Gene editing and micro-homologous end connection combined large-fragment DNA fixed-point integration method

Abstract

The invention discloses a gene editing technology and micro-homologous end connection combined mediated large-fragment DNA efficient fixed-point integration method. According to the method disclosed by the invention, an agrobacterium co-transformation plant which respectively carries a vector containing a gene editing expression cassette and a donor vector containing a micro homologous terminal sequence is utilized, and an exogenous DNA fragment is inserted at a fixed point while a plant target gene is edited; the exogenous DNA fragment and the genome double-strand broken end are more easily subjected to micro homologous sequence mediated end connection, so that the exogenous DNA fragment is integrated into the plant genome at a fixed point. The method provided by the invention has the advantages of accuracy, high efficiency, large integrated fragment and the like, greatly reduces the workloads of genetic transformation, target strain screening, marginal sequence analysis and the like, and has important application value in the fields of molecular medicine agriculture and crop germplasm improvement.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biotechnology, and in particular to a method for site-specific integration of large-fragment DNA by combining gene editing and micro-homologous end joining. Background Art

[0002] CRISPR-Cas9 is the third generation of gene editing technology discovered after ZFN, TALENs and other gene editing technologies. It is one of the most efficient, simplest, lowest cost and easiest technologies among the existing gene editing and modification technologies, and has become a mainstream gene editing system. The above gene editing technologies usually form double-strand breaks (DSBs) in the genome. Usually, after DSBs occur in cells, they activate their own two DNA repair mechanisms - non-homologous end joining (NHEJ) and homology directed repair (HDR). Recent studies have found that there is also a microhomology sequence joining method to mediate DNA repair (microhomology-mediated end joining, MMEJ) (Vu, et al. "CRISPR / Cas-based precision genome editing via microhomology-mediated end joining." Plant Biotechnology Journal (2020).

[0003] Site-directed genome integration is the precise integration of specific gene fragments into a predetermined location in the genome. In recent years, with the continuous development of technology, site-directed genome integration has become a hot research field. However, it still faces some challenges in practical applications, focusing on how to increase the length of exogenous inserted fragments, how to ensure the accuracy of site-directed integration, and how to significantly improve the efficiency of site-directed integration. Summary of the invention

[0004] 1. Technical issues to be solved

[0005] In view of the deficiencies of the prior art, the present invention provides a method for site-specific integration of large-fragment DNA by combining gene editing and microhomology end joining, and successfully realizes the site-specific integration of ultra-long fragments by using gene editing and microhomology sequence joining technology, which has the characteristics of simple operation, high efficiency and easy detection. Taking rice as an example, a common gene editing target was designed for the sequences of rice glutelin genes GluA1 and GluA2, and a gene editing vector was constructed. The rice explants were co-infected with a donor vector containing a microhomology sequence at the end, and the double resistance screening of the transgenic process was superimposed, which significantly improved the efficiency of genome site-specific integration and obtained a stably integrated mutant. The gene editing target and genome site-specific integration method provided by the present invention have high application value.

[0006] (II) Technical solution

[0007] To achieve the above objectives, the present invention is implemented by the following technical solutions: a large-fragment DNA site-specific integration method combined with gene editing and micro-homologous end joining,

[0008] In a first aspect, a gene editing vector and a donor vector comprising microhomology sequences at the ends are disclosed:

[0009] The gene editing transformation vector uses pC1300-cas9-RFP as a backbone vector and a gene editing target designed for an identifiable site in the CDS region of the target gene to be edited.

[0010] Preferably, the edited target genes are OsGluA1 and OsGluA2, and their target sequences are shown in SEQ ID NO: 1 (T1) and SEQ ID NO: 2 (T3). The target sequence is connected to the OsU6a-T1 or OsU6a-T3 expression cassette into the pC1300-cas9-RFP backbone vector by a recombinant cloning method, and the expression is driven by the OsU6a promoter to obtain the gene editing transformation vector. Taking the T3 target as an example, the nucleotide sequence of the gene editing vector is shown in SEQ ID NO: 3.

