Application of transcription factor ELF1 as intervertebral disc degeneration diagnostic marker

Abstract

The invention discloses application of a transcription factor ELF1 in serving as an intervertebral disc degeneration diagnostic marker, belongs to the technical field of biological medicine, aims to solve the problem of how to realize early diagnosis and individualized treatment of intervertebral disc degeneration, and finds that ELF1 gene expression is related to intervertebral disc degeneration for the first time, and the intervertebral disc degeneration diagnosis marker can be obtained by detecting the ELF1 expression of a subject. According to the method, whether a subject suffers from the intervertebral disc degeneration or not can be judged, or whether the subject has the risk of suffering from the intervertebral disc degeneration or not can be judged, so that a clinician is guided to provide a prevention scheme or a treatment scheme for the subject. According to the present invention, the novel molecular marker ELF1 gene is found, and compared with the traditional detection means, the gene diagnosis is timely, specific and sensitive, and the early diagnosis of the intervertebral disc degeneration can be achieved so as to reduce the death rate of the intervertebral disc degeneration.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of transcription factor ELF1 as a diagnostic marker for intervertebral disc degeneration. Background Art

[0002] Low back pain is the leading cause of disability worldwide, and the annual medical insurance expenditure for the treatment of low back pain is as high as hundreds of billions of dollars, causing a heavy socioeconomic burden. It is generally believed in the academic community that intervertebral disc degeneration (IVDD)-related diseases are the main cause of low back pain. Its incidence is second only to upper respiratory tract infection and has become the second leading cause of outpatient visits. At present, conservative treatment for IVDD mainly focuses on relieving symptoms rather than restoring the degenerated disc to a healthy state. Although traditional surgical treatment can achieve nerve decompression to a certain extent, it inevitably destroys the original integrity and stability of the spine, often leading to complications, and thus reducing the patient's quality of life. Therefore, the current diagnosis and treatment ideas of IVDD should shift to precision treatment based on molecular biological mechanisms, in order to delay the progression of IVDD from the root. How to further elucidate the mechanism of IVDD and develop new treatment strategies has become a current research hotspot and a key issue that needs to be solved urgently.

[0003] Studies have found that the prevalence of IVDD increases dramatically with age, with a 50% difference in the prevalence of intervertebral disc disease between people in their 50s and 70s. Histological studies have shown that intervertebral disc cells begin to age as early as the second decade of life. New evidence from clinical and animal model studies shows that senescent intervertebral disc cells, especially senescent nucleus pulposus (NP) cells, accumulate in aging and degenerated IVDs, which is considered to be a new sign and main cause of IVDD. In recent years, the role of senescent NP cells in IVDD has become increasingly clear, and the relevant literature has also increased. As the main cause of IVDD, the pathogenic mechanism of aging is worthy of exploration and research. IVDD is affected by multiple factors such as mechanical load, inflammatory stimulation, immune damage, and aging, all of which can cause senescence of nucleus pulposus cells. Therefore, intervening in NP cell senescence is an ideal strategy for treating IVDD.

[0004] ELF1 (E74-like factor 1) is a transcription factor belonging to the ETS (Erythroblast Transformation-specific) family. Studies in recent years have shown that ELF1 participates in the development of various diseases by regulating biological processes such as cell proliferation, differentiation, apoptosis, and immune response. ELF1 has been found to function in various organs and tissues such as nerves, brain, kidneys, cardiovascular, and gastrointestinal tract; ELF1 plays an anti-proliferative role in squamous cell carcinoma cell lines; in breast cancer, ELF1 can enhance the proliferation and invasion of breast cancer cells and is associated with lymph node metastasis of breast cancer; abnormal expression of ELF1 is also associated with the occurrence and prognosis of many other tumors such as colorectal cancer, prostate cancer, and lung cancer. However, the role of ELF1 in the field of intervertebral disc degeneration and whether it is involved in the aging process of nucleus pulposus cells have not been reported yet.

[0005] At present, the main methods for treating intervertebral disc are conservative treatment and surgical treatment. Conservative treatment includes resting on a hard bed, massage, traction, acupuncture, etc., which are symptomatic treatments; surgical treatment includes nucleus pulposus removal, spinal fusion, etc., which are also symptomatic treatments, and at the expense of the structure and function of part or all of the intervertebral disc; allogeneic disc transplantation, artificial disc replacement and vertebral fusion have clear disadvantages and defects, and there are reports that such operations have certain risks and perioperative complications, and the failure rate of secondary surgery is as high as 50%. Early diagnosis of the disease can enable more patients to pay attention to the disease at an early stage. Therefore, finding specific molecular markers related to the early diagnosis and prognosis of intervertebral disc degeneration has far-reaching significance for the early diagnosis and individualized treatment of intervertebral disc degeneration. Summary of the invention

[0006] In view of the deficiencies in the prior art, the purpose of the present invention is to provide the use of ELF1 in the diagnosis and treatment of intervertebral disc degeneration based on the study of the function and mechanism of ELF1 in intervertebral disc degeneration. Specifically, the use of ELF1 as a marker and therapeutic target for intervertebral disc degeneration in drugs for the treatment of intervertebral disc degeneration is provided.

[0007] The technical solution of the present invention is as follows:

[0008] The present invention provides the use of an inhibitor of ELF1 gene and / or its expression product in preparing a medicine for treating intervertebral disc degeneration.

