A SNP molecular marker for tracing the population of Pseudococcus papaya and its application

Abstract

The present invention discloses a SNP molecular marker for tracing the population of Papaya mealybug and its application. Through simplified genome sequencing and comparison analysis of samples of different geographical origins of Papaya mealybug populations, SNP molecular markers containing specific geographical populations are screened out as identification marks of their geographical population sources, forming a daily detection method that can be applied to population tracing. The SNP molecular markers for tracing the population of Papaya mealybug from 4 countries provided by the present invention can accurately detect the SNP tracing sites of Papaya mealybug populations from China, the United States, Cambodia, Mozambique and Xishuangbanna, and amplification primers for detecting these tracing sites are designed, and the accuracy of the SNP tracing sites is also verified. Routine detection of the traceability of intercepted samples of Papaya mealybug at ports can be realized, providing a basis for solving relevant international trade technical barriers and disputes; and providing a detection technology solution for revealing the propagation and diffusion characteristics of Papaya mealybug populations.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a Pseudococcus papaya population tracing SNP molecular marker and application thereof. Background Art

[0002] At present, the main focus of the molecular routine identification of quarantine pests and diseases implemented at home and abroad is the identification of species, while there is a lack of accurate and rapid detection technology for the identification of genetic differentiation characteristics of infraspecific geographical populations. It is worth noting that for the same biological species, due to the intraspecific genetic differentiation formed by long-term geographical division, on the one hand, genetic differences under the corresponding ecological background conditions (such as biotypes and geographical populations) will be generated. On the other hand, the encounter of different infraspecific units (biotypes and geographical types, etc.) may produce hybrid dominant populations with stronger ecological adaptability than the original geographical populations themselves, and generate new harmful potential. Therefore, the implementation of species identification at the species level cannot accurately identify the geographical genetic differentiation characteristics of species. It is necessary to develop molecular detection and identification technology at the infraspecific level that can be used for the identification of genetic backgrounds of different geographical species, so as to accurately trace the source of their transmission and help solve the problem of traceability of quarantine pests in international trade.

[0003] Prior art related to the present invention 1: Simplified genome sequencing and analysis;

[0004] This technology integrates and analyzes the genetic differentiation characteristics and sources of variation among populations at the genome level by simplifying the genome sequencing of samples from populations of different sources, such as the strain typing and transmission source analysis of the new coronavirus (covid-19) based on the genome sequence, and the rapid expansion mechanism of the invasive weed Mikania micrantha (Liu, Bo; Yan, Jian; Li, Weihua et al. Mikania micrantha genome provides insights into the molecular mechanism of rapid growth. Nature Communications, 2020, 11(1). DOI: 10.1038 / s41467-019-13926-4). The advantage of this technology is that the population typing information is comprehensive and accurate. However, this technology requires the use of second-generation (library construction) or third-generation sequencing technology to sequence and analyze population samples, which is labor-intensive, costly, and time-consuming. It is especially not suitable for routine detection of species with large genome data such as port insects. It is difficult to determine the population source under the condition of a single population sample.

[0005] Prior art 2 related to the present invention: molecular markers based on microsatellites (SSR) and gene fragments (mitochondrial and nuclear genes);

[0006] The technical advantages of using SSR and gene fragments to construct population genetic structure are simple methods and relatively easy operation. It is suitable for the study and analysis of genetic differentiation among multi-sample populations (the more comprehensive the geographical population, the more accurate the results). Through the overall genetic structure analysis of multiple population samples, the population typing results are easy to determine. For example, the genetic structure of geographic populations of Acanthoscelides obtectus Say based on the mitochondrial CO1 gene was analyzed (Oliveira MRC, Corre^aAS, Souza G Ad, Guedes RNC, Oliveira L OD. 2013. Mesoamerican Origin and Pre-and Post-Columbian Expansions of the Ranges of Acanthoscelides obtectus Say, a Cosmopolitan Insect Pest of the Common Bean. PLoS ONE 8(7):e70039). doi:10.1371 / journal.pone.0070039. However, the genetic variation stability of the above molecular markers is poor, and there is a lack of specific population molecular markers. A large number of population samples need to be collected for routine testing, which has poor operability and cannot determine the origin of the population under single sample conditions. Summary of the invention

[0007] In view of the above-mentioned deficiencies in the prior art, the object of the present invention is to provide a SNP molecular marker for tracing the population of P. papaya and its application, and to screen out SNP molecular markers containing specific geographical populations through simplified genome sequencing and comparative analysis of samples of P. papaya populations of different geographical origins as identification marks of their geographical population origins, thereby forming a daily detection method that can be applied to population tracing.

