Medicament for treating diseases related to motor neuron injury

Abstract

The invention relates to a medicine for treating diseases related to motor neuron injury. The medicine comprises circular RNA (Ribonucleic Acid) with circBank ID (Identity) being hsacircPTPRN2018 and an applicable medicine carrier, the invention also relates to application of the circular RNA in preparation of medicines for treating diseases related to motor neuron injury.

Description

Technical Field

[0001] The present application relates to the field of gene therapy, and in particular to a drug for treating diseases associated with motor neuron damage, the drug comprising: a circular RNA with a circBank ID of hsa_circPTPRN2_018 and a suitable drug carrier; the present application also relates to the use of circular RNA in the preparation of a drug for treating diseases associated with motor neuron damage. Background Art

[0002] Amyotrophic lateral sclerosis (ALS) is a motor neuron disease of unknown etiology that affects both upper and lower motor neurons. Patients show progressive muscle atrophy, weakness, paralysis, and eventually die of respiratory failure. ALS is characterized by rapid progression and high mortality. The disease is highly heterogeneous, the pathogenesis is unclear, and there is a lack of effective therapeutic drugs. Currently, the only drugs that have been certified by the FDA and widely used in clinical practice are edaravone, riluzole, and AMX0035 (a combination of sodium phenylbutyrate and taurine diol), but the efficacy is not ideal. Therefore, exploring the pathological mechanism of ALS, assisting in the development of new treatment strategies, and addressing unmet clinical needs have great scientific value and social significance. References include the following: 1) Errichelli L, Dini Modigliani S, Laneve P, et al. FUS affects circular RNA expression in murine embryonic stem cell-derived motor neurons. Nat Commun. 2017; 8: 14741. Published 2017Mar 30. doi: 10.1038 / ncomms14741; This article describes that the depletion and mutation of FUS are key factors affecting the biogenesis of circRNA, and mutations in the FUS gene can lead to ALS. Therefore, this article provides a theoretical basis for the possibility that circRNA may regulate the pathological process of ALS. 2) Colantoni A, Capauto D, Alfano V, et al. FUS Alters circRNA Metabolism in Human Motor Neurons Carrying the ALS-Linked P525LMutation. Int J Mol Sci. 2023; 24(4): 3181. Published 2023Feb 6. doi: 10.3390 / ijms24043181; This paper describes the dysregulation of circRNA expression in MNs carrying the P525LFUS mutation and links this dysregulation to the pathogenesis of ALS. Both of the above papers describe the involvement of circRNA dysregulation in regulating the pathological process of ALS, but neither of them confirms which specific pathological process a certain circRNA is associated with, which is its shortcoming.See also reference 3) D'Ambra E, Santini T, Vitiello E, et al. Circ-Hdgfrp3 shuttles along neurites and is trapped in aggregates formed by ALS-associated mutant FUS. iScience. 2021; 24(12): 103504. Published 2021Nov25. doi: 10.1016 / j.isci.2021.103504. This document found that circ-Hdgfrp3 binds to mutant FUS-positive aggregates under stress in MNs carrying mutant FUS, and the localization of circ-Hdgfrp3 changes after stress removal. This finding proposes the hypothesis that under ALS-related conditions, the long-term co-localization of circ-Hdgfrp3 with FUS inclusions may interfere with its transport and may interfere with its functional activity; the shortcoming of this document is that it has not confirmed the biological function of circ-Hdgfrp3 and whether it regulates the pathological process of ALS. Summary of the invention

[0003] The purpose of this application is to select a new circular RNA as an early diagnostic indicator and therapeutic target for ALS. circPTPRN2 is downregulated in motor neurons with ALS SOD1D90A mutation and can be used as an early diagnostic marker for ALS with this mutation gene. Overexpression of circPTPRN2 alleviates mitochondrial dysfunction in ALS motor neurons, adding a new treatment method for the clinical treatment of ALS.

[0004] 1. A drug for treating a disease associated with motor neuron damage in a patient, the drug comprising: a circular RNA with circBank ID hsa_circPTPRN2_018 and a suitable drug carrier.

[0005] 2. The drug according to item 1, wherein the drug carrier is an adeno-associated virus.

[0006] 3. The drug according to claim 1 or 2, wherein the patient is a mammal.

[0007] 4. The drug according to item 1 or 2, wherein the disease associated with motor neuron damage is selected from any one of the following groups: amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA).