[0011] The donor vector containing the microhomology sequence is a backbone vector transformed from pC1300, and comprises a glyphosate resistance gene, a green fluorescent gene, and a donor gene expression box containing the microhomology sequence.

[0012] Preferably, the donor gene expression cassette containing the microhomology sequence is the avian influenza H5N6 hemagglutinin protein H5 gene, and the sequence is shown in SEQ ID NO: 4. The donor vector sequence containing the microhomology sequence is shown in SEQ ID NO: 5.

[0013] In the second aspect, a method for site-specific integration into a plant genome using CRISPR / Cas9 gene editing and microhomology sequence ligation technology is disclosed. The above vector is introduced into Agrobacterium through Agrobacterium-mediated genetic transformation, and plant explants are infected through Agrobacterium-mediated genetic transformation, and transgenic plants are obtained through screening, differentiation and rooting.

[0014] Specifically, taking rice as an example, Agrobacterium-mediated genetic transformation includes:

[0015] Induction: The seeds of Zhonghua 11 (ZH11) were sterilized with sodium hypochlorite and placed on the induction medium, cultured in the dark at 28°C for 30-40 days, and the induced callus was subcultured for 30-40 days;

[0016] Infection and screening: Mix the aforementioned gene-editing Agrobacterium and the donor vector Agrobacterium at a ratio of 1:3 and infect the callus for 25-30 minutes. After 3 days of co-culture, wash 5-6 times, transfer to the corresponding resistance screening medium (hygromycin 50 mg / L + glyphosate 3-5 mM), culture at 30°C in the dark for 30-50 days, and screen for resistant callus;

[0017] Differentiation: The resistant calli obtained by screening were transferred to the differentiation medium containing the corresponding resistant herbicide (glyphosate 0.05-0.1mM), and the positive seedlings were obtained after differentiation for 25-30 days;

[0018] Rooting: The positive seedlings obtained through differentiation were transferred to the rooting medium containing the corresponding resistance (hygromycin 10-15 mg / L + glyphosate 0.05-0.1 mM), and the positive transgenic plants were finally obtained after rooting for 7-15 days;

[0019] Hardening and transplanting: Open the sealing film on the bottle mouth of the transformed strain with vigorous root growth, add sterile water to cover the culture medium to a thickness of 1-2 cm, place it in contact with air at room temperature for 2-3 days to harden the seedlings, and then transplant it to the greenhouse for cultivation.

[0020] Preferably, the above-mentioned method for co-transformation to obtain transgenic plants with site-specific integration into the genome comprises the following key steps:

[0021] (1) Through mixed Agrobacterium-mediated genetic co-transformation, the key is that the ratio of gene editing vector to donor vector is 1:3;

[0022] (2) a double screening method was used during the callus screening stage, with hygromycin and glyphosate concentrations of 50-100 mg / L and 3-5 mM / L, respectively;

[0023] The third aspect of the present invention discloses a method for performing site-specific integration detection on the obtained resistant callus, differentiated seedlings or plants:

[0024] (1) After sampling and extracting genomic DNA, the gene editing vector-specific detection primers (c9-FP-jcF and c9-FP-jcR) and donor vector-specific detection primers (Do-FP-jcF and Do - FP-jcR), the plants that can obtain specific amplified fragments are double-transformed positive plants;

[0025] (2) GluA1-F / R and GluA2-F / R primers were used to perform PCR amplification to detect the GluA1 and GluA2 genomes respectively; GluA1-F / Do - GluA1-R or GluA1-R / Do-F detection and GluA2-F / Do-R or GluA2-R / Do-F were used for PCR amplification to detect whether there was site-specific insertion of GluA1 or GluA2; if GluA1-F / R did not amplify the expected band, but GluA1-F / Do-R or GluA1-R / Do-F amplified the expected band, it indicated that a homozygous insertion occurred at the corresponding site; if GluA1-F / R amplified the expected band, GluA1-F / Do-R or GluA1-R / Do-F also amplified the expected band, it indicated that a heterozygous insertion occurred at the corresponding site; the same was true for the GluA2 site. (3) For samples without site-specific integration, specific primers GluA1-F / R and GluA2-F / R were used. For samples with site-specific integration into the genome, GluA1-F / Do-R or GluA1-R / Do-F was used for detection and GluA2-F / Do-R or GluA2-R / Do-F was used for PCR amplification. After product sequencing, the DNA fragments of T0 rice plants and the wild-type sequence were compared to determine the gene editing mutation or the boundary sequence of site-specific integration into the genome.

