Method for creating disease-resistant grass carp based on smd3 gene editing and application

Abstract

The invention belongs to the technical field of aquatic organism breeding, and discloses a method for creating a novel grass carp germplasm capable of resisting infection of grass carp hemorrhagic disease virus (grass carp reovirus type II GCRV-II) based on a smd3 gene editing technology and application of the novel grass carp germplasm. Gene editing is carried out on wild grass carp by taking the smd3 gene as a target gene, an F0-generation chimera with the smd3 gene knocked out is selected to carry out a GCRV-II challenge experiment, and the experiment result shows that the smd3 knocked-out chimera of the grass carp has high GCRV-II virus infection resistance, so that a method is provided for genetic improvement of virus infection resistance of economic fishes such as the grass carp and the like. The method has important industrial application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of aquatic biological breeding, and specifically relates to a method and application of creating disease-resistant grass carp based on smyd3 gene editing technology. Background Art

[0002] Grass carp is the freshwater fish with the highest aquaculture output in my country. It is known as the fish that "feeds half of China". It has made important contributions to improving people's dietary structure and providing protein sources. According to the 2024 "China Fisheries Statistical Yearbook", the total output of grass carp in my country in 2023 will reach about 5.9413 million tons, accounting for about 17.4% of the total output of freshwater fish. However, with the expansion of grass carp farming and the increase in output, viral diseases have become one of the main bottlenecks for the healthy breeding of grass carp.

[0003] Grass carp hemorrhagic disease is a highly contagious and lethal viral disease that has been classified as a Class II animal disease by the Ministry of Agriculture and Rural Affairs of China. Its pathogen is grass carp reovirus (GCRV). GCRV is the first fish virus isolated and identified in my country. It is a 20-sided spherical particle containing 11 fragments of double-stranded RNA. It is divided into GCRV-I, GCRV-II and GCRV-III types according to genome information and biological characteristics. Among them, GCRV-II is the most popular and most harmful GCRV type in recent years and is the most prevalent strain in my country. Grass carp hemorrhagic disease frequently occurs in one-year-old grass carp and has the characteristics of rapid onset, rapid infection and high mortality rate, causing huge economic losses to my country's grass carp farming industry every year. However, due to the unclear infection mechanism of GCRV-II, there is currently no efficient prevention and control method for GCRV-II. Therefore, using modern technology to create new disease-resistant grass carp germplasm will fundamentally enhance the fish's disease resistance, reduce economic losses, and has important application value. Summary of the invention

[0004] The object of the present invention is to provide a method for creating a new grass carp germplasm resistant to grass carp reovirus type II (GCRV-II) infection based on smyd3 gene editing technology.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] A method for creating a disease-resistant grass carp includes targeted knockout of the smyd3 gene of the grass carp, so that the smyd3 gene cannot encode a protein or the encoded protein no longer performs the original function. Preferably, the smyd3 gene of the grass carp is knocked out using CRISPR / Cas9 editing technology, the target site sequence is 5'-GCAGAATGCATACGGGTCGC-3', the Cas9 protein and the gRNA targeting the smyd3 gene are mixed and microinjected into the fertilized eggs of the grass carp at the I-cell stage, and the F0 generation chimeras with smyd3 gene knockout are screened by genotype detection.

[0007] The F0 generation chimera with smyd3 gene knockout constructed by the above method has the effect of resisting grass carp reovirus type II (GCRV-II) infection. The F0 generation chimera with smyd3 gene knockout was subjected to GCRV-II virus challenge experiment. Through phenotypic observation and death time recording, it was found that the smyd3 knockout chimera had fewer bleeding symptoms and higher survival rate than the wild type; by detecting the expression of antiviral genes (ifn1, isg15, mx2) and viral genes (VP35, VP56) in grass carp tissues, it was found that the expression level of antiviral genes in the smyd3 knockout chimera was significantly enhanced, and the replication level of GCRV-II virus was significantly inhibited. Therefore, the grass carp smyd3 knockout chimera has significantly enhanced resistance to GCRV-II, and is an ideal new germplasm of grass carp that resists viral infection.

[0008] The present invention is the first to perform gene editing on the smyd3 gene of grass carp and obtain an F0 generation chimera with a knockout effect. The smyd3 knockout chimera grass carp has a strong ability to resist grass carp reovirus type II (GCRV-II) infection, which provides a method for the genetic improvement of grass carp resistance to viral infection and has important industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 This is an information graphic on grass carp smyd3 gene knockout.

[0010] Figure 2 The bleeding of smyd3 knockout chimera grass carp after GCRV-II virus infection. Wild type indicates wild-type grass carp, and smyd3 KO chimera indicates smyd3 knockout chimera grass carp (the same below).