[0008] 5. Use of the circular RNA with circBank ID hsa_circPTPRN2_018 in the preparation of a drug for treating diseases associated with motor neuron damage in patients.

[0009] 6. The use according to item 5, wherein the disease associated with motor neuron damage is selected from any one of the following groups: amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA).

[0010] 7. The use as described in item 5 or 6, wherein, when preparing a drug for treating a disease associated with motor neuron damage, a suitable drug carrier is used in addition to the circular RNA with circBank ID hsa_circPTPRN2_018.

[0011] 8. The use according to item 7, wherein the drug carrier is an adeno-associated virus.

[0012] 9. The use according to claim 7, wherein the patient is a mammal.

[0013] 10. A method for administering the drug of any one of items 1 to 4, wherein the drug of any one of items 1 to 4 is injected into the spinal canal of a patient, i.e., intrathecally injected.

[0014] Beneficial technical effects achieved by the technical solution of this application

[0015] The technical solution of the present application is used to treat patients suffering from ALS or SMA. The motor function of the above patients can be improved and the course of the disease can be delayed by intrathecal delivery of adeno-associated viruses that overexpress circPTPRN2. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the adhesion status of iPSCs in each group after drug screening. The figure shows the adhesion status of iPSCs in the Circ group transfected with overexpression lentivirus, the NC group transfected with control lentivirus, and the D90A group not transfected with virus after the addition of puromycin for 72 hours. It can be seen that cells remain in the Circ group and the NC group, while no cells remain in the blank group D90A, indicating that the drug screening is successful.

[0017] Figure 2This is a verification of the transfection efficiency of motor neurons; Figure A shows the GFP expression of the four groups of D90D MN, D90AMN, OE-NC MN, and OE-Circ MN. It can be seen that the motor neurons of the NC-OE and Circ-OE groups all expressed GFP, indicating that the lentivirus was successfully transfected into the motor neurons; Figure B is the RT-qPCR detection of the mRNA expression level of circPTPRN2 in each group, among which the overexpression efficiency of the Circ-OE MN group was significantly higher than that of the other groups.

[0018] Figure 3 The mitochondrial membrane potential of motor neurons in each group; the left figure shows TMRM staining of mitochondria in living cells of D90D MN, D90A MN, NC-OE MN, and Circ-OE MN, and the fluorescence intensity of mitochondria in MN axons was statistically evaluated using a microscope to reflect the mitochondrial membrane potential level; the right figure is a statistical analysis chart, from which it can be seen that the mitochondrial membrane potential of Circ-OE MN is significantly higher than that of the D90A MN group and the NC-OE MN group, indicating that CircRNA PTPRN2 can improve the decreased mitochondrial membrane potential of D90AMN.

[0019] Figure 4 ATP generation of motor neurons in each group; by detecting and counting the ATP levels of motor neurons in each group, it can be seen that the ATP level of the Circ-OE group was significantly higher than that of other groups, indicating that overexpression of circRNAPTPRN2 can improve the ATP generation of D90AMN.

[0020] Figure 5 The survival of mice in each group is shown. Comparative analysis showed that the median survival of mice injected with circ PTPRN2 overexpressing adeno-associated virus was significantly lower than that of ALS SOD mice injected with PBS and control adeno-associated virus. G93A The mice survived for 21 and 19 days longer, respectively. DETAILED DESCRIPTION

[0021] The specific embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although the specific embodiments of the present application are shown in the accompanying drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0022] It should be noted that certain words are used in the specification and claims to refer to specific components. Those skilled in the art should understand that technicians may use different nouns to refer to the same component. This specification and claims do not use the difference in nouns as a way to distinguish components, but use the difference in the functions of the components as the criterion for distinction. As mentioned throughout the specification and claims, "including" or "comprising" is an open term, so it should be interpreted as "including but not limited to". The subsequent description of the specification is a preferred embodiment of the implementation of the present application, but the description is based on the general principles of the specification and is not used to limit the scope of the present application. The scope of protection of the present application shall be determined by the attached claims.

[0023] As used herein, "substantially free" with respect to a particular component is used herein to mean that the particular component is not purposefully formulated into the composition and / or is present only as a contaminant or in trace amounts. Thus, the total amount of the particular component resulting from any accidental contamination of the composition is less than 0.05%, preferably less than 0.01%. Most preferred are compositions in which the amount of the particular component is undetectable by standard analytical methods.