[0026] The fourth aspect of the present invention discloses a progeny plant prepared and screened by the above method.

[0027] The offspring plants include the offspring of the plants that tested positive by the donor vector detection specific primers (Do-FP-jcF and Do-FP-jcR) and the plants that tested positive by the site-specific integration.

[0028] (III) Beneficial effects

[0029] The present invention provides a method for site-specific integration of large DNA fragments by combining gene editing and micro-homologous end joining. Compared with the prior art, it has the following beneficial effects:

[0030] (1) The method for site-specific integration of large DNA fragments combined with gene editing and micro-homologous end joining does not require long homology arms, and the micro-homologous sequences are relatively short, thereby making the selection of site-specific integration sites relatively free. The gene editing and micro-homologous end joining technologies provided by the present invention are superimposed with multiple screening strategies, thereby achieving a higher efficiency of genome site-specific integration.

[0031] (2) This large-fragment DNA site-specific integration method combined with gene editing and microhomologous end-joining achieved the insertion of ultra-large fragments, providing a reference for genome site-specific integration. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is a schematic diagram of the pC1300-cas9-RFP-T3 gene editing vector of the present invention;

[0033] Figure 2 Schematic diagram of the donor vector containing microhomology sequence ligation. A is a schematic diagram of the vector map; B is a schematic diagram of the 5' end microhomology sequence; C is a schematic diagram of the 3' end microhomology sequence; MHS represents microhomology sequence;

[0034] Figure 3 The results of transgenic strain detection of the present invention are shown in Figure 1. The two bands were amplified using primers c9-FP-jcF / R and Do-FP-jcF / R respectively;

[0035] Figure 4 The schematic diagram of primers for the site-specific integration strain of the present invention and the results of PCR amplification detection. A is a schematic diagram of primer positions; B is a schematic diagram of PCR amplification detection results;

[0036] Figure 5 The right border sequencing result of T-DNA in the site-directed integration strain. MHS represents the microhomologous recombination sequence on the vector and the genome, Donor represents the donor vector sequence, and OsGluA1 represents the original genome sequence.

[0037] Figure 6 This is the sequencing result of the left border of T-DNA of the site-specific integration strain. Figure 5 . DETAILED DESCRIPTION

[0038] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0039] See also Figure 1-6The present invention provides four technical solutions: a large DNA fragment site-specific integration method combined with gene editing and micro-homologous end ligation, specifically including the following embodiments:

[0040] Example 1

[0041] 1. Design of common gene editing target site for rice GluA1 and GluA2 and construction of vector

[0042] Targeting the GluA1 and GluA2 genes in rice, two targets T1 and T3 were designed in combination with the gene target editing website http: / / skl.scau.edu.cn / targetdesign / . The T1 and T3 targets were combined with the rice U6a promoter to directly synthesize the OsU6a-T1-sgRNA (sequence as shown in SEQ ID NO: 12) or OsU6a-T3-sgRNA (sequence as shown in SEQ ID NO: 13) sequence. The backbone vector pC1300-cas9-RFP linearized by MluI and SmiI was connected by recombination. The resulting gene editing vectors were named pC1300-cas9-RFP-OsGluT1 or pC1300-cas9-RFP-OsGluT3, respectively, as shown in the schematic diagram. Figure 1 shown.

[0043] 2. Design and construction of donor vectors containing microhomology sequences;

[0044] In order to facilitate transgenic screening, we constructed the donor expression cassette containing microhomology sequence, glyphosate selection marker gene expression cassette and green fluorescent protein expression cassette on the same vector through gene synthesis, thus forming a super large fragment of about 9.5Kb in length, the sequence is shown in SEQ ID NO: 5, and the map is shown in Figure 2 As shown in A.

