Construction method of an animal model selectively lacking tissue-resident nk cells and application thereof

Abstract

The application provides a construction method of an animal model selectively lacking tissue-resident NK cells and application thereof. The Gpx4 fl / fl CD122 Cre The mouse selectively lacks liver, uterus and kidney-resident NK cells, without affecting the homeostasis of cNK cells in these tissues and NK cells in peripheral lymphatic organs. This provides a practical experimental animal model for studying the functions of liver, uterus and kidney-resident NK cells, and provides an ideal experimental tool for the development of NK biology and even tissue immunology.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of experimental animals, in particular to a method for constructing an animal model selectively lacking tissue-resident NK cells and application thereof. BACKGROUND

[0002] In mice, NK cells are commonly phenotypically identified by expression of surface markers such as NK1.1, NKp46 or CD49b (DX5), or in humans, CD56 and CD16 (FcyRIII), in addition to lack of lineage markers CD3 and CD19. Early studies found that NK cells exhibit heterogeneous expression of various cell surface molecules, and NK cells from different tissues show unique phenotypic characteristics. However, most previous studies were performed using mouse spleen or human peripheral blood NK cells, which are now referred to as cNK cells. Until recently, trNK cells, which are distinct from cNK cells, in various tissues have received close attention. trNK cells were first identified in mouse liver, and then rapidly expanded to various other tissues such as skin, uterus, salivary gland, fat and kidney. The heterogeneity between trNK cells and cNK cells in these different tissues is in urgent need of exploration.

[0003] In the resting state, a large amount of evidence indicates that liver NK cells are composed of two completely different subpopulations, including liver cNK cells and liver-resident NK (LrNK) cells, which are also commonly referred to as liver ILC1 cells. Liver cNK cells are generally defined as NK1.1 + NKp46 + CD49a - CD49b + cells, while LrNK / ILC1 cells are generally defined as NK1.1 + NKp46 + CD49a + CD49b - cells. Liver cNK cells and LrNK / ILC1 cells show significant differences in phenotype, gene expression profile and developmental pathway. In addition, liver cNK cells and LrNK / ILC1 cells also play different roles in liver metastasis, chronic persistent liver viral infection and contact hypersensitivity. The functional and phenotypic differences between liver cNK cells and LrNK / ILC1 cells under these physiological and pathological conditions have attracted great interest of many scholars. Similar to the liver, the uterus NK cells of non-pregnant mice also contain CD49a + and CD49a -Subsets. Unlike the spleen, the uterine NK cell population is more diverse. Based on the expression of CD49a and Eomes, uterine NK cells can be divided into three groups, which are: CD49a + Eomes - ILC1 cells, CD49a + Eomes + trNK cells, and CD49a - Eomes + cNK cells. Notably, both ILC1 cells and trNK cells are resident NK cells in the uterus, while cNK cells arrive at the uterus via blood circulation. Uterine NK cells are the major leukocytes in the decidual tissue of early human and mouse, and make significant contributions to the basic physiological processes of pregnancy. Studies have shown that IFN-γ secreted by uterine NK cells plays an important role in the remodeling of spiral arteries during pregnancy. In addition, uterine NK cells can also inhibit inflammatory Th17 cells by producing IFN-γ, and induce the production of Treg cells by interacting with CD14 + cells, thereby maintaining immune tolerance at the maternal-fetal interface and preventing the mother from rejecting the fetus. More importantly, uterine NK cells can produce angiogenic factors such as vascular endothelial growth factor (VEGF) and placental growth factor (PLGF), which are also important for normal pregnancy. Although the importance of uterine NK cells during pregnancy is currently known, the role of different subsets of uterine NK cells still needs further study. In the mouse kidney, CD49a + CD49b-NK cells, although only a small part (15-20%), are easily detected, representing the kidney-resident NK cell population, while the larger proportion of CD49a - CD49b + NK cells are considered to be cNK cells. In T-bet-deficient mice, the number of kidney-resident NK cells is reduced by about 50% compared to wild-type mice, indicating that kidney-resident NK cells contain T-bet-dependent and independent populations. More interestingly, the deletion of E4BP4 leads to the expansion of the proportion and number of kidney trNK cells, while the effect on cNK cells is the opposite. Deeply exploring the phenotypic and functional differences of different subsets of kidney NK cells may provide reliable data references for the progress and development of kidney immunology and pathology. Therefore, finding more suitable experimental animal models that selectively delete tissue cNK cells or trNK cells has also become a prerequisite for studying the phenotype and function of different tissue cNK cells or trNK cells.

