Genetically engineered bacterium for efficiently synthesizing ectoine and construction method of genetically engineered bacterium

Abstract

The invention relates to a genetically engineered bacterium for efficiently synthesizing ectoine and a construction method of the genetically engineered bacterium. The genetically engineered bacterium comprises a related protein degradation tag, an expression vector and a construction method of the expression vector. According to the invention, a protein degradation tag is added to regulate and control a diaminopimelate decarboxylase gene lysA and a homoserine dehydrogenase gene metL, and meanwhile, an exogenous gene cluster ectABC is introduced to construct an expression path of ectoine in a host cell so as to realize de novo synthesis of ectoine. By means of the construction method, the content of essential amino acid needed by life metabolism of thalli is guaranteed, growth of the strains is promoted and affected, and the purpose of high yield of ectoine is achieved. The amino acid sequence of the protein degradation tag is mutated on the basis of regulation and control of the protein degradation tag, and it is found that the mutated protein degradation tag is more beneficial for increasing the yield of ectoine.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and fermentation engineering, and in particular to a genetic engineering bacterium for efficiently synthesizing ectoine and a construction method thereof. Background Art

[0002] Ectohydropyrimidine is an amino acid derivative found in microorganisms, specifically a cyclic amino acid. Ectohydropyrimidine mainly exists in moderately halophilic bacteria, such as Halomonas Elongata, and non-halophilic bacteria such as Streptomyces and Escherichia coli. As a natural substance with multiple biological and medical effects, ectohydropyrimidine has broad application prospects in the fields of cosmetics, skin care products, and medicine.

[0003] At present, there are two main methods for the synthesis of ectoine: chemical synthesis and biosynthesis. There are many problems with chemical synthesis, including complex production process, low synthesis yield, many by-products with similar chemical properties to the target product, and high difficulty in downstream separation and purification. The biosynthesis method mainly uses enzyme catalysis and fermentation. In the biofermentation method, it is necessary to construct the biological metabolic pathway of ectoine in the bacteria. The synthesis process of ectoine can be completed in three steps. First, aspartate kinase (LysC) catalyzes aspartate to generate β-aspartyl phosphate; then aspartate semialdehyde dehydrogenase (AsD) catalyzes β-aspartyl phosphate to generate aspartate-β-semialdehyde; finally, aspartate-β-semialdehyde completes the synthesis of ectoine under the catalysis of three enzymes encoded by ectABC. At the same time, the metabolic pathways of lysine and homoserine also start from aspartate-β-semialdehyde, so there is a certain carbon flow metabolic competition with ectoine.

[0004] In existing studies, when there is a metabolic flow competing pathway with the main expression metabolic pathway, a common practice is to knock out the expression gene of the branch to achieve complete interception of the branch metabolic flow. In the study of ectoine, the commonly used method of branch metabolic interception is to knock out the lysine expression gene lysA and the homoserine dehydrogenase gene metL. This approach is reasonable at the design level, but it may have a negative impact on bacterial growth. The life metabolism of bacteria requires essential amino acids, such as lysine and threonine. Direct gene knockout leads to the obstruction of the production of these amino acids, which in turn affects the growth of the strain, and ultimately leads to a decrease in ectoine production.

[0005] Therefore, seeking a genetically engineered bacterium that can efficiently synthesize ectoine without affecting the metabolic pathways of other necessary products and a method for constructing the same has become a technical problem that needs to be urgently solved in this field. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a genetically engineered bacterium that can efficiently synthesize ectoine without affecting the metabolic pathways of other necessary products and a construction method thereof.

[0007] To achieve the above object, the technical solution adopted by the present invention is:

[0008] In a first aspect, the present invention provides a protein degradation tag (small subunit ribosomal protein S1, ssrA), wherein the amino acid sequence of the protein degradation tag is any one of SEQ ID NOs: 1-9.

[0009] As a preferred embodiment of the first aspect of the present invention, the amino acid sequence of the protein degradation tag is any one of SEQ ID NOs: 1-4.

[0010] In a second aspect, the present invention provides an expression vector, which includes a dual-promoter plasmid, a diaminopimelate decarboxylase gene lysA fragment, a nucleic acid fragment encoding a protein degradation tag A, a homoserine dehydrogenase gene metL fragment, and a nucleic acid fragment encoding a protein degradation tag B; the diaminopimelate decarboxylase gene lysA fragment and the nucleic acid fragment encoding a protein degradation tag A are sequentially connected in series and located behind the first promoter of the dual-promoter plasmid, and the homoserine dehydrogenase gene metL fragment and the nucleic acid fragment encoding a protein degradation tag B are sequentially connected in series and located behind the second promoter of the dual-promoter plasmid; the amino acid sequences encoded by the nucleic acid fragment encoding a protein degradation tag A and the nucleic acid fragment encoding a protein degradation tag B are the same or different.

[0011] As a preferred embodiment of the second aspect of the present invention, the protein degradation label A or B is independently selected from any one of the protein degradation labels LAA, LAA+2, LAA+8, DAS+2, DAS+8 and their mutation labels LAA+2*, LAA+8*, DAS+2*, DAS+8*.

[0012] As a preferred embodiment of the second aspect of the present invention, the amino acid sequence of the protein degradation tag is as follows:

[0013] The amino acid sequence of the protein degradation tag LAA+2* is shown in SEQ ID NO: 1;

[0014] The amino acid sequence of the protein degradation tag LAA+8* is shown in SEQ ID NO: 2;

[0015] The amino acid sequence of the protein degradation tag DAS+2* is shown in SEQ ID NO: 3;

[0016] The amino acid sequence of the protein degradation tag DAS+8* is shown in SEQ ID NO: 4;

[0017] The amino acid sequence of the protein degradation tag LAA is shown in SEQ ID NO: 5;

[0018] The amino acid sequence of the protein degradation tag LAA+2 is shown in SEQ ID NO: 6;

[0019] The amino acid sequence of the protein degradation tag LAA+8 is shown in SEQ ID NO: 7;

[0020] The amino acid sequence of the protein degradation tag DAS+2 is shown in SEQ ID NO: 8;

[0021] The amino acid sequence of the protein degradation tag DAS+8 is shown in SEQ ID NO:9.