[0045] Example 2

[0046] Agrobacterium transformation, identification, and rice genetic transformation;

[0047] Take Agrobacterium EHA105 competent cells and add 1 μl of the correctly sequenced pC1300-cas9-RFP-OsGluT1 or pC1300-cas9-RFP-OsGluT3 plasmid constructed in Example 1, and transform them by electroporation at 2.5KV. Spread on a YEP culture plate containing kanamycin, rifampicin and streptomycin, culture at 28°C for about 48 hours, pick a single colony and shake overnight, use specific primers (c9-FP-jcF / R) to verify the bacterial solution PCR, and amplify a target fragment of about 614bp, select positive clones, shake for 36 to 48 hours, and save the bacterial solution for infection. The specific primer (c9-FP-jcF / R) is as follows:

[0048] c9-FP-jcF: TGAACGGCCACGAGTTCGA;

[0049] c9-FP-jcR: CTACAGGAACAGGTGGTGGCG;

[0050] The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 45 s, annealing at 55-65°C for 45 s; extension at 72°C for 1.5 min; 30-35 cycles; extension at 72°C for another 10 min; and termination at 16°C.

[0051] The PCR reaction system is as follows:

[0052] Table 1 PCR reaction system

[0053]

[0054] Take Agrobacterium EHA105 competent cells and add 1 μl of the correctly sequenced donor vector plasmid constructed in Example 1, and transform by electroporation at 2.5KV. Spread on a YEP culture plate containing kanamycin, rifampicin and streptomycin, culture at 28°C for about 48 hours, pick a single colony and shake overnight, use specific primers (Do-FP-jcF / R) to verify the bacterial solution PCR, and amplify a target fragment of about 460bp, select positive clones, shake for 36 to 48 hours, and save the bacterial solution for infection. The specific primers (Do-FP-jcF / R) are as follows:

[0055] Do-FP-jcF:CGTGACCACCCTGACCTA;

[0056] Do-FP-jcR: CTCGTTGGGGTCTTTGCT;

[0057] The PCR reaction procedure and system are roughly the same as the gene editing vector.

[0058] Taking rice as an example, the above verified Agrobacterium was shaken to OD 600=0.4-0.6, the Agrobacterium containing the gene editing vector and the donor vector were mixed and shaken in a ratio of 1:3, and co-transformed into rice Zhonghua 11 (ZH11) by Agrobacterium-mediated genetic transformation. After co-cultivation for 3 days, the culture medium was washed 5-6 times and transferred to a resistance screening medium containing glyphosate and hygromycin (N6+2.4-D2mg / L+CH 0.6g / L+Pro 0.5g / L+Sucrose 30g / L+Phytagel 3g / L+Cn 500mg / L+Glyphosate 3-5mmol / L+Hygromycin 50mg / L), cultured in the dark at 30°C for 30-50d, and resistant calli were obtained by screening. A total of 500 calli were screened, and 71 positive calli were obtained, of which 48 had red fluorescence calli (indicating the presence of gene editing vectors); 17 had green fluorescence calli (indicating the presence of donor vectors); 17 had both red and green fluorescence calli (indicating the presence of gene editing vectors and donor vectors); and 6 had neither red fluorescence nor green fluorescence calli (indicating the presence of gene editing vectors and donor vectors). Although the fluorescence of the calli was separated, the screening process used double screening, and the obtained calli were double-resistant, so the obtained positive calli should contain two transgenic vectors. Therefore, we used all resistant calli for differentiation.

[0059] The obtained resistant callus was transferred to a differentiation medium containing glyphosate resistance; (MS+KT 2mg / L+NAA 2mg / L+sorbitol 30g / L+sucrose 30g / L+Phytagel 3g / L+glyphosate 0.05-0.25mmol / L), and the positive seedlings were obtained after differentiation for 25-30 days. The positive seedling rate obtained with 0.01mmol / L glyphosate was the highest, and a total of 66 seedlings were obtained by differentiation. The positive seedlings obtained after differentiation were transferred to a rooting medium containing glyphosate resistance (1 / 2MS+sucrose 20g / L+paclobutrazol 1mg / L+Phytagel 3g / L+glyphosate 0.1-0.25mmol / L), and finally positive transgenic plants were obtained. A total of 64 rooted seedlings were obtained, of which 44 seedlings were derived from red fluorescent callus, 9 seedlings were derived from green fluorescent callus, 11 seedlings were derived from both red and green fluorescent callus, and 2 seedlings were derived from neither red nor green fluorescent callus.