[0008] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:

[0009] A SNP molecular marker for tracing the population of P. papaya is provided. The genotypes of the SNP tracing sites of the populations of P. papaya from four source countries and their detection primers are shown in the following table:

[0010]

[0011]

[0012] Furthermore, by (1) using primers CN07-1 and CN07-3 in South China, genotype TC was obtained, AG was the Chinese population, and the other genotypes were foreign populations;

[0013] (2) The genotypes of the Mozambique population measured by MSBC primers were AA, GG, GG, GG, TT, CC, TT, and the genotypes of other populations were GG, AA, AA, AA, CC, GG, CC;

[0014] (3) After obtaining foreign populations using South China-specific primers, the specific genotypes of the American populations were measured using the American population-specific primer US1, which were CC, AA, and TT. The genotypes of other populations were TT, TT, and CC.

[0015] (4) After obtaining foreign populations using South China-specific primers, the Cambodian population-specific genotypes were measured using Cambodia-specific primers CBM3 as CC, AA, and GG; the genotypes of other populations were GG, GG, and AA;

[0016] (5) Based on the populations obtained in South China, the Xishuangbanna population-specific genotypes were measured using the Xishuangbanna-specific primer XSBN, and the genotypes of the other populations were GG, CC, TT, and AA.

[0017] Provided is an application of a papaya mealybug population tracing SNP molecular marker in identifying and marking the source of the papaya mealybug population.

[0018] Provided is an application of a papaya mealybug population tracing SNP molecular marker in revealing the propagation and diffusion characteristics of the papaya mealybug population.

[0019] The beneficial effects of the present invention are:

[0020] The SNP molecular markers for tracing the papaya mealybug populations from four countries provided by the present invention can accurately detect the SNP tracing sites of the papaya mealybug populations from China, the United States, Cambodia, Mozambique and Xishuangbanna, and amplification primers for detecting these tracing sites are designed, and the accuracy of the SNP tracing sites is also verified. The conventional detection of the tracing of the intercepted samples of the papaya mealybug can be realized at the port, providing a basis for solving relevant international trade technical barriers and disputes; and providing a detection technology solution for revealing the propagation and diffusion characteristics of the papaya mealybug population.

[0021] Description of Figures and Tables

[0022] Figure 1 This is a schematic diagram of the specific mutation sites of papaya mealybug based on the overall genome;

[0023] Figure 2 This is the evolutionary tree of the papaya mealybug population;

[0024] Figure 3 This is a schematic diagram of the verification results of the specific traceability loci (SNPs) of the papaya mealybug population in South China and the populations in the United States and Cambodia;

[0025] Figure 4 This is a schematic diagram of the US1 tracing locus (SNP) of the specific primers for the American population of P. papaya and the verification results of the populations in South China and Cambodia;

[0026] Figure 5 This is a schematic diagram of the verification results of the specific traceability loci (SNPs) of the Cambodian population of P. papaya and the populations in the United States and South China;

[0027] Figure 6 This is a schematic diagram of the traceability loci (SNPs) of the specific primers (reverse primer amplification) of the Xishuangbanna population of P. papaya and the verification results of the populations in South China, the United States, and Cambodia. DETAILED DESCRIPTION

[0028] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0029] Example 1

[0030] In this embodiment, the papaya mealybug samples were derived from 19 samples in 7 regions, and a total of 1,371,047 SNPs sites were obtained, with the quality value of the site being above 30.

[0031] Table 1 Geographical population sample sources and numbers of Pseudococcus papayaensis

[0032]

[0033] Note: SNPs filtering method: (1) Use vcftools software to filter SNPs: remove sites with missing genotypes, --max-missing 1; retain sites with SNPs quality values ​​greater than 30; retain sites with allele number = 2; (2) Screen specific SNPs sites according to position (100% specific SNPs).

[0034] Based on the overall SNP screening of all resequencing population samples, SNP variation sites and their flanking sequences with specific geographical populations were further screened, and amplification primers containing specific SNP variation sites were designed.