[0022] As a preferred embodiment of the second aspect of the present invention, the nucleic acid sequence encoding the protein degradation tag is as follows:

[0023] The nucleic acid sequence encoding the sequence of SEQ ID NO: 1 is shown in SEQ ID NO: 10;

[0024] The nucleic acid sequence encoding the sequence of SEQ ID NO: 2 is shown in SEQ ID NO: 11;

[0025] The nucleic acid sequence encoding the sequence of SEQ ID NO: 3 is shown in SEQ ID NO: 12;

[0026] The nucleic acid sequence encoding the sequence of SEQ ID NO: 4 is shown in SEQ ID NO: 13;

[0027] The nucleic acid sequence encoding the sequence of SEQ ID NO: 5 is shown in SEQ ID NO: 14;

[0028] The nucleic acid sequence encoding the sequence of SEQ ID NO: 6 is shown in SEQ ID NO: 15;

[0029] The nucleic acid sequence encoding the sequence of SEQ ID NO: 7 is shown in SEQ ID NO: 16;

[0030] The nucleic acid sequence encoding the sequence of SEQ ID NO: 8 is shown in SEQ ID NO: 17;

[0031] The nucleic acid sequence encoding the sequence of SEQ ID NO:9 is shown in SEQ ID NO:18.

[0032] In a third aspect, the present invention provides a genetically engineered bacterium, wherein the genetically engineered bacterium contains an expression vector for overexpressing the gene cluster ectABC and the expression vector described in the second aspect.

[0033] In a fourth aspect, the present invention provides a method for constructing the genetically engineered bacteria, comprising the following steps:

[0034] S1. Integrate the gene cluster ectABC into the pRSFDuet-1 plasmid to obtain the plasmid pRSF-ectABC;

[0035] S2. The lysA fragment of the diaminopimelate decarboxylase gene was connected to the first T7 promoter of the plasmid pETDuet-1 by homologous recombination technology to obtain plasmid A;

[0036] S3. The homoserine dehydrogenase gene metL fragment was connected to the second T7 promoter of plasmid A by homologous recombination technology to obtain plasmid B;

[0037] S4. Transforming the plasmid of step S1 and the plasmid of step S3 into competent host cells, and culturing the host cells in liquid culture medium to obtain the genetically engineered bacteria.

[0038] As a preferred embodiment of the fourth aspect of the present invention, the plasmid A contains a lysA gene fragment and a nucleic acid fragment encoding a protein degradation tag A; the plasmid B contains a lysA gene fragment, a nucleic acid fragment encoding a protein degradation tag A, a metL gene fragment and a nucleic acid fragment encoding a protein degradation tag B; the protein degradation tag A or B is independently selected from any one of the protein degradation tags LAA, LAA+2, LAA+8, DAS+2, DAS+8 and their mutant tags LAA+2*, LAA+8*, DAS+2*, DAS+8*; the sequence of the nucleic acid fragment encoding the protein degradation tag A is shown in SEQ ID NOs: 10 to 18; the sequence of the nucleic acid fragment encoding the protein degradation tag B is shown in SEQ ID NOs: 10 to 18; the competent host cell is E.coli BL21(DE3)ΔlysAΔmetL.

[0039] In a fifth aspect, the present invention provides a method for preparing ectoine, comprising the step of fermenting using the genetically engineered bacteria as described above.

[0040] Compared with the prior art, the present invention has the following beneficial effects:

[0041] The present invention regulates the lysine diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL by adding a protein degradation tag, and simultaneously introduces an exogenous gene cluster ectABC to construct an expression pathway of ectoine in a host cell to synthesize ectoine from scratch. The construction method of the present invention ensures the content of essential amino acids required for the life metabolism of the bacterial body, such as lysine, threonine, etc., promotes the growth of the strain, and achieves the purpose of high-yield ectoine.

[0042] The present invention performs mutation optimization on the amino acid sequence of the protein degradation tag on the basis of protein degradation tag regulation, and finds that the mutated protein degradation tag is more helpful to increase the yield of ectoine.

[0043] In addition, the present invention also combines different types of protein degradation tags with the lysA gene and the metL gene, respectively, screens out the most suitable protein degradation tags for different target expression genes, and regulates the expression of the lysA gene and the metL gene by combining the target expression gene with its most suitable protein degradation tag, so that the host cell can generate ectoine to the maximum extent, thereby increasing the yield of ectoine. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is a schematic diagram of the metabolic pathway for regulating ectoine in the present invention. DETAILED DESCRIPTION

[0045] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0046] Plasmids pRSFDuet-1, pACYCDuet-1 and the recombinant plasmid of the present invention were synthesized by General Biotechnology (Anhui) Co., Ltd. The nucleic acid sequence of the ectABC gene cluster related to the ectoine synthesis pathway from Halomonas elongatus is shown in SEQ ID NO:19.

[0047] The Gene ID of the diaminopimelate decarboxylase gene lysA from Escherichia coli is 947313;

[0048] The Gene ID of the homoserine dehydrogenase gene metL derived from Escherichia coli is 948433.

[0049] Preparation of gene-deficient Escherichia coli: The CRISPER method was used to knock out the diaminopimelate decarboxylase gene lysA and / or the homoserine dehydrogenase gene metL in Escherichia coli, respectively, to obtain Escherichia coli E. coli BL21 (DE3) ΔlysA with lysA gene knocked out, E. coli BL21 (DE3) ΔmetL with metL gene knocked out, and E. coli BL21 (DE3) ΔlysA ΔmetL with lysA and metL genes knocked out. The CRISPER method is a conventional gene editing tool used by those skilled in the art for gene editing. The effect of knocking out the target gene can be achieved by designing sgRNA based on the clear sequence of the target gene.