[0009] The present invention utilizes ELF1 silencing small interfering RNA to knock down in nucleus pulposus cells and construct ELF1 gene knockout mice. Protein immunoblotting experiments confirm that ELF1 silencing inhibits extracellular matrix destruction of nucleus pulposus cells and inhibits the expression of cell senescence-related proteins, thereby alleviating the aging phenotype. Knocking down ELF1 can rescue the extracellular matrix destruction caused by oxidative stress induced by IL-1β to a certain extent, and can inhibit the senescence phenotype of nucleus pulposus cells by inhibiting senescence-related proteins P16 and P21 to delay intervertebral disc degeneration. Therefore, ELF1 can be used as a molecular therapeutic target for intervertebral disc degeneration.

[0010] Furthermore, the inhibitor includes an agent that inhibits the expression of the ELF1 gene and / or an agent that inhibits the expression product of the ELF1 gene.

[0011] The present invention verifies that knocking down ELF1 can inhibit intervertebral disc degeneration in animals and play a therapeutic role by constructing acupuncture ELF1- / - gene knockout mice.

[0012] The present invention constructs an ELF1 overexpression adeno-associated virus and then conducts an in vivo mouse intervertebral disc injection experiment. The results show that an increase in the expression level of ELF1 accelerates the aging of nucleus pulposus cells and causes intervertebral disc degeneration.

[0013] The present invention also provides a method for screening candidate drugs for treating intervertebral disc degeneration, taking the ELF1 gene as a drug target, and searching for substances that can reduce the expression of the ELF1 gene and / or inhibit the expression of the ELF1 gene expression product as candidate drugs.

[0014] The present invention also provides the use of a product for detecting the expression of the ELF1 gene in preparing a tool for diagnosing degenerative intervertebral disc lesions.

[0015] Furthermore, the products include: products for diagnosing intervertebral disc degeneration by detecting ELF1 gene expression through RT-PCR, real-time quantitative PCR, immunoassay, in situ hybridization, chip or high-throughput sequencing platform.

[0016] Furthermore, the product for diagnosing intervertebral disc degeneration by RT-PCR includes at least one pair of primers for specifically amplifying the ELF1 gene;

[0017] Among them, the product for diagnosing intervertebral disc degeneration by real-time quantitative PCR includes at least one pair of primers for specifically amplifying the ELF1 gene;

[0018] Products used for diagnosing degenerative disc disease using immunoassays include: antibodies that specifically bind to the ELF1 protein;

[0019] Products for diagnosing degenerative disc disease using in situ hybridization include: probes that hybridize to the nucleic acid sequence of the ELF1 gene;

[0020] Products for diagnosing intervertebral disc degeneration using chips include: protein chips and gene chips; wherein the protein chip includes antibodies that specifically bind to the ELF1 protein, and the gene chip includes probes that hybridize to the nucleic acid sequence of the ELF1 gene.

[0021] The product for diagnosing intervertebral disc degeneration by real-time quantitative PCR comprises at least a pair of primers for specifically amplifying the ELF1 gene (GenBank No.: NM 006521.6) as shown in SEQ ID NO.1 and SEQ ID NO.2.

[0022] The primers designed by the present invention can amplify ELF1, and the ELF1 fragment obtained by reverse transcription using the primers can be proved to be a sequence of the ELF1 coding region by first generation sequencing.

[0023] The present invention uses real-time fluorescence quantitative PCR technology to detect the difference in ELF1 expression in nucleus pulposus cells of intervertebral discs with different degeneration degrees, and finds that ELF1 expression increases with the increase in the degree of degeneration, indicating that ELF1 can be used for auxiliary diagnosis of the degree of intervertebral disc degeneration.

[0024] The present invention also provides a tool for diagnosing intervertebral disc degeneration, the tool comprising a reagent for detecting ELF1 gene expression: the reagent comprises a primer and / or a probe for detecting ELF1 gene mRNA, and / or an antibody for detecting ELF1 protein.

[0025] In a specific embodiment of the present invention, the primers for detecting ELF1 gene mRNA include a primer pair shown in SEQ ID NO.1 and SEQ ID NO.2.

[0026] Compared with the prior art, the present invention has the following advantages:

[0027] 1. The present invention discovered for the first time that ELF1 gene expression is related to intervertebral disc degeneration. By detecting the expression of ELF1 in a subject, it is possible to determine whether the subject suffers from intervertebral disc degeneration or whether the subject is at risk of suffering from intervertebral disc degeneration, thereby guiding clinicians to provide prevention or treatment plans to the subject.

[0028] 2. The present invention also discovered a new molecular marker, the ELF1 gene. Compared with traditional detection methods, genetic diagnosis is more timely, more specific, and more sensitive, and can achieve early diagnosis of intervertebral disc degeneration, thereby achieving early prevention and treatment of intervertebral disc degeneration. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1These are immunohistochemical experimental images of ELF1 protein in human nucleus pulposus cells of different degeneration levels, aging indicators P16, P21, and degeneration indicator CollagenⅡ protein.

[0030] Figure 2 This is an immunofluorescence experiment diagram of ELF1 protein, aging indicators P16 and P21 proteins during the replicative aging of human nucleus pulposus cells.

[0031] Figure 3 This is a picture of the protein immunoblotting experiment of ELF1 protein, aging indicator P21 protein and degeneration indicator MMP13 protein during the replicative aging of human nucleus pulposus cells.

[0032] Figure 4 These are the nuclear magnetic resonance imaging experiment pictures, hematoxylin and eosin (HE) staining experiment pictures and safranin fast green staining experiment pictures of the intervertebral discs of naturally aged mice at different age stages.

[0033] Figure 5 This is a tissue immunofluorescence image of the aging indicator P16 protein in the nucleus pulposus tissue of naturally aged mice at different age stages.

[0034] Figure 6 This is the tissue immunofluorescence image of the degeneration indicator CollagenⅡ protein in the nucleus pulposus tissue of naturally aged mice at different age stages.