[0060] Example 3

[0061] In order to identify whether the obtained strains are transgenic strains, this example performs PCR verification on some positive transgenic plants obtained through screening culture, differentiation culture and rooting culture.

[0062] First, the sample DNA was extracted by the CTAB method. The brief steps are as follows: take about 2 cm of rice leaves, add 800 μl 1.5×CTAB, grind to a homogenate, and place in a 65°C water bath for 20-30 minutes, inverting and mixing 3-5 times during the process; centrifuge at 12000rpm for 10 minutes; aspirate the supernatant into a new centrifuge tube, add 2 times the volume of pre-cooled anhydrous ethanol, and place on ice at -20°C for 20 minutes; centrifuge at 12000rpm for 10 minutes, discard the supernatant, and a milky white precipitate can be seen at the bottom of the tube. Rinse with 500 μl 75% ethanol, centrifuge at 8000rpm for 5 minutes, and discard the supernatant; dry for 5-10 minutes, then add 100 μl ddH2O to dissolve the DNA.

[0063] The above primers (c9-FP-jcF / R) and (Do-FP-jcF / R) were used to perform PCR amplification on the genomic DNA samples of the transgenic strains for the gene editing vector and the donor vector, respectively. The amplification process was referred to Example 2. The PCR products were subjected to agarose gel electrophoresis, and the results showed that the expected products could be amplified in most samples, such as Figure 3 As shown, both vectors were successfully transformed into rice.

[0064] Example 4

[0065] Analysis of target site mutations in T0 generation gene-edited plants

[0066] GluA1-F / R and GluA2-F / R were used to perform PCR amplification sampling and detection on some gene editing vector-positive plants in Example 3, and the products were sequenced to detect the gene editing effects of GluA1 and GluA2. The results showed that for the T1 target, among the 18 samples tested, there were 2 homozygous mutations, 8 biallelic mutations, and 2 heterozygous mutations in GluA1, and the mutation efficiency was 66.7%; there was 1 homozygous mutation, 5 biallelic mutations, and 3 heterozygous mutations in GluA2, and the mutation efficiency was 50.0%, and there were 8 mutations in both. For the T3 target, among the 29 samples tested, there were 0 homozygous mutations, 19 biallelic mutations, and 3 heterozygous mutations in GluA1, and the mutation efficiency was 75.9%; there were 9 homozygous mutations, 14 biallelic mutations, and 0 heterozygous mutations in GluA2, and the mutation efficiency was 79.3%, and there were 19 mutations in both. The above results indicate that both T1 and T3 targets have higher efficiency against mutant GluA1 / 2, among which T3 target is superior to T1 target.

[0067] Table 2 GluA-T1T3 target gene editing results

[0068]

[0069] Example 5

[0070] Site-specific integration analysis of T0 generation gene-edited plants;

[0071] Since the T3 target site has a high efficiency, we mainly used the T3 target site vector and the donor vector to co-transform rice ZH11 according to the method in Example 2. The 64 seedlings obtained were tested by PCR using GluA1-F / R and GluA2-F / R. It was found that one strain (31-1 strain) failed to amplify the GluA1 fragment, indicating that this strain may be a homozygous insertion event; further PCR amplification using GluA1-F / Do-R and GluA1-R / Do-F obtained the expected size fragment, confirming that this strain was a homozygous insertion event. Another strain (11-2 strain) was able to amplify the GluA1 fragment, but further PCR amplification using GluA1-F / Do-R and GluA1-R / Do-F also obtained the expected size fragment, indicating that this strain was a heterozygous insertion event, see. Figure 4 The results of sequencing the PCR products of the two events were further confirmed. The sequencing results of the right and left borders are shown in Figure 5 and Figure 6 No insertion event was obtained at the GluA2 site. In summary, we obtained 2 site-specific integration events of very large fragments in 64 individual strains, and the site-specific insertion efficiency reached 3.13%.