[0004] The current experimental animal models for studying tissue NK cells are as follows:

[0005] 1、Tbx21 - / - Mice. This experimental animal model not only disrupts the homeostasis of liver cNK cells, but also completely loses LrNK / ILC1 cells to a greater extent. In addition, T-bet - / - Uterine trNK cells and kidney trNK cells are still retained in Tbx21 mice.

[0006] 2、Nfil3 - / - Mice. This experimental animal model only disrupts the homeostasis of liver cNK cells in the liver, without affecting the homeostasis of LrNK / ILC1 cells. However, the deletion of E4BP4 leads to an increase in the number of kidney trNK cells and a decrease in the number of cNK cells in the kidney.

[0007] 3、Eomes - / - Mice. This animal model does not affect the homeostasis of LrNK / ILC1 cells, but some liver cNK cells are still present in the liver. In addition, the deletion of Eomes leads to a decrease in both uterine cNK cells and trNK cells.

[0008] 4、γc - / - Mice. This animal model is not specific and affects the homeostasis of all NK cells in the body, which is a tool mouse for NK cell deletion.

[0009] 5、Rag1 - / - Tbx21 - / - Mice. This animal model is a good recipient mouse, and the mice lack T, B, and LrNK / ILC1 cells in the body, but the mice also lack many liver cNK cells. In addition, the mice retain uterine trNK cells and kidney trNK cells.

[0010] 6、Rorα fl / fl Ncr1 Cre Mice. This animal model specifically disrupts the homeostasis of LrNK / ILC1 cells without affecting the homeostasis of liver cNK cells, but the mice still have many LrNK / ILC1 cells in the liver. In addition, the effect of Rorα deletion on uterine and kidney NK cells is still unclear.

[0011] 7、Zfp683 fl / fl Ncr1 Cre Mice. This animal model specifically disrupts the homeostasis of LrNK / ILC1 cells without affecting the homeostasis of liver cNK cells, but the effect of Hobit deletion on uterine and kidney NK cells is still unclear.

[0012] Therefore, constructing and utilizing a more suitable experimental animal model of selectively lacking tissue-resident NK cells has important significance for revealing the biological functions and phenotype changes of different tissue trNK cells under normal physiological conditions or even pathological conditions. At the same time, it can provide a practical experimental tool for the development of histopathology and histology. SUMMARY

[0013] The present application aims to overcome the shortcomings and deficiencies of the prior art, and provide a method for constructing an animal model of selectively lacking tissue-resident NK cells.

[0014] Another object of the present application is to provide the use of the above method.

[0015] The object of the present application is achieved by the following technical solutions:

[0016] A method for constructing an animal model of selectively lacking tissue-resident NK cells, comprising the following steps:

[0017] Gpx4 fl / fl mice and CD122 Cre mice, to obtain Gpx4 fl / fl CD122 Cre mice and Gpx4 fl / + CD122 Cre mice, and then screening mice with genotypes of Gpx4 fl / fl CD122 Cre , which are the animal models of selectively lacking tissue-resident NK cells.

[0018] The animal model of selectively lacking tissue-resident NK cells is an animal model specifically lacking liver LrNK / ILC1 cells, uterine ILC1 cells, uterine trNK cells and kidney trNK cells.

[0019] The animal model of selectively lacking tissue-resident NK cells has an unaffected steady state of liver cNK cells, other immune cells in the liver, uterine cNK cells, kidney cNK cells, spleen and bone marrow NK cells.

[0020] The screening is performed using PCR.