[0024] As used in this specification, "a" or "an" may mean one or more. As used in the claims, when used with the word "comprising", the word "a" or "an" may mean one or more than one.

[0025] The term "or" is used in the claims to mean "and / or" unless explicitly stated to refer only to alternatives or the alternatives are mutually exclusive, although the content of this application supports a definition referring only to alternatives and "and / or." As used herein, "another" may mean at least a second or more.

[0026] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method used to determine the value, or the variation that exists between study subjects.

[0027] The methods for obtaining various biological materials described in the examples are only provided as an experimental method to achieve the specific disclosed purpose, and should not be construed as limiting the sources of biological materials in this application. In fact, the sources of biological materials used are extensive, and any biological material that can be obtained without violating laws and moral ethics can be replaced and used according to the instructions in the examples.

[0028] In a first aspect, the present application provides a drug for treating diseases associated with motor neuron damage.

[0029] In one embodiment, a drug for treating a disease associated with motor neuron damage is provided, the drug comprising: a circular RNA with a circBank ID of hsa_circPTPRN2_018 and a suitable drug carrier. Here, the sequence of the circular RNA with a circBank ID of hsa_circPTPRN2_018 is shown in SEQ ID NO.1:

[0030] AAAAGCAAACTCAAGTTCCTGCCTCCTCAGGCGGAGCAAGAAGACTCCACCAAGTTCATCGCGCTCACCCTGGTCTCCCTCGCCTGCATCCTGGGCGTCCCTCCTGGCCTCTGGCCTCATCTACTGCCTCCGCCATAGCTCTCAGCACAGGCTGAAGGAGAAGCTCTCGGGACTAGGGGGCGACCCAGGTGCAGATGCCACTGCC GCCTACCAGGAGCTGTGCCGCCAGCGTATGGCCACGCGGCCACCAGACCGACCTGAGGGCCCGCACACGTCACGCATCAGCAGCGTCTCATCCCAGTTCAGCGACGGGCCGATCCCCAGCCCCTCCGCACGCAGCAGCGCCTCATCCTGGTCCGAGGAGCCTGTGCAGTCCAACATGGACATCTCCACCGGCCACATGATCCTG.

[0031] In the context of this specification, circBank (http: / / www.circbank.cn / index.html) is a database where human circRNA sequences can be obtained. circBank is a comprehensive human circRNA database that includes more than 140,000 human annotated circRNAs from different sources. In addition to the basic information of circRNAs, it also includes information such as binding miRNAs predicted by two methods, circRNA protein coding potential, circRNA conservation, circRNA mutations and modifications such as methylation.

[0032] The applicant chose the circular RNA hsa_circPTPRN2_018 for the following reasons: first, by reviewing the literature, it was found that circular RNA is specifically expressed in neural tissue and can play an important regulatory function in neurodegenerative diseases; second, the applicant discovered and verified through sequencing and qPCR that the expression of hsa_circPTPRN2_018 circular RNA is downregulated in motor neurons carrying the ALS mutant gene SOD1, so we chose to overexpress this circular RNA to observe whether it can alleviate the disease phenotype of ALS motor neurons.

[0033] In a specific embodiment, a drug is provided, wherein the drug carrier is an adeno-associated virus.

[0034] In the context of this specification, there are various methods for using "adeno-associated virus" as a "drug carrier". In animal experiments, the applicant took the following measures: injecting adeno-associated virus overexpressing circular RNA into the spinal canal of mice. In clinical trials, the method of introducing circular RNA into the body of patients is limited. Generally, adeno-associated virus overexpressing circular RNA is injected into the spinal canal of patients. Here, any technical means for introducing circular RNA into the body of patients and playing a therapeutic role is suitable.

[0035] In yet another specific embodiment, a drug is provided, wherein the disease associated with motor neuron damage is selected from any one of the following groups: amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA).