[0035] Figure 7 This is the tissue immunofluorescence image of ELF1 protein in the nucleus pulposus tissue of naturally aged mice at different age stages.

[0036] Figure 8 This is a protein immunoblot experiment of ELF1 protein, aging indicator P21 protein and degeneration indicator MMP13 protein in the nucleus pulposus tissue of naturally aged mice at different age stages.

[0037] Fig. 9 This is a real-time fluorescence quantitative PCR experimental diagram of the ELF1 gene expression level after ELF1 knockdown.

[0038] Fig.10 This is a protein immunoblot experiment diagram of ELF1 protein, aging indicator P21 protein, degeneration indicator ADAMTS5 protein and cell cycle protein CyclinD1 after ELF1 knockdown.

[0039] Fig.11 This is a picture of the galactosidase senescence staining experiment after adding IL-1β to induce oxidative stress and degenerative environment of nucleus pulposus cells and knocking down the ELF1 gene.

[0040] Fig.12 This is the agarose gel electrophoresis result of ELF1- / - knockout mice;

[0041] Fig.13 This is the sequencing result of ELF1- / - gene knockout mice.

[0042] Fig.14 These are the nuclear magnetic resonance imaging experiment pictures, hematoxylin and eosin (HE) staining experiment pictures and safranin fast green staining experiment pictures of the intervertebral disc of Elf1- / - gene knockout mice at different ages.

[0043] Fig.15 This is the tissue immunofluorescence image of the aging indicator p16 protein in the nucleus pulposus tissue of Elf1- / - gene knockout mice at different ages.

[0044] Fig.16 This is the result of sequencing the mouse E1F1 gene plasmid;

[0045] Fig.17 This is an immunofluorescence experiment diagram of the expression level of ELF1 protein in the nucleus pulposus tissue of the intervertebral disc after different doses of ELF1 adeno-associated virus were injected into the intervertebral disc.

[0046] Fig.18 These are the nuclear magnetic resonance imaging experiment pictures of the intervertebral disc after the ELF1 adeno-associated virus was injected into the intervertebral disc, the hematoxylin and eosin (HE) staining experiment pictures, and the safranin fast green staining experiment pictures. DETAILED DESCRIPTION

[0047] The present invention is further described below in conjunction with specific examples. All data analyses involved in the following examples were statistically analyzed using Graphpad Prism9 software, including t-test, variance analysis, etc. A P value of less than 0.05 indicates statistical significance.

[0048] Example 1

[0049] In this example, the expression of ELF1 in the nucleus pulposus cells of intervertebral discs with different degeneration grades was analyzed by immunohistochemistry using a specific antibody against ELF1 protein to study whether there is a relationship between the degeneration grade and the expression level of ELF1 in the nucleus pulposus cells.

[0050] The experimental method is as follows:

[0051] 1. Collection of human nucleus pulposus tissue specimens

[0052] The present invention collects information (age, gender and degeneration grade) and tissue specimens from patients undergoing intervertebral disc surgery in the Department of Orthopedics of the Affiliated Oriental Hospital of Tongji University. The degree of degeneration of the patients is graded according to the Pfirrmann rating system and lumbar magnetic resonance images, with grades I and II being divided into the control group, and grades III, IV and V being set as the degeneration group.

[0053] 2. Immunohistochemistry

[0054] Place the intervertebral disc nucleus pulposus tissue slices in a 65°C oven for 10 minutes, and then place them in xylene, anhydrous ethanol, 90% ethanol, 75% ethanol and water for five minutes each. This step can remove the paraffin in the tissue slices. Then add trypsin to the slices and incubate at room temperature for 30 minutes for antigen repair. After washing with PBS, add 3% hydrogen peroxide solution and incubate at room temperature for 10 minutes to remove endogenous peroxidase and then wash. Then add goat serum working solution to the tissue to block the tissue, thaw at room temperature for 10 minutes and then shake off the blocking solution. Prepare the primary antibody working solution according to the antibody instructions, add 50ul of working solution to each sample, and incubate overnight at 4°C. The next day, wash the antibody with PBS, add biotin-labeled rabbit / mouse secondary antibody and incubate at room temperature for 10 minutes, and wash. Then add HRP-labeled streptavidin to the tissue, incubate at room temperature for 10 minutes and wash with PBS. Finally, add DAB working solution to the tissue to make the tissue develop color. The color development time is generally 1 to 3 minutes.

[0055] Test results such as Figure 1 As shown in the figure, as the degree of intervertebral disc degeneration gradually increases, the expression level of ELF1 protein in the intervertebral disc also gradually increases, indicating that the expression of ELF1 protein increases in the degenerative environment.

[0056] Example 2

[0057] In this example, primary human nucleus pulposus cells were continuously passaged to construct a replicative aging model. In this model, immunofluorescence experiments were used to detect the expression level of ELF1 protein in aging nucleus pulposus cells to study whether ELF1 is involved in the aging process of nucleus pulposus cells.