[0021] The primers used in the PCR are:

[0022] Gpx4-flox-F: AAAGTCCTAGGAAACGCCCG;

[0023] Gpx4-flox-R: GGCACTAGGTGGAGGAGTCT;

[0024] CD122-Cre-1: CAGAGCAGCTTTGACAACCCAAACG;

[0025] CD122-Cre-2: TGCTTCACAGAAAAACCCACCCCAG;

[0026] CD122-Cre-3: CATACAATGGGGTACCTTCTGGGC.

[0027] The mouse is a C57BL / 6J mouse.

[0028] The application of the animal model selectively lacking tissue-resident NK cells in histopathology and histology research.

[0029] The application has the following advantages and effects relative to the prior art:

[0030] The application aims to provide an experimental animal model selectively lacking tissue-resident NK cells, which is different from the previous animal model in that the animal model only specifically lacks liver LrNK / ILC1 cells, uterine ILC1 cells and trNK cells (all of which are uterine-resident NK cells), kidney trNK cells, without affecting the homeostasis of liver cNK cells, other immune cells in the liver, uterine cNK cells, kidney cNK cells, spleen and bone marrow NK cells. Therefore, the application provides an ideal model for studying the biological functions of liver LrNK / ILC1 cells, uterine ILC1 cells and trNK cells and kidney trNK cells. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 Gpx4 fl / fl CD122 Cre Mouse and Gpx4 fl / + CD122 Cre Construction strategy of the mouse and knockout efficiency result graph.

[0032] Figure 2 Gpx4 fl / fl CD122 Cre Mouse and Gpx4 fl / + CD122 Cre Proportion and number of liver NK cells (A, B), liver cNK cells, LrNK / ILC1 cells (C, D) of the mouse result graph.

[0033] Figure 3 Gpx4 fl / fl CD122 Cre Mouse and Gpx4 fl / + CD122 CreProportion and number of mouse uterine cNK cells, trNK cells and ILC1 cells (A, B), proportion and number of kidney cNK cells and trNK cells (C, D) results chart.

[0034] Figure 4 Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre Proportion and number of mouse liver neutrophils (A, B), monocytes (C, D), dendritic cells (E, F), macrophages (G, H) results chart.

[0035] Figure 5 Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre Proportion and number of CD3 + T cells (A, B), CD4 + T cells, CD8 + T cells (C, D), regulatory T (Treg) cells (E, F) and natural killer T (NKT) cells (G, H) results chart.

[0036] Figure 6 Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre NK cell development in mouse spleen and bone marrow results chart; wherein A, B are the proportion and number of NK cells, C, D are the distribution of NK cell subgroups. DETAILED DESCRIPTION

[0037] The application will be further described in conjunction with the examples and drawings, but the embodiments of the application are not limited thereto.

[0038] In the following examples, if no specific experimental conditions are specified, the general experimental conditions or the experimental conditions recommended by the reagent companies are usually used. If no specific description is given, the materials and reagents used are reagents and materials obtained from commercial channels.

[0039] Example 1 Construction of an animal model selectively lacking tissue-resident NK cells

[0040] 1. Experimental animals

[0041] CD122 CreMice were constructed in our lab based on C57BL / 6J according to the published method (Ref: He J, Wang Y, Liu T, Liu G, Chen S, Li Q, et al. Stage-specific requirement of kinase PDK1 for NK cells development and activation. Cell Death Differ. 2019;26:1918-28). CD122 molecule is the beta subunit of IL-15 and IL-2 receptor, which starts to express at the NK cell progenitor (NKp) cell stage during the development of NK cells. When this mouse is crossed with a mouse containing a LoxP site sequence, the offspring will specifically delete the target gene in the cells expressing CD122 molecule under the action of Cre recombinase. Gpx4 fl / fl Mice were purchased from Guangdong Nansheng Biotechnology Co., Ltd. (Cat No: NM-CKO-200097), and after crossing with a mouse expressing Cre recombinase, the offspring will specifically delete the Gpx4 gene in the tissues specifically expressing Cre recombinase. Both mice were introduced and raised in the specific pathogen-free environment (SPF level) at the Experimental Animal Center of Jinan University.