[0036] In the context of this specification, amyotrophic lateral sclerosis (ALS), referred to as ALS, also known as gradual freezing, is a chronic, progressive neurological disease that mainly damages upper motor neurons and lower motor neurons and the trunk, limbs and head and facial muscles they control. The cause of the disease is still unclear. It may be related to genetic factors, as well as lifestyle, exposure to poisons, excessive physical labor, low body mass index, history of head trauma, metabolic diseases, autoimmune dysfunction and other factors; the peak of onset usually occurs in people over 45 years old, and the incidence rate in men is higher than that in women. The main clinical manifestations of amyotrophic lateral sclerosis are progressive skeletal muscle weakness, muscle atrophy, fasciculations and bulbar paralysis, which will gradually worsen with the course of the disease, and may even affect respiratory muscles and cause breathing difficulties. Patients may also experience symptoms such as conscious numbness, limb paralysis, weight loss, arrhythmia, and are likely to face emotional problems such as depression and anxiety. Parkinson's disease, also often referred to as "tremor paralysis", is a degenerative disease of the nervous system. The main cause of this disease is the degeneration and death of dopaminergic neurons in the substantia nigra, which may be related to multiple factors such as genetics, environmental factors and aging of the nervous system. It is generally recognized that aging is the most important factor in the occurrence of Parkinson's disease. The disease has a significant high incidence in the elderly, and the incidence rate in men is slightly higher than that in women. The symptoms of Parkinson's disease vary, mainly manifested in two types of symptoms: motor and non-motor. Motor symptoms include resting tremor, muscle rigidity, bradykinesia and postural balance disorders; non-motor symptoms mainly include constipation, olfactory disorders, sleep disorders, autonomic dysfunction and mental and cognitive disorders. Spinal muscular atrophy (SMA), also known as progressive spinal muscular atrophy and spinal muscular atrophy, is a type of disease caused by the degeneration of the anterior horn motor neurons of the spinal cord and the motor nerve nuclei of the brainstem, leading to muscle weakness and atrophy. It is an autosomal recessive genetic disease, which is not uncommon in clinical practice. According to the age of onset and the severity of muscle weakness, it is clinically divided into three types: SMA-Ⅰ, SMA-Ⅱ and SMA-Ⅲ, namely infantile, intermediate and juvenile. The common feature is the degeneration of the anterior horn cells of the spinal cord. The clinical manifestations are progressive, symmetrical, widespread flaccid paralysis and muscular atrophy mainly in the proximal limbs. The intellectual development and sensation are normal. The difference between the various types is based on the age of onset, the speed of disease progression, the degree of muscle weakness and the length of survival. There is no specific effective treatment for this disease. The main treatment measures are to prevent or treat various complications caused by severe muscle weakness, such as pneumonia, malnutrition, skeletal deformity, movement disorders and mental and social problems.

[0037] In another specific embodiment, a drug is provided, wherein the patient is a mammal. Specifically, mammals include but are not limited to tigers, wolves, mice, rats, minks, monkeys, zebras, foxes, bears, elephants, leopards, musk oxen, lions, red pandas, warthogs, antelopes, reindeers, koalas, rhinos, lynxes, giraffes, pandas, anteaters, gorillas, manatees, otters, civets, dolphins, walruses, hedgehogs, polar bears, kangaroos, armadillos, hippos, seals, whales, weasels, and common livestock and pets; specifically, livestock include but are not limited to horses, cattle, sheep, pigs, and chickens; specifically, pets include but are not limited to cats, dogs, hamsters, and rabbits.

[0038] In a second aspect, the present application provides pharmaceutical uses of specific circular RNA.

[0039] In one specific embodiment, provided is the use of a circular RNA with circBank ID hsa_circPTPRN2_018 in the preparation of a medicament for treating a disease associated with motor neuron damage.

[0040] In another specific embodiment, the above-mentioned use is provided, wherein the disease associated with motor neuron damage is selected from any one of the following groups: amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA).

[0041] In another specific embodiment, the above-mentioned use is provided, wherein, when preparing a drug for treating a disease associated with motor neuron damage, a suitable drug carrier is used in addition to the circular RNA with circBank ID hsa_circPTPRN2_018.

[0042] In a specific embodiment, the above use is provided, wherein the drug carrier is an adeno-associated virus.

[0043] In yet another specific embodiment, the above use is provided, wherein the patient is a mammal.

[0044] In a third aspect, the present application provides a method for administering a drug.

[0045] In yet another specific embodiment, a method for administering the drug as described above is provided, wherein the drug as described above is injected into the spinal canal of a patient; herein, the "patient" may be an animal or a human being, and should be understood in a broad sense.

[0046] Examples

[0047] Example 1 Effect of circPTPRN2 on mitochondrial function (in vitro cell experiment):

[0048] ①Experimental supplies:

[0049] 1) Experimental materials: 35 mm confocal dish, sterile pipette tip, sterile centrifuge tube, sterile pipette.