[0011] Figure 3 Survival rate of smyd3 knockout chimera grass carp after GCRV-II virus infection.

[0012] Figure 4The expression of antiviral related genes (ifn1, isg15, mx2) in liver and intestinal tissues of smyd3 knockout chimera grass carp after GCRV-II virus infection. UI indicates uninfected with GCRV-II, and GCRV-II indicates GCRV-II infected group.

[0013] Figure 5 This is the expression of viral genes (GCRV-II-VP35, GCRV-II-VP56) in multiple tissues of smyd3 knockout chimeric grass carp after GCRV-II virus infection. DETAILED DESCRIPTION

[0014] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand. The technical solutions of the present invention, unless otherwise specified, are conventional solutions in the art; the reagents or materials, unless otherwise specified, are all from commercial channels.

[0015] Example 1 Creation of smyd3 gene-edited grass carp germplasm

[0016] 1.1 Design of gRNA target sites

[0017] According to the grass carp smyd3 sequence information, the optimal knockout site was designed and screened. The smyd3 gene sequence in this embodiment was downloaded from the NCBI database, with a sequence number of XP_051723627.1, and the target site was located on the first exon of the smyd3 gene (e.g. Figure 1 The target site sequence is: 5'-GCAGAATGCATACGGGTCGC-3'.

[0018] 1.2 In vitro synthesis and purification of gRNA

[0019] pUC19-gRNA vector (https: / / www.addgene.org / 137776 / ) was used to amplify sgRNA, and the primers were F: 5'-GTAATACGACTCACTATAGGCAGAATGCATACGGGTCGCGTTTTAGAGCT AGAAATAGC-3', R: 5'-AAAAGCACCGACTCGGTGCC-3'. The PCR system was: I5 DNA polymerase (purchased from MCLAB, item number I5HM-OEM) 20μl, F primer (concentration of 10μΜ) 1.6μl, R primer (concentration of 10μΜ) 1.6μl, ddH2O 15.8μl, gRNA plasmid template (concentration of 300ng / μl) 1μl. The PCR reaction conditions were: 98℃ pre-denaturation for 5 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 12 seconds, 72℃ extension for 15 seconds, 35 cycles; 75℃ extension for another 5 minutes. The PCR product was subjected to 1% agarose gel electrophoresis, and the PCR product was purified and recovered after the band size was verified to be correct, and the concentration of the recovered product was detected. According to the instructions of the TranscriptAid T7 High Yield Transcription Kit (Thermo Scientific, USA), gRNA was transcribed in vitro, with a total system of 20 μl, and purified and recovered using the lithium chloride precipitation method. The specific steps of gRNA purification are as follows: add 1μl DNase I to the gRNA in vitro transcription system, incubate in a 37℃ water bath for 15 minutes to remove residual DNA, add 1μl 0.5M EDTA, stop the reaction in a 65℃ water bath for 10 minutes, then add lithium chloride to make the final concentration of lithium chloride in the solution 2.5M, mix well, precipitate the solution at -20℃ or -80℃ for 2 hours or overnight, centrifuge at 16000×g at 4℃ for 20 minutes to collect the precipitate, add 50μl 70% pre-cooled ethanol to wash the precipitate to remove residual salt, centrifuge at 13000×g at 4℃ for 5 minutes to remove ethanol, dry naturally, and add 20μl DEPC water to dissolve the precipitate. Take 1μL to detect RNA concentration, and after checking the quality of gRNA by 1% agarose gel electrophoresis, store it in a -80℃ refrigerator for use.

[0020] 1.3 Microinjection

[0021] The embryos used for grass carp microinjection were obtained by artificial breeding and fertilization of sexually mature grass carp male and female parents. The injection system was prepared by mixing gRNA and Cas9 protein, in which the final concentration of gRNA was 500ng / μl and the final concentration of Cas9 was 400ng / μl. The mixture was injected into the fertilized grass carp eggs spread in a culture dish using a Picoliter Microinjector (Warner, PL-100A, USA). The injection is best completed within 2 hours after the eggs are fertilized. After the injection is completed, the fertilized eggs are placed in an incubation bucket with a water temperature of 23-28°C for incubation.

[0022] 1.4 Screening and identification of smyd3 knockout chimeras in the F0 generation of grass carp

[0023] When the F0 generation of gene-edited grass carp grows up to the point where the tail fin can be cut for identification, PCR detection is performed using identification primers F: 5'-CTTTCATGGCATCACGCACC-3', R: 5'-ACTACGTACGTCATGTCGCC-3'. The correct target sequence is gel-recovered and purified, then linked to T-transfer (TaKaRa, #6011) and subjected to monoclonal sequencing. A grass carp smyd3 gene knockout information diagram is drawn based on the sequencing results ( Figure 1 ) and obtained a grass carp smyd3 chimera with knockout effect.