[0035] Chinese population (South China) SNP site 1 sequence content:

[0036] ggttgatttgggctatttttgaaattttcaaaaatttgtcaaaattcgccaaaattgtaGACCtttttctacagaataaaccgcAAAAACCTTCTacagtaatttgttggggtcAGACTTAAATTCTACTGTGCTAAAAATCAATCACGATCTTATTCGGAAAATCGCTGTTTTGATCAAGGAAtcgtacatttttcgaataaaattcaattttccgacTACGGTTTGAGTATaagaatttgatattttcttatttgtgaaaattatatgttgagaaattatgattattttcagcaaaaaatggcaacttcgctcaatcaatttttcgactcaAGTTTTTACGGCTTGATCTGAATTTTCCGActgacacaaaaatttaaaatatgcgGGCAAGCTGCCC[T / C / G]CTTGCCCC TCCTTTCGGTCCGGCCCTGGATTTTCGCTTAAGAAAATGCACGTATCTCGG CTCCTGCAAGAGCTTGCACTCAAAATGGATACCGGATTTGT

[0037] Sequence content of SNP locus 2 in Chinese population (South China):

[0038] AATTAACCAATTCGTCatagtaataataattatactaCAATCCCACACCttataatttcgaaaagtttttttacatttgaaacACATTGTCGAACTATTcacgttcagttcagttcGTTCGGCATTTGGTTTGCATAACACCTACACACACTAACGCACGCACACGACTACACCCAAACAAACACGAGAGGGCGAGCGTT[G / A]TGACGTCACCAGACTCGTCACACACAAA TCAAGTTTTGCGAATGTACAACACTGGCACGCACGAACGAAACAAAGTtgcaaaattcaacattttttttttttaaatactaaatacctacatattatattatCTACGTATTACTTATGGCTATGAGTTATATTATGATGTAGCAGGTACgtagaatgaaaataataataat

[0039] SNP locus sequence content of the Mozambique population:

[0040] ACACAAGCAAAAATCCACCCCCAAGAAAGAGTCGAATTTGTTACATAAATCCAGTTGATTTGTATGATTCAAATCGTGAATCCGACCTTCCGAACTGGTAAATttagtttcgaattcgaatttgaaccCATTAAAAGATTGGAATCCTGCCCGATATCGACACTGTTGTtgagtacatataatatgcgagtattatgtacatatgtaggtagctCTACCTATTCATTAGAGAAATCGCTTATTaaagttaggtaggtactcacgTGTATAATTGTTGATGTCGTTTTATAGCCATTATCGTTTTACTGACGAATTCGTCCAGTGCCAAggattttttaatcttcagttcttgaatttttgataaactaCTCGGGACACGTTTTTCCTCCACAGCCAGTTC[G / A]AA[A / G]TTAG TCACTTC[A / G]TCG[A / G]TGCAGAGAAA[C / T]GT[G / C]GGATACGAAGCGCTT[C / T]GAATAAATAAAGCCAAAGACTCGAATCGATTGTAGATGTTCATGGTGA TTACGAAAATCAAAGTTGGGTACGATACCAAGATGACTGTCTCTGGTATGAGGGTTACTGATTGTATGAACCGAATGACTGCGCATAGTAAGAAAGTTTTGCCGAATGGAACGTACATCGGATATATATGGATGAAGTAGTCATCGAAGTGGATGTATTTCTCTAAAGTAGGTGTTTGTGCGCCCAGAAACACTAAGCAGAATATCGCTACGATCGTTAGAACTTCGGATTTGTTTAAATTCCCAGTGCGGAATAAAGCCTCATCCTCGCTCGGAGATGGAGCGAATCCGTCATGTTTGTggtacaaaaattcgaataatttcaaaaataactttcTCATTGTAAAGGTCC

[0041] SNP locus sequence content of the US population:

[0042] ccataaaaggggttaggagggaggtacggagctaaaaatttgtcacgaggttttagaccataagaaccaatttccaccagaaaatttcaaaatccgttctcagggccgattcaccata cttcatgggctatacccttgaaaaaatcaatgttgataaaaaatcaaaatttaaataagaatttaagtgaaaaaactgtaaattgctgaaatgtaattgaaaaaattcacttct cattgaaaatggaaaaaagttgcattgaagttcaatttgaaaaaagagaaaaaaaacaataattgaaTAAACTCAACAAATGggatcgattaatattaaacCATTTtggtttgaa gaaaaaactcaaaaattgaagatctaaatttaaaacag[t / c]aatttctcaattttt[t / a]aaacattttttgcc[c / t]caaaaaattttcgaaaaagcCTCCTCTACAAA CTcttctcaaaaaaaatttgaaaaaaattcccaagcttctgggggaaaaaaatcaatccaaaGTACAACAAACTAATAAACATGTCAAGCGTCATCTCAAAGCTTCCTCATACTGCACAACAACTTGT GTACCATACTATACTCCTCGAATCTAAACCCATCACGTAAACAAGTCCCGTGTAAAACTCGGCGTCGATAAAATCCCCGGTAACTTTTCgtagaataaattttccaataactACATCGAAGTTTAATTTA

