Application of Maize Gene ZmGG2 in Controlling Maize Yield

By knocking out the maize gene ZmGG2 through the CRISPR/Cas9 system and regulating the number of ear rows and ear weight, the basic genetic problems of maize yield traits were solved, and a significant increase in maize yield was achieved.

CN119144648BActive Publication Date: 2025-09-16HUAZHONG AGRI UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411447730.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-16
Publication Date
2025-09-16
Estimated Expiration
2044-10-16

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively analyze the genetic basis of corn yield traits, especially the control of ear row number and ear weight, resulting in limited yield increases in the breeding process.

Method used

The CRISPR/Cas9 system was used to knock out or inhibit the expression of the maize gene ZmGG2, and the number of ear rows and ear weight were regulated through gene editing, which involved the G protein γ subunit protein involved in the plant sugar signaling pathway, thereby increasing corn yield.

Benefits of technology

By reducing the expression of the ZmGG2 gene, the number of corn ear rows and ear weight were increased, and the corn yield was significantly improved, providing new breeding gene resources and theoretical support.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005088169630000041
    Figure BDA0005088169630000041
  • Figure HDA0005088169640000011
    Figure HDA0005088169640000011
  • Figure HDA0005088169640000012
    Figure HDA0005088169640000012
Patent Text Reader

Abstract

This invention, belonging to the field of plant genetic engineering technology, discloses the use of the maize gene ZmGG2 in controlling maize yield. The protein encoded by ZmGG2 is shown in SEQ ID NO. 2. This gene is located on maize chromosome 7 and controls the number of rows and weight of maize ears. Knocking out this gene and inhibiting its expression using CRISPR / Cas9 technology can increase the number of rows and weight of maize ears.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering technology and specifically relates to the application of the maize gene ZmGG2 in controlling maize yield. The gene is located on maize chromosome 7 and controls important yield traits such as the number of rows of female ears and / or ear weight. Background Art

[0002] Maize yield is a complex quantitative trait controlled by multiple genes. Ear length, number of kernels per row, number of rows per ear, ear weight, and cob weight are important components of maize yield. Dissecting maize yield traits into distinct yield factors facilitates understanding the genetic basis underlying yield traits, helping breeders more effectively utilize genetic resources to design breeding strategies and achieve efficient breeding. At a specific planting density, maize yield per unit area is determined by kernel yield per ear and number of ears; kernel yield per ear is determined by kernels per ear and 100-kernel weight, and kernels per ear are determined by number of rows per ear and kernels per row. Maize ear length and ear diameter are significantly correlated with kernels per row and number of rows per ear, respectively. Using yield and related trait data published by Argentina between 1965 and 2016 for 32 different maize varieties, the experimental design maintained a consistent maximum possible planting density and randomized blocks with three replicates. Results show that over the past 50 years of corn breeding, maize yield has increased at an average rate of 113 kg / ha / year. This yield increase is positively correlated with an increase in kernel number per ear and is unrelated to changes in individual kernel weight. Biomass accumulation per ear has increased annually, while the tassel-silking interval has shortened, and flowering has become more consistent. However, kernel formation efficiency has remained constant, and the gradual trends of all traits are consistent with expectations, indicating that increasing kernel number per ear is a key driver of the annual yield increase. Unraveling the genetic basis of ear length and kernel number per row is crucial for understanding the mechanisms of corn yield formation and provides a theoretical basis for breeding practice.

[0003] In light of this, this study used genetic methods to isolate a gene, ZmGG2, located on maize chromosome 7, that controls the number of rows and weight of ears. This gene encodes a G protein gamma subunit involved in the sugar signaling pathway in plants. Based on the genetic phenotypes of the transgenic material and related molecular biological analyses, the biological function of this gene in controlling traits such as number of rows and weight of ears was confirmed. This genetic transformation study of ZmGG2 can provide genetic resources and theoretical support for maize breeding. Summary of the Invention

[0004] The purpose of the present invention is to provide an application of the maize gene ZmGG2 in controlling maize yield. The protein encoded by the gene is shown in SEQ ID NO.2.

[0005] In order to achieve the above object, the present invention adopts the following technical measures:

[0006] Application of the maize gene ZmGG2 in controlling maize yield, wherein the protein encoded by the gene is shown in SEQ ID NO. 2 (NP_001152197.2);

[0007] The applications mentioned above are:

[0008] Application of reducing the expression of maize gene ZmGG2 in increasing maize yield;

[0009] Application of knocking out, inhibiting or silencing the expression of maize gene ZmGG2 in improving maize yield;

[0010] In the above-mentioned applications, preferably, the knockout is carried out using the CRISPR / Cas9 system, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein, thereby achieving the effect of increasing corn yield.