[0058] The experimental method is as follows:

[0059] 1. Primary Cell Extraction

[0060] The present invention collects information (age, gender and degeneration grade) and tissue specimens of patients undergoing intervertebral disc surgery in the Department of Orthopedics of the Oriental Hospital Affiliated to Tongji University. The degree of degeneration of the patient is graded according to the Pfirrmann rating system and the lumbar magnetic resonance image, and grades I and II are divided into the control group, and grades III, IV and V are set as the degeneration group. The fresh nucleus pulposus on the operating table is soaked in physiological saline to keep it moist, and the nucleus pulposus is transported to the laboratory within 30 minutes. In the cell clean bench, the nucleus pulposus is washed 3 times with PBS, and the waste liquid is discarded with a Pasteur pipette. Then, the fiber ring and cartilage end plate in the nucleus pulposus are removed with sterile surgical instruments, and the nucleus pulposus is minced into 1cm×1cm×1cm tissue blocks, which are washed 3 times with PBS and then discarded. 50mg of type II collagenase is dissolved in 50ml of DMEM high-glucose culture medium and mixed evenly, and added to a 50ml centrifuge tube together with the minced nucleus pulposus, and placed in a 37°C incubator for digestion for 4 hours. Then centrifuge the tube at 2000 rpm for 5 minutes, discard the supernatant and wash twice with PBS, centrifuge at the same speed for 5 minutes and discard the liquid. Add DMEN high-glucose medium containing 10% fetal bovine serum to the 50ml centrifuge tube to suspend the precipitate in the tube, then transfer to a 10cm cell culture dish and place in a cell culture incubator for culture.

[0061] 2. Cell Immunofluorescence Experiment

[0062] (1) Fix the cells with 4% paraformaldehyde at room temperature for 15 minutes;

[0063] (2) Wash the cells with PBS three times, 5 minutes each time, and discard the PBS;

[0064] (3) Add 0.5% Triton solution and incubate at room temperature for 1 minute to perforate the cell membrane structure and increase permeability;

[0065] (4) Wash the cells again with PBS three times and discard the PBS;

[0066] (5) Dilute the goat serum stock solution 10 times with PBS to prepare a blocking working solution, add the blocking working solution dropwise onto the cells, and block at room temperature for 30 minutes;

[0067] (6) Aspirate the blocking solution (no need to wash);

[0068] (7) Add ELF1 primary antibody working solution to the cells and incubate at 4°C overnight;

[0069] (8) The next day, the primary antibody was washed off with PBS, and the fluorescent secondary antibody was added dropwise and incubated at room temperature in the dark for 1 hour;

[0070] (9) After washing away the fluorescent secondary antibody with PBS, the slides were sealed with a sealing medium containing DAPI nuclear staining reagent;

[0071] (10) The fluorescent slides were observed and photographed under a fluorescent microscope to compare the expression levels of ELF1 protein and senescence proteins P16 and P21 among different generations of nucleus pulposus cells in the replicative aging model.

[0072] The experimental results are as follows Figure 2 As shown, with the continuous increase in the number of nucleus pulposus cell passages, the immunofluorescence results showed that the expression levels of aging proteins P16 and P21 gradually increased, and the expression level of ELF1 protein also gradually increased, indicating that ELF1 plays an important role in the aging process of nucleus pulposus cells.

[0073] Example 3

[0074] In this example, primary human nucleus pulposus cells were continuously passaged to construct a replicative aging model. In this model, protein immunoblotting was used to detect the expression level of ELF1 protein in aging nucleus pulposus cells to further study whether ELF1 is involved in the aging process of nucleus pulposus cells.

[0075] The experimental method is as follows:

[0076] 1. Cell Protein Extraction

[0077] (1) When the nucleus pulposus cells grow to 90% density, wash them once with PBS, dry them, add 300 μl of pre-cooled RIPA cell lysis buffer containing PMSF, scrape the cells with a cell scraper, transfer them to a centrifuge tube, and place them on ice;

[0078] (2) placing the centrifuge tube in a non-contact ultrasonic lysator and lysing it for 5 cycles at maximum intensity, with each cycle lasting 45 seconds;

[0079] (3) Place the centrifuge tube in a 4°C centrifuge and centrifuge at 12,000 rpm for 10 minutes. After the centrifugation, use a pipette to collect the supernatant into another centrifuge tube. The resulting liquid is the protein sample.

[0080] (4) Determine the concentration of protein samples using the BCA kit;

[0081] (5) The protein samples of each group were balanced, added to the loading buffer, mixed well, and heated in a 100°C metal bath for 10 minutes to obtain the protein immunoblotting electrophoresis loading solution;

[0082] 2. Western Blot

[0083] (1) Prepare acrylamide protein electrophoresis gel and TRIS-SDS electrophoresis solution of different concentrations according to the reagent conditions;

[0084] (2) Add the protein loading solution and ladder to the gel and run electrophoresis at 120 V for about 1 hour;

[0085] (3) Install the transfer device, place the gel into the transfer device, and transfer at 300 mA for 90 minutes. The purpose of this step is to transfer the proteins on the gel to the PVDF membrane;

[0086] (4) Take out the PVDF membrane from the device and seal it in 5% skim milk at room temperature for 1 hour;

[0087] (5) Wash the blocked PVDF membrane in TBST three times, 5 minutes each time;

[0088] (6) Cut the PVDF membrane into strips according to the actual situation and incubate with different primary antibodies at 4°C overnight;

[0089] (7) The next day, the strips were removed, washed three times with TBST, and then incubated with the secondary antibody at room temperature;

[0090] (8) After the incubation, wash the strips three times with TBST, and then use an exposure imager to observe the luminescence phenomenon;

[0091] In this example, Western blotting ( Figure 3 ) The results showed that with the continuous aging of nucleus pulposus cells, the expression of extracellular matrix degrading enzyme (MMP13) increased and the aging protein (P21) also continued to increase, further indicating that ELF1 is an important protein that can affect the aging of nucleus pulposus cells and the metabolism of extracellular matrix.

[0092] Example 4

[0093] In this example, a natural aging intervertebral disc degeneration model was constructed using aged mice of different months, the expression level of ELF1 protein in intervertebral disc degeneration was further verified in the animals, and whether ELF1 was involved in intervertebral disc degeneration and the aging process of nucleus pulposus cells was further studied.