[0050] Example 1

[0051] The embodiment provides a protein degradation tag, the amino acid sequence of which is any one of the following:

[0052] 1)AANDENYGSALAA (SEQ ID NO: 1);

[0053] 2) AANDENYDSE SGSNYALAA (SEQ ID NO: 2);

[0054] 3) AANDENYGSADAS (SEQ ID NO: 3);

[0055] 4) AANDENYDSESGSNYADAS (SEQ ID NO: 4);

[0056] 5)AANDENYALAA (SEQ ID NO: 5);

[0057] 6)AANDENYNYALAA (SEQ ID NO: 6);

[0058] 7)AANDENYSESESENYALAA (SEQ ID NO: 7);

[0059] 8) AANDENYNYADAS (SEQ ID NO: 8);

[0060] 9)AANDENYSESESENYADAS (SEQ ID NO: 9);

[0061] The protein degradation tags ssrA with different amino acid sequences were named as: LAA+2* (SEQ ID NO: 1), LAA+8* (SEQ ID NO: 2), DAS+2* (SEQ ID NO: 3), DAS+8* (SEQ ID NO: 4), LAA (SEQ ID NO: 5), LAA+2 (SEQ ID NO: 6), LAA+8 (SEQ ID NO: 7), DAS+2 (SEQ ID NO: 8), and DAS+8 (SEQ ID NO: 9).

[0062] Preferably, the amino acid sequence of the protein degradation tag is any one of SEQ ID NOs: 1-4.

[0063] Example 2

[0064] The present embodiment provides an expression vector, which includes a dual-promoter plasmid, a diaminopimelate decarboxylase gene lysA fragment, a nucleic acid fragment encoding a protein degradation tag A, a homoserine dehydrogenase gene metL fragment, and a nucleic acid fragment encoding a protein degradation tag B; the diaminopimelate decarboxylase gene lysA fragment and the nucleic acid fragment encoding a protein degradation tag A are sequentially connected in series and located behind the first promoter of the dual-promoter plasmid, and the homoserine dehydrogenase gene metL fragment and the nucleic acid fragment encoding a protein degradation tag B are sequentially connected in series and located behind the second promoter of the dual-promoter plasmid; the amino acid sequences encoded by the nucleic acid fragment encoding a protein degradation tag A and the nucleic acid fragment encoding a protein degradation tag B are the same or different.

[0065] Preferably, the protein degradation tag A or B is independently selected from any one of the protein degradation tags LAA, LAA+2, LAA+8, DAS+2, DAS+8 and their mutant tags LAA+2*, LAA+8*, DAS+2*, DAS+8*.

[0066] Preferably, the protein degradation tag A or B is independently selected from any one of the protein degradation tags LAA+2*, LAA+8*, DAS+2*, and DAS+8*.

[0067] The amino acid sequence of the protein degradation tag LAA+2* is AANDENYGSALAA (SEQ ID NO: 1);

[0068] The amino acid sequence of the protein degradation tag LAA+8* is AANDENYDSE SGSNYALAA (SEQ ID NO: 2);

[0069] The amino acid sequence of the protein degradation tag DAS+2* is AANDENYGSADAS (SEQ ID NO: 3);

[0070] The amino acid sequence of the protein degradation tag DAS+8* is AANDENYDSESGSNYADAS (SEQ ID NO: 4);

[0071] The amino acid sequence of the protein degradation tag LAA is AANDENYALAA (SEQ ID NO: 5);

[0072] The amino acid sequence of the protein degradation tag LAA+2 is AANDENYNYALAA (SEQ ID NO: 6);

[0073] The amino acid sequence of the protein degradation tag LAA+8 is AANDENYSESESENYALAA (SEQ ID NO: 7);

[0074] The amino acid sequence of the protein degradation tag DAS+2 is AANDENYNYADAS (SEQ ID NO: 8);

[0075] The amino acid sequence of the protein degradation tag DAS+8 is AANDENYSESESENYADAS (SEQ ID NO: 9).

[0076] The nucleotide sequence encoding the above protein degradation tag is as follows:

[0077] The nucleic acid sequence encoding SEQ ID NO: 1 is as follows:

[0078] GCAGCAAATGATGAAAATTATGGTAGCGCACTGGCAGCA (SEQ ID NO: 10);

[0079] The nucleic acid sequence encoding SEQ ID NO: 2 is as follows:

[0080] GCAGCAAATGATGAAAATTATGATAGCGAAAGCGGTAGCAATTATGCACTGGCAGCA (SEQ ID NO: 11);

[0081] The nucleic acid sequence encoding SEQ ID NO: 3 is as follows:

[0082] GCAGCAAATGATGAAAATTATGGTAGCGCAGATGCAAGC (SEQ ID NO: 12);

[0083] The nucleic acid sequence encoding SEQ ID NO: 4 is as follows:

[0084] GCAGCAAATGATGAAAATTATGATAGCGAAAGCGGTAGCAATTATGCAGATGCAAGC (SEQ ID NO: 13);

[0085] The nucleic acid sequence encoding SEQ ID NO: 5 is as follows:

[0086] GCCGCCAATGACGAAAATTACGCATTGGCAGCC (SEQ ID NO: 14);

[0087] The nucleic acid sequence encoding SEQ ID NO: 6 is as follows:

[0088] GCGGCGAACGATGAGAACTATAATTACGCTTTGGCTGCT (SEQ ID NO: 15);

[0089] The nucleic acid sequence encoding SEQ ID NO: 7 is as follows:

[0090] GCAGCAAACGATGAGAACTATTCGGAATCGGAGAGTGAAAAACTACGCG TTGGCTGCA (SEQ ID NO: 16);

[0091] The nucleic acid sequence encoding SEQ ID NO: 8 is as follows:

[0092] GCCGCTAATGATGAAAACTACAATTATGCGGATGCATCC (SEQ ID NO: 17);

[0093] The nucleic acid sequence encoding SEQ ID NO: 9 is as follows:

[0094] GCAGCCAACGACGAAAACTATAGCGAAAGCGAGTCAGAGAACTATGCG GATGCCAGT (SEQ ID NO: 18);

[0095] Preferably, the dual promoter plasmid may be pACYCDuet-1 plasmid.