[0042] 2. Construction method

[0043] Gpx4 fl / fl Mice over 8 weeks of age were used. CD122 Cre Mice over 8 weeks of age were used. Gpx4 fl / fl CD122 Cre Mice over 8 weeks of age were used. CD122 fl / + Mice over 8 weeks of age were used. CD122 Cre Mice over 8 weeks of age were used. CD122 Figure 1 A) The offspring mice were tail-clipped for DNA extraction at about 20 days after birth for genotyping, and the two genotypes of mice were separated for genotyping. The primer sequences used for genotyping are as follows:

[0044] Gpx4-flox-F: AAAGTCCTAGGAAACGCCCG;

[0045] Gpx4-flox-R: GGCACTAGGTGGAGGAGTCT;

[0046] CD122-Cre-1: CAGAGCAGCTTTGACAACCCAAACG;

[0047] CD122-Cre-2: TGCTTCACAGAAAAACCCACCCCAG;

[0048] CD122-Cre-3: CATACAATGGGGTACCTTCTGGGC.

[0049] Meanwhile, Gpx4 was verified by qPCR fl / fl CD122 Cre Knockout efficiency of mice Figure 1 B). Adult Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre After the sacrifice of mice, the NK cells of the spleen, bone marrow and liver of mice were sorted, and after the extraction of RNA to prepare cDNA, Gpx4 was detected by qPCR fl / fl CD122 Cre Efficiency of Gpx4 gene knockout of NK cells in the spleen, bone marrow and liver of mice. The primer sequence information used for qPCR is as follows:

[0050] Gpx4-F: GTCTGCCTGGATAAGTACAG;

[0051] Gpx4-R: AGGATTCGTAAACCACACTC;

[0052] Gapdh-F: CCAGCTTAGGTTCATCAGGT;

[0053] Gapdh-R: TTGATGGCAACAATCTCCAC.

[0054] The offspring mice of the same sex, same age and same cage were used for subsequent flow detection, and the genetic background of all mice was C57BL / 6J.

[0055] Example 2

[0056] 1. Preparation of sample

[0057] Gpx4 fl / + CD122 Cre Mice and Gpx4 fl / fl CD122 Cre Mice, up to 6-8 weeks, sacrifice the mice, take out the spleen, bone marrow, liver, kidney and uterus of the mice, respectively prepare into single cell suspension, after flow antibody incubation, detect on flow cytometer, at least 4 samples in each group, and conduct two repeated experiments.

[0058] 2. Flow detection of the proportion and number of liver NK cells

[0059] Flow cytometry detection and statistics of Gpx4fl / + CD122 Cre Mice and Gpx4 fl / fl CD122 Cre Mouse liver total NK cells ( Figure 2 A, B), the proportion and number of liver cNK cells and LrNK / ILC1 cells ( Figure 2 C, D). The results showed that the loss of Gpx4 in NK cells led to a significant decrease in the proportion and number of LrNK / ILC1 cells in mouse liver, while the number of cNK cells in the liver remained unchanged.

[0060] 3. Flow cytometry detection of the proportion and number of uterine and kidney NK cells

[0061] Detection and statistics of Gpx4 by flow cytometry fl / + CD122 Cre Mice and Gpx4 fl / fl CD122 Cre The proportion and number of cNK cells, trNK cells and ILC1 cells in mouse uterus ( Figure 3 A, B), the ratio and number of cNK cells and trNK cells in the kidney ( Figure 3 C, D). The results showed that Gpx4 deficiency in NK cells significantly reduced the proportion and number of trNK cells and ILC1 cells in the mouse uterus, while the number of uterine cNK cells remained unchanged. Conversely, Gpx4 deficiency in NK cells significantly reduced the proportion and number of trNK cells in the mouse kidneys, while the number of renal cNK cells remained unchanged.

[0062] 4. Flow cytometry to detect the proportion and number of other immune cells in the liver

[0063] Detection and statistics of Gpx4 by flow cytometry fl / + CD122 Cre Mice and Gpx4 fl / fl CD122 Cre Mouse liver neutrophils ( Figure 4 A, B), monocytes ( Figure 4 C, D), dendritic cells ( Figure 4 E, F), macrophages ( Figure 4 G, H) The results showed that the loss of Gpx4 in NK cells did not affect the proportion and number of neutrophils, monocytes, dendritic cells, and macrophages in the liver.