[0094] The experimental method is as follows:

[0095] 1. Nuclear Magnetic Resonance Analysis

[0096] (1) A 3.0T MRI scanner (PHILIPS-Achieva 3) was used to examine the extent of intervertebral disc degeneration in C57 mice at three ages (2 months, 12 months, and 24 months).

[0097] (2) Disc measurement by quantitative T2 mapping in sagittal MRI. The midsagittal plane of the disk was evaluated by drawing contour lines in the region of interest (ROI) using the Picture Archiving and Communication System program (an imaging system that can quickly read MRI and has processing and measurement functions). The mean gray value of the ROI was analyzed using axial T2-weighted MRI.

[0098] 2. Hematoxylin and eosin staining (HE staining)

[0099] The mouse intervertebral disc slices were placed in a 65°C oven for 10 minutes, and then placed in xylene, anhydrous ethanol, 90% ethanol, 75% ethanol and water for five minutes each. The slices were then subjected to the next step of hematoxylin staining for 10 minutes, and then soaked in natural water until the cell nuclei appeared blue. The slices were soaked in eosin dye for 1 minute and then washed in running boiled water for 1 minute. Then, they were placed in 75% ethanol, 90% ethanol, anhydrous ethanol and xylene for 5 minutes each, and neutral resin was added to seal the slices after the slices were air-dried.

[0100] 3. Safranin Fast Green Staining

[0101] (1) Delipidation: The tissue sample to be stained is removed and the lipid substances therein are removed. Common methods include using organic solvents such as methanol to remove lipids.

[0102] (2) Fixation: Use an appropriate fixative, such as formalin, to fix tissue samples to maintain the morphological structure of cells and prevent their degeneration.

[0103] (3) Acid staining: The tissue sample is acid-stained, mainly using safranin dye. Safranin dye can bind to nucleic acid molecules and specifically stain the cell nucleus.

[0104] (4) Staining with alkaline dyes: After the tissue sample has been acid-stained, it is stained with alkaline dyes, most commonly fast green dyes. Solid dyes can bind to proteins in the cytoplasm and specifically stain the cytoplasm.

[0105] (5) Cleaning and sealing: The stained tissue samples are cleaned to remove excess dye, and then the tissue samples are sealed on glass slides for observation and preservation.

[0106] 4. Immunofluorescence Staining

[0107] According to the immunofluorescence staining method in step 2 of Example 2, immunofluorescence staining of p16, CollagenⅡ and E1F1 proteins was performed on the intervertebral discs of mice at different age stages in this example.

[0108] 5. Cell Protein Extraction

[0109] According to the cell protein extraction method in step 1 of Example 3, protein extraction was performed on the intervertebral discs of mice at different age stages in this example.

[0110] 6. Western Blot

[0111] According to the protein immunoblotting extraction method in step 2 of Example 3, the expression levels of the aging indicator P16, the degeneration indicator MMP13 and the ELF1 protein were detected in the intervertebral discs of mice at different age stages in this example.

[0112] In this example, nuclear magnetic resonance analysis first confirmed that the degree of intervertebral disc degeneration gradually increased with the increase of mouse age, and HE staining and safranin fast green staining further confirmed the successful construction of the intervertebral disc degeneration aging model from a histological perspective ( Figure 4 ), immunofluorescence staining confirmed that the expression level of aging protein P16 gradually increased in aging intervertebral discs ( Figure 5 ), the degeneration index CollagenⅡ gradually decreased ( Figure 6 ), and the expression of EIF1 protein gradually increased in the aged intervertebral disc ( Figure 7 Western blotting confirmed that the expression levels of aging protein P16 and degeneration protein MMP13 gradually increased in aging intervertebral discs, and the expression of ELF1 protein also gradually increased in aging intervertebral discs ( Figure 8 ).

[0113] Example 5

[0114] In this example, ELF1 small interfering RNA was constructed to knock down ELF1 in nucleus pulposus cells to verify its effect on aging proteins and degenerative proteins; IL-1β was used to induce oxidative stress and degenerative environment in nucleus pulposus cells and then knock down the EIF1 gene to verify its effect on nucleus pulposus cell aging.

[0115] The experimental method is as follows:

[0116] 1. Construction of ELF1 knockout nucleus pulposus cell line

[0117] (1) Incubate the nucleus pulposus cells in a 37°C, 5% CO2 incubator until the logarithmic growth phase.

[0118] (2) Nucleus pulposus cells were seeded in 96-well or 24-well culture plates to ensure that the cell density reached 50%-70% during transfection.

[0119] (3) Dilute siRNA to the desired concentration using serum-free Opti-MEM medium. In a 96-well plate, use a final siRNA concentration of 5-10 nM. The volume of siRNA added to each well is usually 5-10 μl.

[0120] (4) Dilute Lipo3000 reagent using serum-free Opti-MEM medium. Use 0.2-0.5 μl Lipo3000 per well in a 96-well plate to mix siRNA and Lipo3000.

[0121] (5) In a new Eppendorf tube, mix the diluted siRNA and Lipo3000 reagent in a 1:1 ratio. Mix gently and incubate at room temperature for 10-20 minutes to form a transfection complex.

[0122] (6) Remove the culture medium from the culture plate and wash the cells once with serum-free Opti-MEM medium.

[0123] (7) Add an appropriate amount of serum-free Opti-MEM medium (for example, 100 μl per well of a 96-well plate and 500 μl per well of a 24-well plate).

[0124] (8) Gently add the prepared transfection complex to each well and shake gently.

[0125] (9) Incubate in a 37°C, 5% CO2 incubator for 4-6 hours.

[0126] (10) After the incubation, add an appropriate amount of complete culture medium containing 10% FBS and 1% P / S.