[0096] Since the nucleic acid sequence of the protein degradation tag is directly connected to the nucleic acid sequence of the expressed gene (lysA gene or metL gene), the primers for synthesizing and amplifying the expressed gene also include a portion that can amplify the protein degradation tag. The primers can simultaneously amplify the expressed gene and the protein degradation tag. The primers are synthesized by General Biotechnology (Anhui) Co., Ltd., and the primers are shown in Tables 1 and 2.

[0097] Example 3

[0098] This embodiment provides a method for constructing a recombinant Escherichia coli, comprising the following steps:

[0099] S1. Integrate the gene cluster ectABC into the pRSFDuet-1 plasmid to obtain the plasmid pRSF-ectABC;

[0100] S2. The lysA fragment of the diaminopimelate decarboxylase gene from Escherichia coli was connected to the first T7 promoter of the plasmid pETDuet-1 by homologous recombination technology to obtain plasmid A;

[0101] S3. The homoserine dehydrogenase gene metL fragment from Escherichia coli was connected to the second T7 promoter of plasmid A by homologous recombination technology to obtain plasmid B;

[0102] S4. Transforming the plasmid of step S1 and the plasmid of step S3 into competent Escherichia coli, culturing the Escherichia coli in liquid culture medium, and obtaining the recombinant Escherichia coli.

[0103] Preferably, the plasmid A contains a lysA gene fragment and a nucleic acid fragment encoding a protein degradation tag A.

[0104] Preferably, the plasmid B contains a lysA gene fragment, a nucleic acid fragment encoding a protein degradation tag A, a metL gene fragment, and a nucleic acid fragment encoding a protein degradation tag B.

[0105] Preferably, the protein degradation tag A or B is independently selected from any one of the protein degradation tags LAA, LAA+2, LAA+8, DAS+2, DAS+8 and their mutant tags LAA+2*, LAA+8*, DAS+2*, DAS+8*.

[0106] Preferably, the protein degradation tag A or B is independently selected from any one of the protein degradation tags LAA+2*, LAA+8*, DAS+2*, and DAS+8*.

[0107] Preferably, the competent Escherichia coli is E. coli BL21 (DE3) ΔlysAΔmetL.

[0108] The nucleic acid sequence of ectABC is as follows:

[0109] atgaacgcaaccacagagccctttacaccctccgccgacctggccaagcccagcgtggccgatgccgtggtcggccatgaggcctcacc

[0110] gctcttcatccgcaagccaagccccgatgacggctggggcatctacgagctggtcaagtcctgtccgcctctcgacgtcaattccgcctacgcctat

[0111] ctgttgctggccacccagttccgcgatagctgcgccgtggcgaccaacgaagagggcgagatcgtcggcttcgtttccggctacgtgaagagcaa

[0112] cgcccccgatacctatttcctctggcaggttgccgtgggcgagaaggcacgtggcaccggcctggcccgtcgtctggtggaagccgtgatgacac

[0113] gcccggaaatggccgaggtccaccatctcgagaccactatcacgcccgacaaccaggcgtcctggggcttgttccgccgtctcgccgatcgctg

[0114] gcaggcgccgttgaacagccgcgaatacttctccaccgatcaactcggcggtgagcatgacccggaaaacctcgttcgcatcggcccgttccaga

[0115] ccgaccagatctgagccgggacgccgcctggccggcccggtacgggccggcaacccgtcttttcgttttatcactttccccccacaggaggtcgc

[0116] aatgcagacccagattctcgaacgcatggagtccgacgttcggacctactcccgctccttcccggtcgtcttcaccaaggcgcgcaatgcccgcct

[0117] gaccgacgaggaagggcgcgagtacatcgacttcctggccggtgccggcaccctgaactacggccacaacaacccgcacctcaagcaggcgc

[0118] tgctcgactatatcgacagcgacggcatcgtccacggcctggacttctggactgcggccaagcgcgactatctggaaaccctggaagaggtgatc

[0119] ctcaagccgcgcggtctcgactacaaggtgcatctgcccggaccgactggcaccaacgccgtcgaggcggccattcgcctggcccgggtcgcc

[0120] aaggggcgccacaatatcgtctccttcaccaacggctttcatggcgtcaccatgggcgcgctggcgaccaccggtaaccgcaagttccgcgagg

[0121] ccaccggtggcgtgccgacccaggctgcttccttcatgccgttcgatggctacctcggcagcagcaccgacaccctcgactacttcgagaagctg

[0122] ctcggcgacaagtccggcggcctggacgtgcccgcggcggtgatcgtcgagacagtgcagggcgagggcggtatcaatgtcgccggcctgga

[0123] gtggctcaagcgcctcgagagcatctgccgcgccaatgacatcctgctgatcatcgacgacatccaggcgggctgcggccggaccggcaagttc

[0124] ttcagcttcgagcatgccggcatcacgccggatatcgtgaccaactccaagtcgctgtccggttacggcctgccgttcgctcacgtcctgatgcgcc

[0125] ccgagctcgacaagtggaagcccggtcagtacaacggcaccttccgcggcttcaacctggctttcgccactgctgctgccgccatgcgcaagtac

[0126] tggagcgacgacaccttcgagcgtgacgtgcagcgcaaggctcgcatcgtcgaggaacgcttcggcaagatcgccgcctggctgagcgagaac

[0127] ggcatcgaggcctccgagcgcggccgcgggctgatgcggggcatcgacgtgggttccggcgatatcgccgacaagatcacccaccaagccttc

[0128] gagaacgggttgatcatcgaaaccagcggtcaggacggcgaagtggtcaagtgcctgtgcccgctgaccattcccgacgaagacctggtcgag

[0129] ggactcgacatcctcgagaccagcaccaagcaggcctttagctgatcgcctgaggtgcgccatcgggcctgtccatggcatcctgtatcggtcgg

[0130] ccgtgcgcggccggccagtcattgattcactggagaatcgacatgatcgttcgcaatctcgaagaagcgcgccagaccgaccgtctggtcaccgc

[0131] cgaaaacggcaactgggacagcacccgcctgtcgctggccgaagatggtggcaactgctccttccacatcacccgcatcttcgagggtaccgag

[0132] acccacatccactataagcatcacttcgaggctgtttattgcatcgaaggcgagggcgaagtggaaaccctggccgatggcaagatctggcccatc

[0133] aagccgggtgacatctacatcctcgaccagcacgacgagcacctgctgcgcgccagcaagaccatgcacctggcctgcgtgttcacgccgggc

[0134] ctgaccggcaacgaagtgcaccgcgaagacggttcctacgcacctgccgacgaagccgacgaccagaagccgctgtaa (SEQ ID NO: 19).