[0024] Example 2 The ability of smyd3 knockout chimera grass carp to resist GCRV-II virus infection is significantly enhanced

[0025] Wild-type grass carp and smyd3 knockout chimera grass carp with a body length of 3-4 cm were injected intraperitoneally with GCRV-II virus (2.60×10 6 The experimental fish were placed in a constant temperature environment of 28°C, and the status of the grass carp was observed and the number of deaths was counted every day. Photos were taken 5 days after virus infection. Figure 2 As shown in the figure, the red arrow points to the bleeding point of grass carp. The survival of grass carp was counted using GraphPad prism software. The results are shown in the figure. Figure 3 shown.

[0026] The photographic results showed that 5 days after GCRV-II infection, the hemorrhagic symptoms of wild-type grass carp were significantly more severe than those of smyd3 knockout chimera grass carp ( Figure 2 ), and according to Figure 3 From the death curve, we found that all wild-type grass carp died 6 days after GCRV-II infection, while the survival rate of smyd3 knockout chimeric grass carp was still above 75% at this time, indicating that the ability of smyd3 knockout chimeric grass carp to resist GCRV-II virus infection was significantly enhanced.

[0027] Example 3 The expression of antiviral related genes in smyd3 knockout chimera grass carp is significantly enhanced

[0028] Wild-type grass carp and smyd3 knockout chimera grass carp with a body length of 3-4 cm were injected intraperitoneally with GCRV-II virus (2.60×10 6 The experimental fish were placed in a constant temperature environment of 28°C. After 48 hours of virus infection, the fish were dissected, and the liver and intestinal tissues were taken in 1.5 ml centrifuge tubes. RNA was extracted using the Trizol method, and then cDNA was obtained using a reverse transcription kit. According to the instructions of the SYBR Green qPCR mix, real-time fluorescence quantitative PCR was performed to detect the expression of grass carp antiviral related genes (ifn1, isg15, mx2). The internal reference gene was β-actin, and the fluorescence quantitative PCR primer sequences are shown in Table 1. The experimental results are shown in Table 1. Figure 4 shown.

[0029] The experimental results showed that GCRV-II virus can significantly activate the expression of grass carp antiviral-related genes ifn1, isg15, and mx2. At the same time, the expression level of antiviral genes in the liver and intestinal tissues of smyd3 knockout chimera grass carp was significantly higher than that of wild-type grass carp.

[0030] Table 1

[0031]

[0032] Example 4 The replication ability of GCRV-II virus in smyd3 knockout chimera grass carp is significantly inhibited

[0033] Wild-type grass carp and smyd3 knockout chimera grass carp with a body length of 3-4 cm were injected intraperitoneally with GCRV-II virus (2.60×10 6 The experimental fish were placed in a constant temperature environment of 28°C. After 48 hours of virus infection, the fish were dissected and the liver, intestine, gill and heart tissues were collected in 1.5 ml centrifuge tubes. RNA was extracted using the Trizol method, and then cDNA was obtained using a reverse transcription kit. According to the instructions of the SYBR Green qPCR mix, real-time fluorescence quantitative PCR was performed to detect the expression of GCRV-II virus genes (GCRV-II-VP35, GCRV-II-VP56). The sequences of fluorescence quantitative PCR primers are shown in Table 1. The experimental results are shown in Table 1. Figure 5 shown.

[0034] The experimental results showed that the replication ability of GCRV-II in smyd3 knockout grass carp chimeras was significantly inhibited.

Claims

1. A method for producing disease-resistant grass carp, characterized in that: Including targeted knockout of grass carp smyd3 Genes that make smyd3 The gene cannot encode a protein or the encoded protein no longer performs its original function.

2. The method according to claim 1, characterized in that Using CRISPR / Cas9 editing technology to knock out grass carp smyd3 gene, and the target site sequence was 5′-GCAGAATGCATACGGGTCGC-3′.

3. The method according to claim 2, characterized in that Cas9 protein and targeting smyd3 The gRNA of the gene was mixed and microinjected into the fertilized eggs of grass carp at the I-cell stage, and screened by genotyping smyd3 F0 generation chimeras of gene knockout.

4. Use of the method according to any one of claims 1 to 3 in preparing grass carp resistant to grass carp reovirus type II infection.

5. Construct a reagent for grass carp resistant to grass carp reovirus type II infection, characterized in that: Including Cas proteins and targeting smyd3 Gene-specific gRNA.

6. The reagent according to claim 5, characterized in that The targeting sequence of the gRNA is 5'-GCAGAATGCATACGGGTCGC-3'.

Images