[0043] The SNP's headquarters:

[0044] TTCATCTTCGATTCCACATTCGTTGGATCCTCtcttgattttgaaatatccgTGATCGCCCCAATCGGTATTCCATGAGTTTGCCACCAACCAATAAGGCGTGTTTGGTTCTCTACTCTTATCGACACCCCATCCTAAAATCCTGACAGCATGACCGCCCAACAATTTACCTTGAACATGTTGGTAAACACCTgtggaaaagagaaaaatatgattGAGTTGATCGCAGTAgttcaaaacaaaaagaacTCGTTAACGTAAACTTACCCGACTTGTATGTTACGAAATCGCTAAAAACGCTAAATGCTGCTTCAACGGgaccatttttataaatttcttgTTTAATCTGCTCTTCGTTGCTGTCGATGGAGTATGCTTTTTCACCTGAAAAAGTAGTAAACACATACTTAATGAGATACTTCCGATTGATGA[C / G]AAATTGAGAAGA[A / G]AGCGACAGTCAGTTGATTTTAGAAAC[G / A]TTGAGTAttaccaaaatt caaatcatccTTGTACGAAACTGTGTAGCTTGACTGGCATTTCTCTCGACATTTCGGTGTTTTTGTCGAGCCGCTACATGGTGGTCTAGTGCCGTTTGAATGATGTTCGCATGGAGCGATTTCGTAAGGCTGACAACCCTGTACAATAAAAAAGTATACATTCGATAAACGCctattttcaaagattacGGGTATAaacaaggaaattttcaacatgtcaTAAATTACCTCATTCGTTCCGTAGTTACCACCACTAACGATACCAGATCTCACCCAGTATTTCCATGCAGAACCTGGGAAACCACCATTGCATCCGAATCCACACGACCAACAACAGGCTACCAAATTATCAGCCGACAAATGTACATTTTCGGTGCCATTA

[0045] SNP site sequence content of Xishuangbanna population:

[0046] CagacctgaaaattttaacatggATGATGGATCAGTGAAAATgcaactaaaatttcagtcaatttcactgatattttagTAACTTTTCAGTGCTctcatttgttgaaaatcactgatcttCTTCAGTCAGAATGGTAGTACAGTAGCCAATAAGTGaaagaaaatcactgaa attttggtaattttcactgatatttcagtTTTACAGAATCGCTAGTAAAATCACTTAGAAGTTActaaaatatcagtgaaaatcaccaaaattttagtgaaattgactgaaattttagctgtATTTTC[G / A]CTGAT[C / T]CgtgaaatgatcaatttttccagtccGCCA CAGGATGTTCAC[T / C]ATAGGCGGATCTAAGGGTGGGC[A / G]AGGGTGAGT CAGgcccttttaaaattttttttggctcgagCAATCAAAATTAACATTGATACATTTCTAGCATCAAGagctttttgtgaaaattgagcattttgtaaaaatcacaagcaaaaatggaaaatttatgaaattctgtaggaattga aaattttaaaattgtgaaaattggaaaaatggaaaaattctgtaaaaattgaaattttgtagaaatgaaatggaaaaatctgcaaaaatatgtaaaaattgaaaattttaaaattatgtgaaaatgaaaaattTtgtgaaaaattt

[0047] Table 2 Tracing sites and detection primers of Pseudococcus papayaensis populations from four source countries

[0048]

[0049] Table 3 The location of the SNP loci on the chromosome for the traceability of the Pseudococcus papaya population