[0135] Example 4 Effects of different protein degradation tags on ectoine production

[0136] Using E. coli BL21 (DE3) as the expression strain, the expression plasmids pRSF-ectABC, pACYC-lysA-ssrA, pACYC-metL-ssrA, and pACYC-lysA-ssrA1-metL-ssrA2 were constructed. The specific steps are as follows:

[0137] S1 integrates the gene cluster ectABC from Halomonas elongatus into the pRSFDuet-1 plasmid, which is constructed by General Company. The constructed plasmid is pRSF-ectABC;

[0138] S2: The obtained recombinant vector pRSF-ectABC was mixed with E. coli BL21 (DE3) ΔlysA, E. coli BL21 (DE3) ΔmetL, and E. coli BL21 (DE3) ΔlysA ΔmetL competent cells, respectively, and placed on ice for 30 min. Then, the mixture was rapidly heat-shocked (42°C, 90 s) and quickly placed on ice. The mixture was allowed to stand for 2 min, and then 1 mL of LB liquid medium was aseptically added. The mixture was cultured at 37°C, 220 rpm for 1 h to obtain strains Ect01, Ect02, and Ect03, respectively.

[0139] S3 designed 9 pairs of primers for the diaminopimelate decarboxylase gene lysA from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, so that lysA and ssrA could be amplified simultaneously) for cloning, and the cloned different lysA fragments (including ssrA nucleic acid fragments) were connected to the first T7 promoter of plasmid pACYCDuet-1 by homologous recombination technology, respectively, to obtain 9 plasmids pACYC-lysA-LAA, pACYC-lysA-LAA+2, pACYC-lysA-LAA+8, pACYC-lysA-LAA+9, pACYC-lysA-LAA+10, pACYC-lysA-LAA+11, pACYC-lysA-LAA+12, pACYC-lysA-LAA+13, pACYC-lysA-LAA+14, pACYC-lysA-LAA+15, pACYC-lysA-LAA+16, pACYC-lysA-LAA+17, pACYC-lysA-LAA+18, pACYC-lysA-LAA+19, pACYC-lysA-LAA+19, pACYC-lysA-LAA+11, pACYC-lysA-LAA+13, pACYC-lysA-LAA+17, pACYC-lysA-LAA+18, pACYC-lysA-LAA+19, pACYC-lysA-LAA+19, pACYC-lysA-LAA+11, pACYC-lysA-LAA+12, pACYC-lysA-LAA+13, pACYC-lysA-LAA+14, pACYC-ly sA-DAS+2, pACYC-lysA-DAS+8, pACYC-lysA-LAA+2*, pACYC-lysA-LAA+8*, pACYC-lysA-DAS+2*, pACYC-lysA-DAS+8*; the obtained plasmids were transformed into the Ect01 strain to obtain Ect0101, Ect0102, Ect0103, Ect0104, Ect0105, Ect0106, Ect0107, Ect0108, and Ect0109 strains respectively. The primers used in this step are as shown in Table 1 below;

[0140] Table 1: Primers used for amplification of lysA-ssrA

[0141]

[0142]

[0143] S4 designed 9 pairs of primers for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, so that metL and ssrA could be amplified simultaneously) for cloning, and the cloned different metL fragments (including ssrA nucleic acid fragments) were connected to the second T7 promoter of plasmid pACYCDuet-1 by homologous recombination technology, and 9 different plasmids were obtained, namely pACYC-metL-LAA, pACYC-metL-LAA+2, pACYC-metL-LAA+8, and pACYC-m etL-DAS+2, pACYC-metL-DAS+8, pACYC-metL-LAA+2*, pACYC-metL-LAA+8*, pACYC-metL-DAS+2*, pACYC-metL-DAS+8*; the obtained plasmids were transformed into the Ect02 strain to obtain Ect0201, Ect0202, Ect0203, Ect0204, Ect0205, Ect0206, Ect0207, Ect0208, and Ect0209 strains respectively. The primers used in this step are as shown in Table 2 below;

[0144] Table 2: Primers used to amplify metL-ssrA

[0145]

[0146]

[0147] S5 designed 9 pairs of primers for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, so metL and ssrA could be amplified simultaneously) for cloning, and the cloned different metL fragments (including ssrA nucleic acid fragments) were connected to the second T7 promoter of plasmid pACYC-lysA-LAA by homologous recombination technology, and 9 different plasmids were obtained, namely pACYC-lysA-LAA-metL-LAA, pACYC-lysA-LAA-metL-LAA+2, pACYC-lysA-LAA-metL-LAA+8, pACYC-lysA-LAA-metL-DAS+2, pACYC-lysA-LAA-metL-DAS+8, pACYC-lysA-LAA-metL-LAA+2*, pACYC-lysA-LAA-metL-LAA+8*, pACYC-lysA-LAA-metL-DAS+2*, pACYC-lysA-LAA-metL-DAS+8*; the obtained plasmids were transformed into the Ect03 strain to obtain Ect0301, Ect0302, Ect0303, Ect0304, Ect0305, Ect0306, Ect0307, ​​Ect0308, and Ect0309 strains, respectively. This step uses the primers in Table 2.

