.

[0096] like Figure 6As shown, the results of the detection using the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent containing the improved group of crRNA1~3 (crRNA1~3 groups in the figure), crRNA1 group, crRNA2 group and crRNA3 group all had no obvious detection of fluorescence ratio for the CHV-1 positive samples of canine throat swabs. This shows that the use of the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent containing the improved group of crRNA1~3 provided by the present invention can determine whether the sample contains the virus based on the detected 30min Ex / Em=485 / 520nm fluorescence ratio. CHV-1 Viruses can be detected to identify the samples. However, the results of the RPA amplification reagents containing RPA-F2 and RPA-R2 and the CRISPR reagents containing the improved group of crRNA4~5 (crRNA4~5 group in the figure) for negative samples all have a significant average value of the 30min Ex / Em=485 / 520nm fluorescence ratio, which makes it difficult to identify the samples and indicates that this reagent may produce non-specific target sequences or non-specific cuts during amplification and cutting of the target sequence.

[0097] like Figure 6 As shown, the results of the detection using the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent of the improved group containing crRNA1~3 (crRNA1~3 groups in the figure) for CAV-2 samples and FPV-1 samples, there is no 30minEx / Em=485 / 520nm fluorescence ratio. However, the results of the detection using the RPA amplification reagent containing RPA-F2 and RPA-R2 and the CRISPR reagent of the improved group containing crRNA4~5 (crRNA4~5 groups in the figure) for CAV-2 samples and FPV-1 samples, both have a significant 30min Ex / Em=485 / 520nm fluorescence ratio. This shows that the detection using the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent of the improved group containing crRNA1~3 provided by the present invention CHV-1 virus, with high specificity, and no detection reaction was detected for CAV-2 samples and FPV-1 samples.

[0098] Relative to Figure 5 As a result, Figure 6The CRISPR reagents of the improved group are used for detection. After comparison, it was found that the CRISPR reagents of the improved group can improve the 30min Ex / Em=485 / 520nm fluorescence ratio of positive samples, and reduce the 30min Ex / Em=485 / 520nm fluorescence ratio of negative samples, CAV-2 samples and FPV-1 samples. This shows that the CRISPR reagents of the improved group can improve the detection rate of the detection, reduce nonspecific amplification or nonspecific cutting, and improve the detection specificity.

[0099] (5) Sensitivity test

[0100] Five processed positive canine throat swab samples were diluted 100 times, and 1 μL of each sample was added to 30 μL of RPA amplification reagent and 19 μL of CRISPR reagent. After thorough mixing, the reaction system was added to the fluorescent quantitative PCR tube and tested on the machine. The detection conditions were the same as above. Among them, when RPA-F1 and RPA-R1 were used as primer pairs in the RPA reagent, crRNA1~3 were used for detection in the CRISPR reagent. When RPA-F2 and RPA-R2 were used as primer pairs in the RPA reagent, crRNA4~5 were used for detection in the CRISPR reagent.

[0101] Figure 7 The results of detecting positive samples using RPA amplification reagent and CRISPR reagent (CRISPR-1) and using RPA amplification reagent and improved group CRISPR reagent (CRISPR-2) are shown. In the figure, "*" indicates that there is a significant difference (p<0.05) when using RPA amplification reagents containing different crRNA1~5 relative to CRISPR-1 and CRISPR-2.

[0102] like Figure 7 As shown, the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent containing crRNA1~3 (CRISPR-1), and the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent containing the improved group of crRNA1~3 (CRISPR-2) all have higher 30min Ex / Em=485 / 520nm fluorescence ratios, and the detection fluorescence ratios are all detected for 5 canine throat swab positive samples diluted 100 times, and the detection rate is very high. Once again, it shows that the RPA amplification reagent containing RPA-F1 and RPA-R1 and the CRISPR reagent containing crRNA1~3 can effectively detect CHV-1 Viruses, with very high detection sensitivity.

[0103] like Figure 7As shown, the fluorescence ratio of the CRISPR-2 group is significantly higher than that of CRISPR-1. This shows that the CRISPR reagent in the improved group can improve the detection rate, reduce nonspecific amplification or nonspecific cutting, and improve the detection sensitivity. However, the RPA amplification reagent containing RPA-F2 and RPA-R2 and the CRISPR reagent containing crRNA5 or the CRISPR reagent in the improved group have no 30min Ex / Em=485 / 520nm fluorescence ratio. The 30min Ex / Em=485 / 520nm fluorescence ratio of the RPA amplification reagent containing RPA-F2 and RPA-R2 and the CRISPR reagent containing crRNA5 or the CRISPR reagent in the improved group is low, which again shows that the detection sensitivity of the combination of RPA-F2, RPA-R2 and crRNA4~5 is low.