[0127] 2. RNA Extraction, Reverse Transcription, and PCR

[0128] (1) When the nucleus pulposus cells are cultured to 90% in a 10 cm culture dish, the medium is discarded and the cells are washed once with PBS and then dried. 1 ml of Trizo1 lysis buffer is added, and the cells are scraped off with a cell scraper, transferred to a centrifuge tube and placed on ice;

[0129] (2) Add one-fifth volume of chloroform to the centrifuge tube, shake vigorously for 10 seconds, let stand at room temperature for 10 minutes, and then centrifuge at 12000g for 15 minutes at 4°C. This process inhibits RNase activity and denatures proteins;

[0130] (3) After centrifugation, the liquid is divided into three layers. Use a pipette to absorb the upper aqueous phase (rich in RNA) and transfer it to a new centrifuge tube. Then add an equal volume of isopropanol, shake vigorously for 10 seconds, and let it stand at room temperature for 10 minutes. This process can absorb the water around the RNA, which is convenient for the next step of washing and precipitation;

[0131] (4) Centrifuge at 12000g for 10 minutes at 4°C, discard the liquid, leaving the RNA precipitate, add pre-cooled 75% ethanol solution to wash the RNA, and centrifuge at 7500g for 5 minutes;

[0132] (5) Repeat the steps of discarding the liquid, washing and centrifuging in (4);

[0133] (6) Aspirate the ethanol solution and add 25 μl of DEPC water to dissolve the RNA when the RNA in the tube is air-dried to a translucent state. The total RVA of the cells can be obtained and stored at -80°C.

[0134] (7) After mixing the RNA solution, pipette 1 μl of the solution into a Nanodrop spectrophotometer to measure the total RNA concentration in the RNA solution.

[0135] (8) Prepare the reverse transcription system in a centrifuge tube. Each 10ul system contains 500ng of RNA and 2ul of reverse transcriptase. The remaining volume is made up with DEPC water:

[0136] (9) Set the degree of reverse transcription, react at 37°C for 15 minutes, react at 85°C for 5 seconds, and finally stabilize at 4°C. The reverse transcription product obtained is cDNA, which has better stability than RNA and can be stored at 4°C for a long time;

[0137] (10) If fluorescence quantitative PCR detection is performed, the system required for fluorescence quantitative PCR needs to be prepared. In a 20ul system, add 0.4u1 of positive chain primer, 0.4u1 of antisense chain primer, 2u1 of CDNA diluent, 10ul of SYBR green dye and 3.6u1 of DEPC water; the primer information is as follows:

[0138] Sense strand primer: 5'TGTCCAACAGAACGACCTAGT-3' (SEQ ID NO. 1);

[0139] Antisense strand primer: 5'GGCAGGAAAAATAGCTGGATCAC-3 (SEQ ID NO. 2).

[0140] After the system is mixed, it is added to a 96-well plate or a 384-well plate and placed in a fluorescent quantitative PCR instrument for amplification detection.

[0141] The amplification procedure used a two-step method, that is, the first stage was pre-denaturation at 95°C for 30 seconds, the second stage was denaturation at 95°C for 10 seconds and annealing at 60°C for 30 seconds, and a total of 40 cycles. The relative expression level of ELF1 was calculated based on the final CT value of ELF1 and the CT value of the housekeeping gene.

[0142] (11) If the product is sent for first-generation sequencing after ordinary PCR, first prepare the ordinary PCR system, that is, a 50u1 system containing 25u1 of 2×Taa enzyme, 2u1 of positive chain primer, 24ul of antisense chain primer, and 2u1 of CDNA solution, and the remaining volume is filled with DEPC water. Then mix the system and place it in a PCR instrument for amplification. The program is set as follows: the first stage is 95℃ pre-denaturation for 3 minutes; the second stage is 95℃ treatment for 15 minutes, 60℃ treatment for 15 seconds, and 72℃ treatment for 12 seconds as one cycle, a total of 45 cycles; the third stage is 72℃ extension for 5 minutes. The obtained product can be used for first-generation sequencing.

[0143] 3. Detection of the positive rate of senescent cells

[0144] The percentage of senescent cells was detected by SA-β-gal staining. SA-β-gal accumulated in senescent cells and stained positive. First, fix the cells at room temperature for 15 minutes. Then wash the cells three times with PBS, 3 minutes each time. Aspirate PBS and add 1 ml of staining working solution to each well. Incubate overnight in a 37°C water bath and observe and take pictures under an optical microscope. The results showed that the SA-β-gal staining positive rate of cells after knockdown of ELF1 was lower than that of the control group.

[0145] In this example, the knockout efficiency of ELF1 small interfering RNA was first verified ( Fig. 9 ), and the expression levels of aging indicator P21 protein and degeneration indicator ADAMTS5 protein were significantly reduced after ELF1 knockdown, while the expression level of cell cycle protein CyclinD1 was significantly increased ( Fig.10 ). After adding IL-1β to induce oxidative stress and degenerative environment of nucleus pulposus cells, the number of senescent cells was significantly reduced after knocking down the ELF1 gene ( Fig.11 ). The above results indicate that reducing the expression of ELF1 can inhibit the senescence of nucleus pulposus cells and promote their proliferation.

[0146] Example 6

[0147] In this example, ELF1- / - knockout mice were constructed to further observe the effect of ELF1 knockout on intervertebral disc degeneration.