[0148] S6 designed 9 pairs of primers for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, so that metL and ssrA could be amplified simultaneously) for cloning, and the cloned different metL fragments (including ssrA nucleic acid fragments) were connected to the second T7 promoter of plasmid pACYC-lysA-LAA+2 by homologous recombination technology, resulting in 9 different plasmids, pACYC-lysA-LAA+2-metL-LAA, pACYC-lysA-LAA+2-metL-LAA+2, pACYC-lysA-LAA+2-metL-LAA+8, and pACYC-lysA-LAA+2-metL -DAS+2, pACYC-lysA-LAA+2-metL-DAS+8, pACYC-lysA-LAA+2-metL-LAA+2*, pACYC-lysA-LAA+2-metL-LAA+8*, pACYC-lysA-LAA+2-metL-DAS+2*, pACYC-lysA-LAA+2-metL-DAS+8*, and the resulting plasmids were transformed into the Ect03 strain to obtain Ect0310, Ect0311, Ect0312, Ect0313, Ect0314, Ect0315, Ect0316, Ect0317, and Ect0318 strains, respectively. This step uses the primers in Table 2.

[0149] S7 designed 9 pairs of primers for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, so metL and ssrA could be amplified simultaneously) for cloning, and the cloned different metL fragments (including ssrA nucleic acid fragments) were connected to the second T7 promoter of plasmid pACYC-lysA-LAA+8 by homologous recombination technology, resulting in 9 different plasmids, pACYC-lysA-LAA+8-metL-LAA, pACYC-lysA-LAA+8-metL-LAA+2, pACYC-lysA-LAA+8-metL-LAA+8, pACYC-lysA-LAA+8-met L-DAS+2, pACYC-lysA-LAA+8-metL-DAS+8, pACYC-lysA-LAA+8-metL-LAA+2*, pACYC-lysA-LAA+8-metL-LAA+8*, pACYC-lysA-LAA+8-metL-DAS+2*, pACYC-lysA-LAA+8-metL-DAS+8*, and the resulting plasmids were transformed into the Ect03 strain to obtain Ect0319, Ect0320, Ect0321, Ect0322, Ect0323, Ect0324, Ect0325, Ect0326, and Ect0327 strains, respectively. This step uses the primers in Table 2.

[0150] S8 designed 9 pairs of primers for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, so metL and ssrA could be amplified simultaneously) for cloning, and the cloned different metL fragments (including ssrA nucleic acid fragments) were connected to the second T7 promoter of plasmid pACYC-lysA-DAS+2 by homologous recombination technology, resulting in 9 different plasmids, pACYC-lysA-DAS+2-metL-LAA, pACYC-lysA-DAS+2-metL-LAA+2, pACYC-lysA-DAS+2-metL-LAA+8, and pACYC-lysA-DAS+2-met L-DAS+2, pACYC-lysA-DAS+2-metL-DAS+8, pACYC-lysA-DAS+2-metL-LAA+2*, pACYC-lysA-DAS+2-metL-LAA+8*, pACYC-lysA-DAS+2-metL-DAS+2*, pACYC-lysA-DAS+2-metL-DAS+8*, and the resulting plasmids were transformed into the Ect03 strain to obtain Ect0328, Ect0329, Ect0330, Ect0331, Ect0332, Ect0333, Ect0334, Ect0335, and Ect0336 strains, respectively. This step uses the primers in Table 2.

[0151] S9 designed 9 pairs of primers for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, so that metL and ssrA could be amplified simultaneously) for cloning, and the cloned different metL fragments (including ssrA nucleic acid fragments) were connected to the second T7 promoter of plasmid pACYC-lysA-DAS+8 by homologous recombination technology, and 9 different plasmids pACYC-lysA-DAS+8-metL-LAA, pACYC-lysA-DAS+8-metL-LAA+2, pACYC-lysA-DAS+8-metL-LAA+8, pACYC-lysA-DAS+8-metL -DAS+2, pACYC-lysA-DAS+8-metL-DAS+8, pACYC-lysA-DAS+8-metL-LAA+2*, pACYC-lysA-DAS+8-metL-LAA+8*, pACYC-lysA-DAS+8-metL-DAS+2*, pACYC-lysA-DAS+8-metL-DAS+8*, and the resulting plasmids were transformed into the Ect03 strain to obtain Ect0337, Ect0338, Ect0339, Ect0340, Ect0341, Ect0342, Ect0343, Ect0344, and Ect0345 strains, respectively. This step uses the primers in Table 2.

[0152] S10 designed 9 pairs of primers for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, so metL and ssrA could be amplified simultaneously) for cloning, and the cloned different metL fragments (including ssrA nucleic acid fragments) were connected to the second T7 promoter of the plasmid pACYC-lysA-LAA+2* by homologous recombination technology, resulting in 9 different plasmids pACYC-lysA-LAA+2*-metL-LAA, pACYC-lysA-LAA+2*-metL-LAA+2, pACYC-lysA-LAA+2*-metL-LAA+8, pACYC-lysA-LAA+2*-met L-DAS+2, pACYC-lysA-LAA+2*-metL-DAS+8, pACYC-lysA-LAA+2*-metL-LAA+2*, pACYC-lysA-LAA+2*-metL-LAA+8*, pACYC-lysA-LAA+2*-metL-DAS+2*, pACYC-lysA-LAA+2*-metL-DAS+8*, and the resulting plasmids were transformed into the Ect03 strain to obtain Ect0346, Ect0347, Ect0348, Ect0349, Ect0350, Ect0351, Ect0352, Ect0353, and Ect0354 strains, respectively. This step uses the primers in Table 2.

[0153] S11 designed 9 pairs of primers for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, so metL and ssrA could be amplified simultaneously) for cloning, and the cloned different metL fragments (including ssrA nucleic acid fragments) were connected to the second T7 promoter of the plasmid pACYC-lysA-LAA+8* by homologous recombination technology, resulting in 9 different plasmids pACYC-lysA-LAA+8*-metL-LAA, pACYC-lysA-LAA+8*-metL-LAA+2, pACYC-lysA-LAA+8*-metL-LAA+8, pACYC-lysA-LAA+8*-metL-LAA+8 L-DAS+2, pACYC-lysA-LAA+8*-metL-DAS+8, pACYC-lysA-LAA+8*-metL-LAA+2*, pACYC-lysA-LAA+8*-metL-LAA+8*, pACYC-lysA-LAA+8*-metL-DAS+2*, pACYC-lysA-LAA+8*-metL-DAS+8*, and the resulting plasmids were transformed into the Ect03 strain to obtain Ect0355, Ect0356, Ect0357, Ect0358, Ect0359, Ect0360, Ect0361, Ect0362, and Ect0363 strains, respectively. This step uses the primers in Table 2.