[0011] Preferably, the target sites of gRNA in the CRISPR / Cas9 system are GCTTCTCTAGTCCCGAACAC and GAGATCGAATTCCTCA.

[0012] In the above-mentioned application, preferably, the edited corn mutant with improved yield contains the sequence shown in SEQ ID NO.5 or SEQ ID NO.6.

[0013] Application of increasing the expression of maize gene ZmGG2 in reducing maize yield;

[0014] The application described above is to introduce substances that increase the expression of the maize ZmGG2 gene into maize;

[0015] In the above application, preferably, the substance is a nucleic acid molecule containing the ZmGG2 gene, or its expression cassette, recombinant vector, or recombinant microorganism;

[0016] The ZmGG2 gene is shown as SEQ ID NO.1.

[0017] In the above application, the control of corn yield is achieved by controlling the number of ear rows and / or ear weight.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] The present invention cloned and confirmed the gene ZmGG2, which controls the number of rows and weight of ears in maize, and confirmed the relationship between the number of rows and weight of ears and the expression level of ZmGG2. By reducing its expression level, the number of rows and weight of ears in maize can be increased. The difference in kernel number per ear between transgenic and wild-type materials is due to editing of the gene's coding region, which causes a decrease in the level of the protein encoded by the gene. In terms of its mechanism of action, it is believed that this gene is involved in the sugar signal response in the plant body, increasing the response to sugar signals, thereby regulating the expression of downstream genes, ultimately controlling the differentiation activity of the maize inflorescence meristem, affecting maize yield traits such as the number of rows and weight of ears. Therefore, the present invention provides a new genetic resource for improving maize yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of maize ZmGG2 gene knockout material;

[0021] Among them: A is a schematic diagram of the editing of the maize ZmGG2 gene, in which zmgg2-1 lacks the A base and zmgg2-2 lacks the AT base. The insertion and deletion of these bases lead to premature termination of protein translation.

[0022] B is a schematic diagram of the protein structure of maize ZmGG2 gene knockout materials, from top to bottom: the wild-type family (WT) isolated from transgenic heterozygous plants, and two ZmGG2 gene-edited families zmgg2-1 and zmgg2-2;

[0023] C is a schematic diagram of the female ear of the maize ZmGG2 gene knockout material, from top to bottom, including the wild-type family (WT), two ZmGG2 gene-edited families zmgg2-1 and zmgg2-2;

[0024] D is a schematic diagram of the number of ear rows of maize ZmGG2 gene knockout materials. The bar graphs from left to right are the wild-type family (WT), two ZmGG2 gene-edited families zmgg2-1 and zmgg2-2;

[0025] E is a schematic diagram of the ear width of the maize ZmGG2 gene knockout material. The bars from left to right are the wild-type family (WT), two ZmGG2 gene-edited families zmgg2-1 and zmgg2-2;

[0026] F is a schematic diagram of ear weight of maize ZmGG2 gene knockout materials. The bar graphs from left to right are the wild-type family (WT), two ZmGG2 gene-edited families zmgg2-1 and zmgg2-2.

[0027] Figure 2 Schematic diagram of the expression pattern of the maize ZmGG2 gene;

[0028] Among them: A: ZmGG2 is highly expressed in maize meristem; BC: In situ hybridization results showed that ZmGG2 is specifically expressed in IM (inflorescence meristem), SPM (spikelet pair meristem) and SM (spikelet meristem) of 2mm young ears. DETAILED DESCRIPTION

[0029] The following examples further define the present invention. Based on the following description and examples, those skilled in the art can determine the essential features of the present invention and, without departing from the spirit and scope of the present invention, can make appropriate improvements and modifications to the present invention to make it suitable for various uses and conditions. The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels or published materials.

[0030] Example 1: ZmGG2 cloning

[0031] Total DNA was extracted from the leaves of the inbred line KN5585 (Liu, et al. High-throughput CRISPR / Cas9 mutagenesis streamlin es trait gene identification in maize. The Plant Cell, 2020, 32: 1397–1413). Primers G2-F and G2-R were designed based on the genome reference sequence of maize B73 (National Crop Germplasm Center). The ZmGG2 gene was PCR amplified and resequenced in the KN5585 material, and the complete CDS nucleotide sequence of the ZmGG2 gene was obtained (SEQ ID NO. 1). The protein encoded by this gene is shown in SEQ ID NO. 2.

[0032] Total DNA from plant leaves was extracted using the CTAB method, and the PCR amplification program was as follows: pre-denaturation at 94°C for 5 min, followed by 34 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 60 s, and finally extension at 72°C for 5 min.