[0104] 5. Stability test of the kit

[0105] The RPA reagent and CRISPR reagent provided in the above embodiment can be prepared into a lyophilized product, which is convenient for transportation and can be transported at room temperature and stored at low temperature. The lyophilized products were taken out at different times of 30 days, 60 days and 90 days, respectively, and balanced at room temperature for 40 minutes. Five canine throat swab CHV-1 positive samples were tested according to the above steps to analyze their inter-batch stability.

[0106] The above-mentioned RPA reagent containing crRNA1 and the CRISPR reagent kit were statistically analyzed to detect these four samples, and each sample was detected 5 times. The average value of the fluorescence ratio of Ex / Em=485 / 520nm for 30min of each sample was calculated, and its coefficient of variation was calculated, and the average coefficient of variation at the same time point (same batch) was calculated. In addition, the above-mentioned RPA reagent containing crRNA1 and the improved group of CRISPR reagent kits were used to detect these four samples, and each sample was detected 5 times. The average value of the fluorescence ratio of Ex / Em=485 / 520nm for 30min of each sample was calculated, and its coefficient of variation was calculated, and the average coefficient of variation at the same time point (same batch) was calculated.

[0107] Figure 8 The intra-assay coefficient of variation of positive samples detected by using RPA amplification reagent and CRISPR reagent (CRISPR-1) and RPA amplification reagent and improved CRISPR reagent (CRISPR-2) are shown. In the figure, "*" indicates that the corresponding time point has a significant difference (p<0.05).

[0108] The results are as follows Figure 8As shown in the figure, the intra-batch coefficient of variation of the three batches of the improved CRISPR reagent (CRISPR-2) at 60 days and 90 days were significantly lower than that of CRISPR-1. This shows that the stability of the improved CRISPR reagent is stronger.

[0109] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. Application of primers, crRNA, nucleic acid compositions, RPA amplification reagents and CRISPR reagents in the preparation of a kit for detecting canine herpesvirus type 1; The primer pair is shown in SEQ ID NO: 12 and 13, and the primer pair is used to amplify the nucleotide sequence shown in SEQ ID NO: 1; The nucleotide sequence of the crRNA is as shown in any one of SEQ ID NOs: 4 to 6, and the crRNA is used to guide the nuclease Cas13a to target the nucleotide sequence shown in SEQ ID NO: 1; The nucleic acid composition comprises the primer pair and the crRNA; The RPA amplification reagent comprises: 75 mM Tris, 50 mM potassium acetate, 25 mM magnesium acetate, 25 mM β-mercaptoethanol, 3.5% polyethylene glycol-2000, 2 mM ATP, 20 mM polyphosphate, 50 ng / μL polyphosphate kinase, 250 nM upstream primer of SEQ ID NO: 12, 250 nM downstream primer of SEQ ID NO: 13, 300 ng / μL TthRecA protein, 600 ng / μL TthSSB protein and 0.26 U / μL Bst3.0 DNA polymerase; The CRISPR reagent contains 12.5 ng / μL LwaCas13a, 10 ng / μL crRNA, 2 μM fluorescent reporter RNA, 5 U / μL T7 RNA polymerase, 1 M HEPES, 1 M solution, 25 mM0 rNTP mix, 40 U / mL 1 μL RNase inhibitor and enzyme-free water.

2. According to the use according to claim 1, the CRISPR reagent contains 19 μL: 2 μL 12.5 ng / μL of LwaCas13a, 1 μL 10 ng / μL of the crRNA, 1.25 μL 2 μM fluorescent reporter RNA, 0.5 μL 5 U / μL T7 RNA polymerase, 0.4 μL 1 M HEPES buffer, 0.18 μL 1 M MgCl2 solution, 0.8 μL containing 25 mM ATP, 25 mM GTP, 25 mM UTP and 25 mM CTP rNTP mix, 1 μL 40 U / mL RNase inhibitor and 11.87 μL enzyme-free water.

3. According to the use according to claim 1, the CRISPR reagent contains 19 μL: 2 μL 12.5 ng / μL LwaCas13a, 1 μL 10 ng / μL crRNA, 1.25 μL 2 μM fluorescent reporter RNA, 0.5 μL 5 U / μL T7 RNA polymerase, 0.4 μL 1 M HEPES buffer, 0.18 μL 1 M MgCl2 solution, 0.8 μL rNTP mix containing 25 mM ATP, 25 mM GTP, 25 mM UTP and 25 mM CTP, 1 μL 40 U / mL RNase inhibitor, 1 μL 10 mM p-aminobenzamide and 10.87 μL enzyme-free water.

4. According to the use of claim 1, the detection kit comprises 30 μL of the RPA amplification reagent and 19 μL of the CRISPR reagent.

Images