[0050] 2) Cell culture reagents: DMEM / F-12 medium, Neurobasal medium, DMEM / F12, GlutaMax, AA, B27, N2, RA, SAG, BDNF, GDNF, IGF, Compound E.

[0051] 3) Mitochondrial dye: TMRM.

[0052] 4) Induction and drug screening reagents: doxy, puromycin, and Bio-Tech S0027 enhanced ATP detection kit.

[0053] 5) Instruments: CO2 cell culture incubator, biological safety cabinet, electronic pipette, Olympus confocal microscope, and microplate reader.

[0054] ② Experimental methods: The construction and packaging of overexpression lentiviral vectors were completed by Jikai Company, and the process included: A) Preparation of overexpression lentiviral clones. The linearized vector was obtained by restriction endonuclease digestion, and the PTPRN2 gene fragment was prepared by PCR amplification. The reaction system was prepared with the linearized vector and the target gene amplification product, and the recombination reaction was carried out to achieve in vitro circularization of the linearized vector and the target gene fragment. The recombinant product was directly transformed, and the single clone on the plate was selected for PCR identification, and the positive clone was sequenced and the results were analyzed. The correct cloned bacterial solution was expanded and extracted to obtain a high-purity plasmid. B) Packaging lentivirus. Jikai used a tool vector plasmid and two virus packaging auxiliary plasmids to co-transfect 293T cells. 48-72 hours after the transfection was completed, the supernatant of the unpurified cells was collected for virus, and the high-titer overexpression CircPTPRN2 lentiviral storage solution was obtained by centrifugal contraction and concentration purification. After obtaining, it can be stored in a -80 degree refrigerator for one year.

[0055] 1) Obtaining iPSCs overexpressing circPTPRN2: Prepare appropriate amounts of circPTPRN2 overexpressing lentivirus and control lentivirus in advance, and divide them into control lentivirus transfection group (NC-OE) and overexpression lentivirus transfection group (Circ-OE). After digesting the ALS mutant iPSC cells with dispase, wash them twice with DF-12, then add the culture medium, gently blow off the target clones with a 200ul pipette tip, blow off all the clones with a 1ml pipette tip for 2-3 times (to prevent the clones from sticking to the wall of the pipette tip, you can first absorb DF-12 to wet the pipette tip), until no obvious cell clumps are visible to the naked eye, quickly absorb 10ul and mix with 10ul trypan blue for counting. According to the instructions, the number of infected cells in a 6-well plate is 200,000, so it is planned to divide the cells into corresponding amounts, at least two wells for NC-OE and at least two wells for Circ-OE.

[0056] Then transfer the cell suspension to a clean EP tube at 250ul / tube. Add 6.67ul of the corresponding virus. This time, set the MOI of NC to 5 and the MOI of circ to 5. After adding the virus, add 750ul of culture medium and mix gently. Then cover the lid and place in the incubator for infection for half an hour. After half an hour, remove the EP tube and add the cells to each well of the 6-well plate, and add 1ul of Rho to each well.

[0057] 72 hours after transfection, puromycin 1.5ug / ml was added for drug screening. After three days of continuous screening, the remaining iPSC clones were expanded. After one day of doxy induction, iPSCs expressing GFP under a microscope were the iPSC stable lines that were successfully transfected and stably overexpressed CircPTPRN2.

[0058] 2) Differentiate iPSCs overexpressing CircPTPRN2 into mature motor neurons. Human iPSCs were differentiated into neuroepithelial cells (NEP) in vitro, and the small molecules in the NEP culture medium were DMH1 (2μM) + SB431542 (2μM) + CHIR99021 (3μM); NEPs were differentiated into spinal cord MNPs in vitro, and the small molecules in the MNP culture medium were DMH1 (2μM) + SB431542 (2μM) + CHIR99021 (1μM) + RA (0.1μM) + SAG (0.5μM); spinal cord motor progenitor cells were differentiated into spinal cord MNPs in vitro Directed differentiation into postmitotic motor neurons in the spinal cord: the motor neuron progenitor cells were digested and resuspended for suspension culture. The small molecules in the MN culture medium were RA (0.5 μM) + SAG (0.1 μM). After 7 days, MNPs were directed to differentiate into postmitotic motor neurons and specifically expressed Hb9 and Tuj1 after attachment. For the maturation of spinal motor neurons, the steps of coating 24-well plates with matrigel were performed on ice overnight. The MN maturation culture medium was prepared in the dark. The culture medium was the same as the MN culture medium (4.7 mL DMEM / F12+4.8mL Neurobasal+0.05mL N2+0.1mL B27+0.1mL AA+0.1mL Glutamax+0.1mL P / S+5uL RA(0.5μM)+1uL SAG(0.1μM), but Compound E(0.5μM) was added in the first 3 days. The MN spheres at day 19 of differentiation were digested into single or several cells with Accutase, and then planted in a matrigel-coated 24-well plate at 37°C and 5% CO2. After 3 days, Compound E was removed and cultured for another 7 days (equivalent to a total of 10 days). Postmitotic neurons are not mature and are stimulated by the addition of the notch signal inhibitor Compound E. Under the action of E, postmitotic motor neurons can mature after 10 days of attachment and specifically express Chat and Map2. On the third day after MNs were attached to matrigel-coated culture plates, doxy (1 μg / ml) was added to induce the expression of CircPTPRN2. Mature motor neurons overexpressing CircPTPRN2 were obtained on the 10th day after attachment. RT-qPCR was used to verify the overexpression efficiency of CircPTPRN2.