[0050] SNP loci chromosome Location South China Site 1: [T / C] FIZT01030228.1 512 South China Site 2: [G / A] FIZT01000256.1 3517 Mozambique site 1: [G / A] FIZT01029036.1 1235 Mozambique site 2: [A / G] FIZT01029036.1 1238 Mozambique site 3: [A / G] FIZT01029036.1 1250 Mozambique site 4: [A / G] FIZT01029036.1 1254 Mozambique site 5: [C / T] FIZT01029036.1 1265 Mozambique site 6: [G / C] FIZT01029036.1 1268 Mozambique site 7: [C / T] FIZT01029036.1 1274 US Site 1: [T / C] FIZT01001281.1 400 US Site 2: [T / A] FIZT01001281.1 416 US site 3: [C / T] FIZT01001281.1 432 Cambodia site 1: [C / G] FIZT01000217.1 2976 Cambodia site 2: [A / G] FIZT01000217.1 2989 Cambodia site 3: [G / A] FIZT01000217.1 3016 Xishuangbanna site 1: [G / A] FIZT01034942.1 3724 Xishuangbanna site 2: [C / T] FIZT01034942.1 3730 Xishuangbanna site 3: [T / C] FIZT01034942.1 3773 Xishuangbanna site 4: [A / G] FIZT01034942.1 3796

[0051] Note: Because the reference genome of P. papaya mealybug is not annotated, there is no way to locate the specific functional genes.

[0052] (1) The South China specific primers CN07-1 and CN07-3 can be used to distinguish the South China population from the United States and Cambodia populations. The genotype of the South China population is TC, AG, and the genotype of the United States and Cambodia populations is CC, GG ( Figure 3 ).

[0053] (2) The genotypes of the Mozambique population measured by MSBC primers were AA, GG, GG, GG, TT, CC, TT, and the genotypes of other populations were GG, AA, AA, AA, CC, GG, CC;

[0054] (3) After obtaining foreign populations through South China specific primers, the specific genotypes of the American populations were measured by the American population specific primer US1, which was CC, AA, TT, and the genotypes of other populations were TT, TT, CC ( Figure 4 );

[0055] (4) After obtaining foreign populations using South China-specific primers, the Cambodian population-specific genotypes were measured using Cambodia-specific primers CBM3, which were CC, AA, and GG; the genotypes of other populations were GG, GG, and AA ( Figure 5 );

[0056] (5) Based on the populations in South China, the specific genotypes of the Xishuangbanna population were determined to be AA, TT, CC, GG using the Xishuangbanna specific primer XSBN, and the genotypes of other populations were GG, CC, TT, AA ( Figure 6 ).

[0057] Example 2

[0058] Verify the effectiveness of primer amplification, and expand the population sample with effective primers to verify the authenticity of the SNP locus. Figure 3 shown.

[0059] The SNP molecular markers for tracing the papaya mealybug populations from four countries provided by the present invention can accurately detect the SNP tracing sites of the papaya mealybug populations from China (South China and Xishuangbanna), the United States, Cambodia, Mozambique and Xishuangbanna, and amplification primers for detecting these tracing sites are designed, and the accuracy of the SNP tracing sites is also verified. The conventional detection of the tracing of the intercepted samples of the papaya mealybug can be realized at the port, providing a basis for solving relevant international trade technical barriers and disputes; and providing a detection technology solution for revealing the propagation and diffusion characteristics of the papaya mealybug population.

[0060] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0061] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A SNP molecular marker for tracing the population of Pseudococcus papaya, characterized in that: The genotypes of SNP traceability loci and their detection primers of the four source countries of Papaya mealybug populations are shown in the following table: The location of the SNP loci for tracing the Papaya mealybug population on chromosomes is shown in the following table:

2. The SNP molecular marker for tracing the population of Pseudococcus papaya according to claim 1, characterized in that: (1) Genotype TC was obtained using primers CN07-1 and CN07-3 from South China, AG is from Chinese populations, and other genotypes are from foreign populations; (2) The genotypes of the Mozambique population measured by MSBC primers were AA, GG, GG, GG, TT, CC, TT, and the genotypes of other populations were GG, AA, AA, AA, CC, GG, CC; (3) After obtaining foreign populations using South China-specific primers, the U.S. population-specific primer US1 determined that the U.S. population-specific genotypes were CC, AA, and TT, and the genotypes of other populations were TT, TT, and CC; (4) After obtaining foreign populations using South China-specific primers, the Cambodian population-specific genotypes were measured using Cambodia-specific primers CBM3 as CC, AA, and GG; the genotypes of other populations were GG, GG, and AA; (5) Based on the populations obtained in South China, the Xishuangbanna population-specific genotypes were measured using the Xishuangbanna-specific primer XSBN, which were AA, TT, CC, and GG, and the genotypes of other populations were GG, CC, TT, and AA.

3. An application of the papaya mealybug population tracing SNP molecular marker as claimed in claim 1 or 2 in identifying the source of the papaya mealybug population.

Images