[0072] The above results show that not only gluten mutants were obtained by the above method, but also genome-specific integration events were obtained. The method provided by the present invention has the advantages of precision, high efficiency, and large fragments, which greatly facilitates the expression of exogenous genes in plants and provides a basis for improving the agronomic traits of important crops.

[0073] Meanwhile, the contents not described in detail in this specification belong to the prior art known to those skilled in the art.

[0074] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.

[0075] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. The common target sites for efficient gene editing of rice glutenin GluA1 and GluA2, the sequences of which are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

2. An efficient binary vector for transgenic screening of GluA1 / 2 gene editing, characterized in that: The nucleotide sequence of the gene editing vector is shown in SEQ ID NO:

3.

3. The efficient GluA1 / 2 gene editing transgenic screening binary vector according to claim 1, characterized in that: It includes a hygromycin resistance gene, a red fluorescent gene, an sgRNA expression cassette and a Cas9 gene. The sgRNA expression cassette is driven by a rice U6a promoter, and its target sequence is shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the Cas9 protein is driven by a corn ubiqintin promoter.

4. The efficient GluA1 / 2 transgenic screening binary vector according to claim 2, characterized in that: The nucleotide sequence of the vector is shown in SEQ ID NO:

5.

5. A donor gene sequence containing microhomology sequences at the end, comprising a glyphosate resistance gene, a green fluorescent gene, and a donor gene expression cassette, wherein the donor gene expression cassette is the avian influenza H5N6 hemagglutinin protein H5 gene, and the sequence is shown in SEQ ID NO:

4.

6. A method for site-specific integration of exogenous DNA fragments into rice genome, characterized in that: The specific steps include: (1) respectively transferring the vectors comprising claims 2 and 4 into Agrobacterium; (2) mixing the above-mentioned Agrobacterium-infected plant explants in a ratio of 1:3; (3) Double-resistance positive callus was obtained through double screening of hygromycin and glyphosate during the screening process; (4) After obtaining positive callus or differentiating into seedlings, extract genomic DNA for molecular testing to determine the status and efficiency of site-specific integration.

7. The method for site-specific integration of exogenous DNA fragments into rice genome according to claim 6, characterized in that: The Agrobacterium concentration is OD600 between 0.4 and 0.

6.

8. The method for site-specific integration of exogenous DNA fragments into rice genome according to claim 6, characterized in that: The concentrations of hygromycin and glyphosate in the screening process were 50-100 mg / L and 3-5 mM / L, respectively.

9. The method for site-specific integration of exogenous DNA fragments into rice genome according to claim 6, characterized in that: The genomic primers for detecting site-specific integration of GluA1 are GluA1-F / R, and their sequences are shown in SEQ ID NOs: 6 and 7; the genomic primers for detecting site-specific integration of GluA2 are GluA2-F / R, and their sequences are shown in SEQ ID NOs: 8 and 9; and the donor vector primers are Do-F / R, and their sequences are shown in SEQ ID NOs: 10 and 11.

10. The method for site-specific integration of exogenous DNA fragments into rice genome according to claim 6 or 9, characterized in that: Primers GluA1-F / R and GluA2-F / R were used to perform PCR amplification to detect the GluA1 and GluA2 genomes, and GluA1-F / Do-R or GluA1-R / Do-F were used to detect, and GluA2-F / Do-R or GluA2-R / Do-F were used to perform PCR amplification to detect whether there was a GluA1 or GluA2 site-specific insertion. If GluA1-F / R did not amplify the expected band, but GluA1-F / Do-R or GluA1-R / Do-F amplified the expected band, it indicated that a homozygous insertion occurred at the corresponding site. If GluA1-F / R amplified the expected band, GluA1-F / Do-R or GluA1-R / Do-F also amplified the expected band, it indicated that a heterozygous insertion occurred at the corresponding site. The same was true for the GluA2 site.

Images