[0059] 3) Mitochondrial membrane potential staining of live motor neurons. Four groups of motor neurons were obtained according to the above differentiation steps, namely the D90A group with ALS SOD1 mutation (abbreviated as D90A MN), the D90D group with corrected mutation gene (abbreviated as D90D MN), the control lentivirus transfection group (abbreviated as NC-OE MN), and the CircPTPRN2 overexpression group (abbreviated as Circ-OE MN).

[0060] TMRM dye is used to mark mitochondrial membrane potential. Take an appropriate amount of DMSO and TMRM stock solution to make a 200nM TMRM dye reagent. Pipette 1μl TMRM and add it to a 1ml confocal dish with motor neurons. Incubate it in a 37-degree incubator for half an hour, then discard the culture medium, gently rinse it with DF-12, add fresh culture medium and a small amount of TMRM dye to a final concentration of 25nM, and continue to return to the incubator for 10 minutes. Place the stained confocal dish under a confocal microscope for observation and shooting, set the laser excitation wavelength to 594, and select the layer with the highest fluorescence intensity for shooting. ImageJ was used to count the fluorescence intensity of the four groups of D90D MN, D90A MN, OE-NC MN, and OE-Circ MN.

[0061] 4) Evaluation of ATP production in motor neurons. D90D MN, D90A MN, OE-NC MN, and OE-Circ MN were plated on 24-well plates and the ATP production level was detected after 13 days. The detection reagents were prepared on ice in advance, including ATP detection working solution and ATP standard solutions with multiple concentration gradients as standards. After the formal detection begins, the motor neuron culture medium is first aspirated and 80 μl of lysis solution is added to each well to lyse the cells. When lysing the cells, in order to fully lyse them, a pipette can be used to repeatedly blow or shake the culture plate so that the lysis solution fully contacts and lyses the cells. After lysis, centrifuge at 4°C 12000g for 5 minutes, and take the supernatant as the sample for each group. Add 100 μl of ATP detection working solution to the detection well or detection tube. Place at room temperature for 3-5 minutes to consume all the background ATP, thereby reducing the background. Add 20 μl of sample or standard to the test hole or test tube, quickly mix with a gun (micropipette), and after at least 2 seconds, measure the RLU value or CPM with a chemiluminometer (luminometer) or liquid scintillation meter. At the same time, use a protein concentration kit to detect the protein concentration of each group.

[0062] The standardized ATP concentrations in the D90D MN, D90A MN, OE-NC MN, and OE-Circ MN4 groups of samples were calculated based on the standard curve and the protein concentration of each group.

[0063] ③Experimental results:

[0064] Figure 1 The figure shows the adhesion status of iPSCs in each group after drug screening.

[0065] The figure shows the adhesion of iPSCs after the addition of puromycin for 72 hours in the Circ group transfected with overexpression lentivirus, the NC group transfected with control lentivirus, and the D90A group transfected with virus. It can be seen that cells remain in both the Circ group and the NC group, while no cells remain in the blank group D90A, indicating that the drug screening is successful.

[0066] Figure 2 Verification of motor neuron transfection efficiency is shown.

[0067] Figure A shows the GFP expression of the four groups of D90D MN, D90A MN, OE-NC MN, and OE-Circ MN. It can be seen that the motor neurons of the NC-OE and Circ-OE groups all expressed GFP, indicating that the lentivirus was successfully transfected into the motor neurons. Figure B shows the mRNA expression level of circPTPRN2 in each group detected by RT-qPCR, among which the overexpression efficiency of the Circ-OE MN group was significantly higher than that of the other groups.