[0033] Table 1. Primers used in the present invention and their sequences

[0034]

[0035] Example 2: Genetic transformation of ZmGG2 in maize

[0036] The genetic transformation of ZmGG2 gene knockout was carried out by using ZmGG2 in transgenic recipient material KN5585 as the applied gene, the sequence of which is shown in SEQ ID NO.1. http: / / cbi.hzau.edu.cn / crispr / ) were used for gene target design, ultimately obtaining Guide RNA (Target: GCTTCTCTAGTCCCGAACAC and GAGATCGAATTC CTCA). Based on the Guide RNA, two ZmU6-Target-sgRNA fragments (shown in SEQ ID NO. 3 and SEQ ID NO. 4) were synthesized by gene synthesis and constructed into the commercial pEASY-T1 vector.

[0037] The fragment was amplified by PCR using primers pU6F1 and gRR1 (primer sequences are shown in Table 1, Primer ID 2). The CPB-ZmUbi-hspCas9 vector was linearized using HindIII single enzyme digestion, recovered and detected by electrophoresis, and the Guide RNA was connected to the target vector CPB-ZmUbi-hspCas9 (CN113004383A) by homologous recombination. Finally, the resulting clone was sequenced using CRISPR vector detection primers (primer sequences are shown in Table 1, Primer ID 3) to confirm that the target fragment was connected to the vector.

[0038] The correctly cloned plasmid was transformed into the maize inbred line KN5585 via Agrobacterium-mediated transformation (genetic transformation was completed by the Life Science Technology Center of China National Seed Group Corporation). Using specific ZmGG2 gene detection primers (primer sequences are shown in Table 1, primer ID4), two maize transformation events were screened with KN5585 as the background ( Figure 1 A), zmgg2-1 and zm gg2-2, among which zmgg2-1 lacks the G base (zmgg2-1 contains the sequence shown in SEQ ID NO.5), and zmgg2-2 lacks the CG base (zmgg2-2 contains the sequence shown in SEQ ID NO.6). The insertion and deletion of these bases lead to the premature termination of protein translation ( Figure 1 Furthermore, in 2023, the phenotypic values ​​of maize ear length and kernel number per row in the ZmGG2 gene knockout family were investigated in Gansu ( Figure 1 The results showed that compared with WT, the number of ears and rows of maize in zmgg22-1 and zmgg2-2 increased by 12.4% and 11.7%, respectively, after the ZmGG2 gene function was lost. Figure 1 D), the ear width increased by 19.9% ​​and 14.9% ( Figure 1 Middle E), the average ear weight increased by about 10.9% ( Figure 1Based on the above results, it was proved that reducing the expression of ZmGG2 gene can increase the ear length and the number of kernels per row of corn.

[0039] Example 3:

[0040] Expression analysis of ZmGG2

[0041] Based on the maize B73 expression database, the expression pattern of the ZmGG2 gene was analyzed. The expression level of the ZmGG2 gene in maize meristem was very high (FPKM) ( Figure 2 At the same time, we used RNA in situ hybridization to verify the specific expression pattern of ZmGG2 in ~2mm young ears ( Figure 2 The primer sequences are shown in Table 1 , primer ID 5). This gene is highly expressed in the early IM, SPM, and SM of the maize ear; therefore, ZmGG2 affects maize traits such as ear length and kernel number per row.

Claims

1. Corn Genes ZmGG2 The application in controlling corn yield, the protein encoded by the gene is shown in SEQ ID NO.2, and the application process is to knock out the corn gene ZmGG2 The expression of improves corn yield, and the knockout adopts the CRISPR / Cas9 system. The protein translated from the knocked-out gene has no original function or cannot be translated into protein.

2. The use according to claim 1, characterized in that: The target sites of gRNA in the CRISPR / Cas9 system are GCTTCTCTAGTCCCGAACA and CCTTGAGGAAGTCGATCTCGG.

3. The use according to claim 1, wherein: The ZmGG2 The gene is shown in SEQ ID NO.

1.

4. The use according to claim 1, characterized in that: The corn yield is controlled by controlling the number of ear rows and / or ear weight.

Citation Information

Patent Citations

  • Application of corn gene ZmEREB102 in improvement of corn yield

    CN113004383A

  • New application of upright dense cluster genes in improvement of utilization efficiency of nitrogen fertilizer

    CN102174527A

  • Application of corn gene ZmGG1 in control of corn yield

    CN119242690A

  • Application of corn gene ZMM3 in control of corn yield

    CN120350061A