[0154] S12 designed 9 pairs of primers for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, so metL and ssrA could be amplified simultaneously) for cloning, and the cloned different metL fragments (including ssrA nucleic acid fragments) were connected to the second T7 promoter of the plasmid pACYC-lysA-DAS+2* by homologous recombination technology, resulting in 9 different plasmids pACYC-lysA-DAS+2*-metL-LAA, pACYC-lysA-DAS+2*-metL-LAA+2, pACYC-lysA-DAS+2*-metL-LAA+8, pACYC-lysA-DAS+2*-met L-DAS+2, pACYC-lysA-DAS+2*-metL-DAS+8, pACYC-lysA-DAS+2*-metL-LAA+2*, pACYC-lysA-DAS+2*-metL-LAA+8*, pACYC-lysA-DAS+2*-metL-DAS+2*, pACYC-lysA-DAS+2*-metL-DAS+8*, and the resulting plasmids were transformed into the Ect03 strain to obtain Ect0364, Ect0365, Ect0366, Ect0367, Ect0368, Ect0369, Ect0370, Ect0371, and Ect0372 strains, respectively. This step uses the primers in Table 2.

[0155] S13 designed 9 pairs of primers for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, so that metL and ssrA could be amplified simultaneously) for cloning, and the cloned different metL fragments (including ssrA nucleic acid fragments) were connected to the second T7 promoter of the plasmid pACYC-lysA-DAS+8* by homologous recombination technology, resulting in 9 different plasmids pACYC-lysA-DAS+8*-metL-LAA, pACYC-lysA-DAS+8*-metL-LAA+2, pACYC-lysA-DAS+8*-metL-LAA+8, pACYC-lysA-DAS+8*-metL L-DAS+2, pACYC-lysA-DAS+8*-metL-DAS+8, pACYC-lysA-DAS+8*-metL-LAA+2*, pACYC-lysA-DAS+8*-metL-LAA+8*, pACYC-lysA-DAS+8*-metL-DAS+2*, pACYC-lysA-DAS+8*-metL-DAS+8*, and the resulting plasmids were transformed into the Ect03 strain to obtain Ect0373, Ect0374, Ect0375, Ect0376, Ect0377, Ect0378, Ect0379, Ect0380, and Ect0381 strains, respectively. This step uses the primers in Table 2.

[0156] S14 conducted fermentation verification on the above strains:

[0157] Shake flask fermentation medium: yeast extract 2g / L, KH2PO4 3g / L, Na2HPO4·12H2O 25g / L, (NH4)2SO4 16g / L, MgSO4·7H2O 1g / L, D-glucose 20g / L, trace element solution 1 ml, biotin 0.1mg;

[0158] Fermentation culture: Inoculate the seed culture into batch fermentation medium at a 20% inoculation rate, add 1 mL of trace elements, culture at 35-39°C for 5-7 h, rotate at 220 rpm, add 150 uL of 0.2 mmol / L IPTG and induce culture at 35-39°C.

[0159] 5L tank fermentation medium: yeast extract 10g / L, peptone 5g / L, Na2HPO4·12H2O 25g / L, KH2PO42g / L, citric acid 2g / L, NaCl 1g / L, MgSO4·7H2O 1g / L, biotin 0.1mg, D-glucose 25g / L, trace element solution 1 ml;

[0160] Trace elements: ammonium ferric citrate 5.6g / L, zinc sulfate heptahydrate 0.9g / L, CoCl2·6H2O 0.2g / L, manganese chloride tetrahydrate 1.0g / L, CuCl2·2H2O 0.10g / L, boric acid 0.2g / L, Na2MoO4·2H2O 0.2g / L;

[0161] Fermentation tank culture: Inoculate the seed culture into a batch-fed fermentation tank at a 20% inoculation rate, culture at 37°C for 5-7 hours, add 3 ml of 0.2 mmol / L IPTG, induce culture at 37°C, control pH 7.0, control dissolved oxygen content at 20-40%, and correlate the rotation speed with dissolved oxygen. The fermentation results are shown in Table 3 below:

[0162] Table 3: Constructed strains, plasmids contained therein and ECT yields

[0163]

[0164] From the results in Table 3, the yield of the plasmid strain with protein degradation tags was significantly higher than that of the direct knockout strain. At the same time, the DAS+8* tag had the best regulatory effect on the LysA protein, and the LAA+2* tag had the best regulatory effect on the MetL protein.

[0165] Table 4: Constructed strains, plasmids contained therein and ECT yields

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172] By transferring plasmids into strains with lysA and metL genes knocked out, gene complementation was performed and degradation proteins were used to regulate the expression of these two genes on the plasmid. From the results, the DAS+8* tag had the best overall regulatory effect. At the same time, the combination of DAS+8* and LAA+8* produced the highest-yielding strain.

[0173] Example 5 Fermentation Verification

[0174] The strain Ect0343 obtained in Example 4 (containing plasmids pRSF-ectABC, pACYC-lysA-DAS+8-metL-LAA+8*) was fermented in a 5L fermenter:

[0175] Fermentation medium: yeast extract 10g / L, peptone 5g / L, Na2HPO4·12H2O 25g / L, KH2PO42g / L, citric acid 2g / L, NaCl 1g / L, MgSO4·7H2O 1g / L, biotin 0.1mg, D-glucose 25g / L, trace element solution 1ml;

[0176] Trace elements: ammonium ferric citrate 5.6g / L, zinc sulfate heptahydrate 0.9g / L, CoCl2·6H2O 0.2g / L, manganese chloride tetrahydrate 1.0g / L, CuCl2·2H2O 0.10g / L, boric acid 0.2g / L, Na2MoO4·2H2O 0.2g / L;

[0177] Fermentation tank culture: Inoculate the seed culture into a batch-fed fermentation tank at an inoculation rate of 20%, culture at 37°C for 5-7h, add 3ml of 0.2mmol / L IPTG and induce culture at 37°C, control the pH to 7.0, control the dissolved oxygen content to 20-40%, and correlate the rotation speed with the dissolved oxygen to obtain the fermentation results as shown in the following table:

[0178] Table 5: Fermentation results of strain ect0603

[0179] Strain number ECT yield (g / L) Ect0343 86.9

[0180] As shown in Table 5, the strain Ect0343 was verified by 5L tank fermentation, and its ectoine production reached 86.9 g / L after 60 h of fermentation.