[0068] Figure 3 The mitochondrial membrane potential of motor neurons in each group is shown.

[0069] The left picture shows TMRM staining of mitochondria in living cells of D90D MN, D90A MN, NC-OE MN, and Circ-OE MN. The fluorescence intensity of mitochondria in MN axons was statistically evaluated using a microscope to reflect the level of mitochondrial membrane potential. The right picture is a statistical analysis chart. The figure shows that the mitochondrial membrane potential of Circ-OE MN is significantly higher than that of the D90A MN group and the NC-OE MN group, indicating that CircRNA PTPRN2 can improve the decrease in mitochondrial membrane potential of D90A MN.

[0070] Figure 4 The ATP production of motor neurons in each group is shown.

[0071] By detecting and counting the ATP levels of motor neurons in each group, it was found that the ATP level of the Circ-OE group was significantly higher than that of the other groups, indicating that overexpression of circRNA PTPRN2 can improve the ATP production of D90A MNs.

[0072] The above results summarize: Mitochondria are the energy center of cells, responsible for producing most of the energy molecules required by cells, adenosine triphosphate (ATP). Mitochondrial dysfunction can lead to phenotypes such as reduced energy production, increased oxidative stress, and mitochondrial DNA damage, which impair the function of cells and tissues. Mitochondrial dysfunction has been reported in many literatures in neurodegenerative diseases including ALS. Mitochondrial dysfunction can be specifically defined as: decreased mitochondrial respiratory capacity, decreased mitochondrial membrane potential, accompanied by increased production of oxygen free radicals, and abnormalities in mitochondrial mass and oxidative phosphorylation. In this patent, overexpression of circPTPRN2 can alleviate some mitochondrial dysfunction, including increasing the mitochondrial membrane potential and ATP production in ALS MNs, thus becoming a possible treatment strategy for ALS.

[0073] Alternative solutions:

[0074] In the above step 2), the motor neurons were spread on the slides coated with matrigel, but can be replaced with plo and laminin coating. The specific experimental plan is as follows:

[0075] Place a sterile glass slide in a 24-well plate and add 80ul of plo (0.1mg / ml), and place it in a 37°C, 5% CO2 incubator for overnight coating. Take out the plate the next day, discard the plo, wash it 2-3 times with sterile BI water, then add 50ul of laminin to each well, place it in a 37°C, 5% CO2 incubator for 2 hours, then add the motor neuron pellet suspension to the glass slide, place it in a 37°C, 5% CO2 incubator and wait for the pellet to adhere to the wall. After 1 hour, take out the cell plate and add 500ul / well of freshly prepared MN culture medium, then change the medium every other day, and obtain mature motor neurons after 10 days.

[0076] Example 2 Intrathecal injection of adeno-associated virus overexpressing CircPTPRN2 prolongs the survival of ALS mice (in vivo experiment using mice)

[0077] ①Experimental supplies:

[0078] 1) Experimental materials: 25ul microinjector

[0079] 2) Experimental reagents: 3% sodium pentobarbital, PBS, adeno-associated virus overexpressing circPTPRN2, control adeno-associated virus

[0080] ② Experimental methods:

[0081] 1) Obtaining adeno-associated virus overexpressing circPTPRN2.

[0082] A) First prepare an adeno-associated virus clone that overexpresses circPTPRN2. The steps are the same as "lentivirus preparation". That is, use restriction endonuclease digestion to obtain a linearized vector, and use PCR amplification to prepare the PTPRN2 gene fragment. Prepare a reaction system with the linearized vector and the target gene amplification product, perform a recombination reaction, and realize the in vitro circularization of the linearized vector and the target gene fragment. The recombinant product is directly transformed, and the single clone on the plate is selected for PCR identification, and the positive clone is sequenced and the results are analyzed. The correct clone bacterial solution is expanded and extracted to obtain a high-purity plasmid.

[0083] B) Adeno-associated virus packaging. GK uses GV series AAV9 vector, pHelper vector and pAAV-RC vector to form the AAV Helper-Free System three-plasmid system to co-transfect HEK 293T cells. The virus is harvested 72 hours after the transfection is completed (i.e., the unpurified cell supernatant and cell pellet), and a high-purity AAV9 virus storage fluid overexpressing CircPTPRN2 is obtained by gradient density centrifugation. After obtaining, it can be stored in a -80 degree Celsius refrigerator for one year.