[0064] 5. Flow cytometry detection of the proportion and number of various types of T cells in the liver

[0065] Detection and statistics of Gpx4 by flow cytometry fl / + CD122 Cre Mice and Gpx4 fl / flCD122 Cre Mouse CD3 + T cells ( Figure 5 A, B), CD4 + T cells ( Figure 5 C, D), CD8 + T cells ( Figure 5 C, D), Treg cells ( Figure 5 E, F) and NKT cells ( Figure 5 The results showed that the loss of Gpx4 in NK cells did not affect the expression of CD3 + T cells, CD4 + T cells, CD8 + The proportion and number of T cells, Treg cells and NKT cells.

[0066] 6. Flow cytometry detection of NK cell development in spleen and bone marrow

[0067] Detection and statistics of Gpx4 by flow cytometry fl / + CD122 Cre Mice and Gpx4 fl / fl CD122 Cre The proportion and number of NK cells in the spleen and bone marrow of mice ( Figure 6 A, B), Gpx4 fl / + CD122 Cre Mice and Gpx4 fl / fl CD122 Cre Distribution of NK cell subsets in mouse spleen and bone marrow ( Figure 6 C, D). The results showed that the loss of Gpx4 in NK cells did not affect the proportion, number, and subset distribution of NK cells in the spleen and bone marrow of mice.

[0068] The experimental results show that Gpx4 fl / fl CD122 Cre Mice are an ideal experimental animal model for selectively depleting tissue-resident NK cells. fl / fl CD122 Cre The mice specifically lacked liver LrNK / ILC1 cells, uterine ILC1 cells and trNK cells (both NK cells resident in the uterus), and kidney trNK cells, without affecting the homeostasis of liver cNK cells, other liver immune cells, uterine cNK cells, kidney cNK cells, spleen, and bone marrow NK cells. fl / fl CD122 Cre In the future, mice are likely to become an ideal experimental animal model for studying the function of NK cells resident in the liver, uterus, and even kidney. This invention aims to provide a powerful experimental tool and theoretical basis for the advancement of NK cell biology and tissue immunology.

[0069] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications, etc. made without departing from the spirit and principles of the present application should be equivalent replacement manners and should be included in the protection scope of the present application.

Claims

1. A method of constructing an animal model selectively lacking tissue-resident NK cells, characterized in that The method comprises the following steps: Gpx4 fl / fl mice and CD122 Cre mice were crossed to obtain Gpx4 fl / fl CD122 Cre mice and Gpx4 fl / + CD122 Cre mice, and then screened out the mice with genotype Gpx4 fl / fl CD122 Cre , which is an animal model selectively lacking tissue-resident NK cells.

2. The construction method according to claim 1, characterized in that: The animal model selectively lacking tissue-resident NK cells is an animal model specifically lacking liver LrNK / ILC1 cells, uterine ILC1 cells, uterine trNK cells and kidney trNK cells.

3. The construction method according to claim 1, characterized in that: The animal model selectively lacking tissue-resident NK cells has an un-affected homeostasis of liver cNK cells, other immune cells in the liver, uterine cNK cells, kidney cNK cells, spleen and bone marrow NK cells.

4. The construction method according to claim 1, characterized in that: The screening is a PCR screening.

5. The construction method according to claim 4, characterized in that: The primers used in the PCR are: Gpx4-flox-F: AAAGTCCTAGGAAACGCCCG; Gpx4-flox-R: GGCACTAGGTGGAGGAGTCT; CD122-Cre-1: CAGAGCAGCTTTGACAACCCAAACG; CD122-Cre-2: TGCTTCACAGAAAAACCCACCCCAG; CD122-Cre-3: CATACAATGGGGTACCTTCTGGGC.

6. The construction method according to claim 1, characterized in that: The mouse is a C57BL / 6J mouse.

7. Use of the animal model selectively lacking tissue-resident NK cells according to any one of claims 1-6 in histopathology and histology research.

Images