[0181] The present invention is to use the protein degradation tag ssrA for the first time to regulate the expression of the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL, and at the same time achieve the purpose of increasing the yield of ectoine through this combined regulation.

Claims

1. A protein degradation tag, characterized in that: The amino acid sequence of the protein degradation tag is any one of SEQ ID NOs: 1-9.

2. The protein degradation tag according to claim 1, characterized in that The amino acid sequence of the protein degradation tag is any one of SEQ ID NOs: 1-4.

3. An expression vector, characterized in that: The expression vector comprises a double promoter plasmid, a diaminopimelate decarboxylase gene lysA fragment, a nucleic acid fragment encoding a protein degradation tag A, a homoserine dehydrogenase gene metL fragment, and a nucleic acid fragment encoding a protein degradation tag B; The diaminopimelate decarboxylase gene lysA fragment and the protein degradation tag A encoding nucleic acid fragment are sequentially connected in series and located behind the first promoter of the dual-promoter plasmid, and the homoserine dehydrogenase gene metL fragment and the protein degradation tag B encoding nucleic acid fragment are sequentially connected in series and located behind the second promoter of the dual-promoter plasmid; The amino acid sequences encoded by the nucleic acid fragment encoding protein degradation tag A and the nucleic acid fragment encoding protein degradation tag B are the same or different.

4. The expression vector according to claim 3, characterized in that The protein degradation tag A or B is independently selected from any one of the protein degradation tags LAA, LAA+2, LAA+8, DAS+2, DAS+8 and their mutation tags LAA+2*, LAA+8*, DAS+2*, DAS+8*.

5. The expression vector according to claim 4, characterized in that The amino acid sequence of the protein degradation tag is as follows: The amino acid sequence of the protein degradation tag LAA+2* is shown in SEQ ID NO: 1; The amino acid sequence of the protein degradation tag LAA+8* is shown in SEQ ID NO: 2; The amino acid sequence of the protein degradation tag DAS+2* is shown in SEQ ID NO: 3; The amino acid sequence of the protein degradation tag DAS+8* is shown in SEQ ID NO: 4; The amino acid sequence of the protein degradation tag LAA is shown in SEQ ID NO: 5; The amino acid sequence of the protein degradation tag LAA+2 is shown in SEQ ID NO: 6; The amino acid sequence of the protein degradation tag LAA+8 is shown in SEQ ID NO: 7; The amino acid sequence of the protein degradation tag DAS+2 is shown in SEQ ID NO: 8; The amino acid sequence of the protein degradation tag DAS+8 is shown in SEQ ID NO:

9.

6. The expression vector according to claim 5, characterized in that The encoding nucleic acid sequence of the protein degradation tag is as follows: The nucleic acid sequence encoding the sequence of SEQ ID NO: 1 is shown in SEQ ID NO: 10; The nucleic acid sequence encoding the sequence of SEQ ID NO: 2 is shown in SEQ ID NO: 11; The nucleic acid sequence encoding the sequence of SEQ ID NO: 3 is shown in SEQ ID NO: 12; The nucleic acid sequence encoding the sequence of SEQ ID NO: 4 is shown in SEQ ID NO: 13; The nucleic acid sequence encoding the sequence of SEQ ID NO: 5 is shown in SEQ ID NO: 14; The nucleic acid sequence encoding the sequence of SEQ ID NO: 6 is shown in SEQ ID NO: 15; The nucleic acid sequence encoding the sequence of SEQ ID NO: 7 is shown in SEQ ID NO: 16; The nucleic acid sequence encoding the sequence of SEQ ID NO: 8 is shown in SEQ ID NO: 17; The nucleic acid sequence encoding the sequence of SEQ ID NO:9 is shown as SEQ ID NO:

18.

7. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria contain an expression vector for overexpressing the gene cluster ectABC and the expression vector according to any one of claims 3 to 6.

8. A method for constructing the genetically engineered bacteria according to claim 7, characterized in that: The steps include: S1. Integrate the gene cluster ectABC into the pRSFDuet-1 plasmid to obtain the plasmid pRSF-ectABC; S2. The lysA fragment of the diaminopimelate decarboxylase gene was connected to the first T7 promoter of the plasmid pETDuet-1 by homologous recombination technology to obtain plasmid A; S3. The homoserine dehydrogenase gene metL fragment was connected to the second T7 promoter of plasmid A by homologous recombination technology to obtain plasmid B; S4. Transforming the plasmid of step S1 and the plasmid of step S3 into competent host cells, culturing the host cells in liquid culture medium, and obtaining the genetically engineered bacteria.

9. The construction method according to claim 8, characterized in that: The plasmid A contains a lysA gene fragment and a nucleic acid fragment encoding a protein degradation tag A; the plasmid B contains a lysA gene fragment, a nucleic acid fragment encoding a protein degradation tag A, a metL gene fragment and a nucleic acid fragment encoding a protein degradation tag B; The protein degradation tag A or B is independently selected from any one of the protein degradation tags LAA, LAA+2, LAA+8, DAS+2, DAS+8 and their mutation tags LAA+2*, LAA+8*, DAS+2*, DAS+8*; The sequence of the nucleic acid fragment encoding the protein degradation tag A is shown in SEQ ID NOs: 10 to 18; The sequence of the nucleic acid fragment encoding protein degradation tag B is shown in SEQ ID NOs: 10 to 18; The competent host cell is E. coli BL21 (DE3) ΔlysAΔmetL.

10. A method for preparing tetrahydropyrimidine, characterized in that: The step of using the genetically engineered bacteria described in claim 7 to carry out fermentation.

Images