[0084] 2) Intrathecal injection: fasting but not water for 24 hours before intrathecal injection. The weight of mice was weighed and recorded with an electronic weighing machine before the operation. Anesthesia was performed by intraperitoneal injection of 3% sodium pentobarbital (0.5ml / 100g). Anesthesia was considered successful if there was no reaction after pinching the tail or paw and the corneal reflex disappeared. The operation was performed aseptically, and the ambient temperature was controlled at about 28°C. The anesthetized mice were placed prone on the operating table and fixed with tape on their limbs; hair at the lumbar spine was removed with an electric shaver to expose the pink skin, and the right hand was tweezers dipped in alcohol cotton balls to gently wipe the skin at the lumbar spine; the blade was held and slowly cut 1.5-2.0cm along the lumbar spine, and the skin was slowly pulled apart until the lumbar spinous process was fully exposed; the experimenter's non-dominant hand fixed the head and upper body of the mouse, and the thumb and index finger firmly fixed the iliac crest hip bone for accurate positioning later. Using the spinous process of L6 as a positioning marker (the most prominent spinous process of mice), a microsyringe (25 μl) was used to puncture the center point between the L5 and L6 segments. After piercing the skin, the experimenter could feel the syringe "slipping" between the vertebrae. At this time, the needle insertion speed should be slowed down as much as possible. After entering a few millimeters, the mouse's tail will flick or swing in an "S" shape, which is considered a sign of successful puncture. Then, a total volume of 10 μl of adeno-associated virus (no more than 10 μl in a single injection) was injected into the subarachnoid space at a constant rate of 10 μl / min, and then the syringe was unscrewed to complete the intrathecal injection of mice.

[0085] 3) Observe the condition of the mice, change the cage, bedding and water every week, and record the survival time of the mice

[0086] 4) Indicators for the termination of the experiment: ALS mice were killed when their motor function was severely degraded and they could not stand up on their own within 30 seconds after lying in the lateral position.

[0087] ③Experimental results:

[0088] Figure 5 The survival time of mice in each group is shown.

[0089] Comparative analysis showed that the median survival of mice injected with adeno-associated virus overexpressing circPTPRN2 was significantly lower than that of ALS SOD mice injected with PBS and control adeno-associated virus. G93AThe mice were extended by 21 days and 19 days respectively (SOD G93A -PBS vs SOD G93A -circPTPRN2 P<0.01; SOD G93A -NC vs SOD G93A -circPTPRN2 P<0.05). G93A Intrathecal delivery of adeno-associated virus overexpressing circPTPRN2 in mice significantly prolonged their survival.

[0090] Although the embodiments of the present application are described above in conjunction with the accompanying drawings, the present application is not limited to the above specific embodiments and application fields, and the above specific embodiments are merely illustrative and instructive, rather than restrictive. A person of ordinary skill in the art can also make many forms under the guidance of this specification and without departing from the scope of protection of the claims of the present application, all of which belong to the protection of the present application.

Claims

1. A drug for treating a disease associated with motor neuron damage in a patient, the drug comprising: Circular RNA with circBank ID hsa_circPTPRN2_018 and suitable drug carriers.

2. The drug according to claim 1, wherein The drug carrier is adeno-associated virus.

3. The drug according to claim 1 or 2, wherein The patient is a mammal.

4. The drug according to claim 1 or 2, wherein The disease associated with motor neuron damage is selected from any one of the following groups: amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA).

5. Use of the circular RNA with circBank ID hsa_circPTPRN2_018 in the preparation of a drug for treating diseases associated with motor neuron damage in patients.

6. The use according to claim 5, wherein The disease associated with motor neuron damage is selected from any one of the following groups: amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA).

7. The use according to claim 5 or 6, wherein When preparing a drug for treating diseases associated with motor neuron damage, a suitable drug carrier is used in addition to the circular RNA with circBank ID hsa_circPTPRN2_018.

8. The use according to claim 7, wherein The drug carrier is adeno-associated virus.

9. The use according to claim 7, wherein The patient is a mammal.

10. A method for administering the drug according to any one of claims 1 to 4, wherein: The drug according to any one of claims 1 to 4 is injected into the patient's spinal canal, i.e., intrathecally injected.

Images