[0148] 1. Construction of ELF1- / - knockout mice

[0149] (1) gRNA target sequence

[0150] gRNA-A1:CTGGTCCTCTGGTAACAGCAGG

[0151] gRNA-A2:TAGTATCGATAGAGGCCGGGAGG

[0152] gRNA-B1:AATCTGACGTGGTGGGCACGTGG

[0153] gRNA-B2:GCCTCTCACTGGGTTTTAACTGG

[0154] (2) Primer design strategy: F1 / R1 amplifies the target gene after deletion, and obtaining a 647 bp fragment indicates successful targeting.

[0155] (3) PCR experimental conditions:

[0156] Primer Information:

[0157] F1:5'-TCATCCTAAAGGAGGACAGCAG-3'

[0158] R1:5'-CCATACATAGCCTCACATACCACTG-3'

[0159] Positive band: 647bp Wild type band: 6424bp

[0160] PCR reaction system: (Premix Taq Polymerase: Vazyme, P222 is recommended)

[0161]

[0162] (4) PCR identification results: Mice No. 2, 6, 8, 10, 11, and 19 were positive after the target gene was deleted. The agarose gel electrophoresis results are as follows: Fig.12 shown.

[0163] (5) Sequencing results are as follows Fig.13 shown.

[0164] 2. According to the nuclear magnetic resonance analysis method in step 1 of Example 4, a 3.0T MRI scanner was used to examine the water content of the nucleus pulposus tissue of WT wild-type and ELF1- / - knockout C57 mice at three age stages (2 months, 10 months, and 18 months).

[0165] 3. The pathological changes of intervertebral disc degeneration tissues of WT wild-type and ELF1- / - knockout C57 mice were detected according to the hematoxylin and eosin staining (HE staining) method in step 2 of Example 4.

[0166] 4. According to the safranin fast green staining method in step 3 of Example 4, the content and distribution of proteoglycan in the intervertebral disc matrix of WT wild-type and ELF1- / - knockout C57 mice were detected.

[0167] 5. According to the safranin fast green staining method in step 3 of Example 4, the content and distribution of proteoglycan in the intervertebral disc matrix of WT wild-type and ELF1- / - knockout C57 mice were detected.

[0168] 6. According to the immunohistochemical fluorescent staining method in step 2 of Example 2, the intervertebral discs of WT wild-type and ELF1- / - knockout C57 mice in this example were stained for aging protein P16.

[0169] In this example, we found that the degree of intervertebral disc degeneration in WT wild-type C57 mice gradually increased with age, while the degree of intervertebral disc degeneration in ELF1- / - knockout C57 mice of the same age was significantly reduced ( Fig.14 ), indicating that reducing the expression of ELF1 can significantly alleviate intervertebral disc degeneration. In addition, the results of immunofluorescence staining showed that compared with WT wild-type C57 mice of the same age, the expression of senescence proteins in the nucleus pulposus tissue of ELF1- / - knockout C57 mice was significantly reduced ( Fig.15 ), which proves that reducing the expression of ELF1 can significantly delay the senescence of nucleus pulposus cells and thus alleviate intervertebral disc degeneration.

[0170] Example 7

[0171] Based on the effectiveness of the in vivo experiment, in this example, ELF1 overexpression adeno-associated virus was injected into the intervertebral disc of young mice to verify the in vivo effect of ELF1 overexpression on intervertebral disc degeneration.

[0172] 1. AAV packaging of mouse EIF1 gene overexpression

[0173] (1) Mouse_E1F1 plasmid sequence report

[0174] ① Plasmid sequencing results are as follows Fig.16 As shown;

[0175] ②Sequence:

[0176]

[0177] (2) Mouse_E1F1 adeno-associated virus packaging and titer determination

[0178] 1) Adeno-associated virus packaging

[0179] ① AAVPro-293T cell division: One day before transfection, subculture the cells in good condition into 10 cm culture dishes at an appropriate ratio, and prepare for transfection when the cell density reaches 80% to 90%.

[0180] ② Change medium before transfection: Replace the cells with fresh culture medium 1 to 2 hours before transfection.

[0181] ③ Transfection: Take a sterile 15mL centrifuge tube and the transfection system / plate is as follows:

[0182]

[0183] ④ After mixing, place at room temperature for 15-20 minutes, add evenly to the culture dish in which the liquid has been changed in advance, and then place in a CO2 incubator for culture.

[0184] ⑤ Change medium: 6 to 8 hours after transfection, carefully aspirate the cell culture medium and discard it in a waste liquid cup filled with disinfectant, and replace the medium after AAVPro-293T Cell Line transfection.

[0185] ⑥ Add Enhancing buffer: After replacing the culture medium after AAV Pro-293T Cell Line transfection, evenly add 100×Enhancing buffer to promote transfection, 100μL / dish.

[0186] ⑦ Virus collection: Collect cells and cell supernatant 72 hours after transfection for subsequent concentration and purification.

[0187] 2) Adeno-associated virus purification

[0188] ① Virus concentration and purification: The cell suspension was repeatedly transferred between a dry ice foam box containing ethanol and a 37°C water bath, and freeze-thawed three times. Centrifuged at 4000 rpm for 10 min.

[0189] ② Transfer the supernatant after centrifugation to an ultracentrifuge tube and centrifuge at 10WG for 2 hours.

[0190] ③ Add Benzonase at a final concentration of 50 U / mL and MgCL at a final concentration of 0.002 M, incubate at 37°C for 20 min.

[0191] ④ Filter with a 0.22 μm filter and transfer the supernatant to a horizontal ultracentrifuge tube.

[0192] ⑤ Prepare 60%, 40%, 25%, and 15% iodixanol, and lay out a gradient. The gradient order is: 60% iodixanol, 40% iodixanol, 25% iodixanol, 15% iodixanol, and balance.

[0193] ⑥27.5WG, 4℃, centrifuge for 4h.

[0194] ⑦ Transfer to a 50KD ultrafiltration tube, centrifuge at 4500rpm to the required virus amount, and discard the waste liquid at the bottom.

[0195] ⑧Virus packaging and storage.

[0196] ⑨After the virus is divided into packages, store it in a -80℃ refrigerator.

[0197] 3) Adeno-associated virus titer determination

[0198] The number of AAV viral particles was determined by quantitative PCR to detect the genome copy number of the AAV vector in the genome.

[0199] ① Prepare samples and standards, 10-fold gradient dilution of standard plasmid: original concentration, 10-1, 10-2, 10-3, 10-4, 10-5; 10-fold gradient dilution of the sample to be tested: 10-2, 10-4, 10-5, 10-6, 10-7. Calculate the total volume of the reaction tube according to the number of reactions (X) (two replicates are made for each gradient above).

[0200] ②The volumes of the components in the PCR system are as follows:

[0201]

[0202] PCR reaction conditions:

[0203]

[0204]

[0205] Experimental results:

[0206]

[0207] in conclusion:

[0208] In summary, the titer results are shown in the following table, indicating that the adeno-associated virus was packaged successfully:

[0209]

[0210] 2. Intra-discal Injection of Elf1 Overexpressing Adenovirus into the Mouse Coccygeal Intervertebral Disc

[0211] After the mice were anesthetized by intraperitoneal injection of sodium anisobarbital solution, the mice were placed in a prone position and located with a black marker at the 7th / 8th caudal disc (the disc between the 7th and 8th caudal vertebrae). Different doses of ELF1 overexpression adenovirus (1u1, 3u1, 5u1) were drawn with a microinjector and injected into the mouse intervertebral disc, then pulled out, and the skin was disinfected with iodine solution again.

[0212] 3. The intervertebral discs of mice injected with Elf1 overexpressing adenovirus were stained for Elf1 protein according to the immunohistochemical fluorescent staining method in step 2 of Example 2.

[0213] 4. According to the nuclear magnetic resonance analysis method in step 1 of Example 4, a 3.0T MRI scanner was used to examine the water content of the nucleus pulposus tissue of mice injected with different doses of ELF1 overexpression adenovirus (1u1, 3u1, 5u1).

[0214] 5. According to the hematoxylin and eosin staining (HE staining) method in step 2 of Example 4, the pathological changes of intervertebral disc degeneration tissue in mice with different doses of ELF1 overexpression adenovirus (1u1, 3u1, 5u1) were detected.

[0215] 6. According to the safranin fast green staining method in step 3 of Example 4, the content and distribution of proteoglycan in the intervertebral disc matrix of mice infected with different doses of ELF1 overexpressing adenovirus (1u1, 3u1, 5u1) were detected.

[0216] In this case, we used the results to indicate that ELF1 overexpression adenovirus was injected into the mouse intervertebral disc. After ensuring that Elf1 overexpression was successful ( Fig.17 ), the results showed that overexpression of ELF1 could destroy the homeostasis of extracellular matrix in the intervertebral disc and reduce the abundance of extracellular matrix. As the expression level of ELF1 gradually increased, the degree of intervertebral disc degeneration gradually increased ( Fig.18 ).

Claims

1. Use of an inhibitor of the ELF1 gene and / or its expression product in the preparation of a drug for treating intervertebral disc degeneration.

2. The use according to claim 1, characterized in that: The inhibitor includes an agent that inhibits the expression of the ELF1 gene and / or an agent that inhibits the expression product of the ELF1 gene.

3. A drug for treating intervertebral disc degeneration, characterized in that: The drug includes an inhibitor of the ELF1 gene and / or its expression product; Wherein, the inhibitor includes an agent that inhibits the expression of the ELF1 gene and / or an agent that inhibits the expression product of the ELF1 gene.

4. A method for screening candidate drugs for treating intervertebral disc degeneration, characterized in that: Taking the ELF1 gene as a drug target, substances that can reduce the expression of the ELF1 gene and / or inhibit the expression of the ELF1 gene expression product are sought as candidate drugs.

5. Application of products for detecting ELF1 gene expression in the preparation of tools for diagnosing intervertebral disc degeneration.

6. The use according to claim 5, characterized in that: The products include: products for diagnosing intervertebral disc degeneration by detecting ELF1 gene expression through RT-PCR, real-time quantitative PCR, immunoassay, in situ hybridization, microarray or high-throughput sequencing platforms; Among them, the product for diagnosing intervertebral disc degeneration by RT-PCR includes at least one pair of primers for specific amplification of the ELF1 gene: The product for diagnosing intervertebral disc degeneration by real-time quantitative PCR includes at least one pair of primers that specifically amplify the ELF1 gene: Products used for diagnosing degenerative disc disease using immunoassays include: antibodies that specifically bind to the ELF1 protein; Products that use chips to diagnose intervertebral disc degeneration include: protein chips and gene chips: among them, the protein chip includes antibodies that specifically bind to the ELF1 protein, and the gene chip includes probes that hybridize with the nucleic acid sequence of the ELF1 gene.

7. The use according to claim 6, characterized in that: The product for diagnosing intervertebral disc degeneration by real-time quantitative PCR comprises at least a pair of primers for specifically amplifying the ELF1 gene.

8. A tool for diagnosing intervertebral disc degeneration, characterized in that: The kit includes a reagent for detecting the expression of the ELF1 gene.

9. The tool according to claim 8, characterized in that The reagents include primers and / or probes for detecting ELF1 gene mRNA, and / or antibodies for detecting ELF1 protein.

10. The tool according to claim 9, characterized in that The primer pair for detecting ELF1 gene mRNA.

Images