BnaC06.ADH1 gene and application of protein coded by BnaC06.ADH1 gene in improvement of plant salt tolerance

Abstract

The invention discloses an application of a BnaC06. ADH1 gene and a protein coded by the BnaC06. ADH1 gene in improvement of salt tolerance of plants. A nucleotide sequence of the BnaC06. ADH1 gene is shown as SEQ ID NO: 1, and a CDS sequence of the BnaC06. ADH1 gene is shown as SEQ ID NO: 2. The BnaC06. ADH1 gene is screened and identified, phenotype identification based on an overexpression plant of the BnaC06. ADH1 gene shows that the BnaC06. ADH1 gene can improve the salt stress resistance under salt treatment, it is indicated that the BnaC06. ADH1 gene can positively regulate the salt tolerance of the plant, a new choice is provided for screening dominant stress-resistant genes, and the BnaC06. ADH1 gene has important application value in the field of plant genetic engineering.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to the application of BnaC06.ADH1 gene and the protein encoded by it in improving the salt tolerance of plants. Background Art

[0002] Salinity is one of the major abiotic stresses that affects crop plants and limits global yields. It is estimated that approximately 1.125 billion hectares of land are affected by soil salinization worldwide. Soil salinization is occurring at a rate of ~3ha / min and has become a major problem for irrigated agriculture. Salinity imposes three major limitations on plants: osmotic stress, ion imbalance / toxicity, and oxidative stress. Studies have shown that ADH activity is associated with osmotic stress in crops.

[0003] Rapeseed is one of the most important oil crops in the world, and its planting areas are widely distributed. Rapeseed has multifunctional application value. In addition to the traditional use of oil and rapeseed cake as feed / fertilizer, fresh rapeseed can also be used as feed, fertilizer or vegetable (rapeseed stalks), honey, and tourism during the flowering period. Cultivation experiments have verified that rapeseed has excellent salt tolerance, which can improve saline-alkali soil and increase the supply of edible oil. However, for a long time, the salt tolerance gene mining of rapeseed in my country has been relatively small.

[0004] The present invention uses salt stress transcriptome data analysis of salt-tolerant rapeseed variety Huayouza62 and salt-intolerant variety Zhongshuang11 (ZS11) during germination to screen out significant differential expression of BnaADH1. Currently, there are no reports on the number of members, gene and CDS sequences, relationship with salt resistance, and application in genetic engineering of BnaADH1 gene in Brassica napus. Summary of the invention

[0005] The object of the present invention is to provide an application of the BnaC06.ADH1 gene and the protein encoded by the gene in improving the salt tolerance of plants. The present invention obtains a transgenic material with Brassica napus Zhongshuang11 as a receptor through Agrobacterium-mediated genetic transformation. Studies have found that overexpression of the Brassica napus BnaC06.ADH1 gene can improve the salt tolerance of Brassica napus during the germination period. Therefore, the BnaC06.ADH1 gene can be applied to rapeseed breeding to improve the salt tolerance of Brassica napus, providing an ideal approach for cultivating new salt-resistant Brassica napus varieties.

[0006] In order to achieve the above purpose, this application adopts the following technical solutions:

[0007] In a first aspect, the present invention provides an application of the BnaC06.ADH1 gene in improving plant salt tolerance, wherein the nucleotide sequence of the BnaC06.ADH1 gene is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:2.

[0008] In a second aspect, the present invention provides a use of a protein encoded by the BnaC06.ADH1 gene in improving plant salt tolerance, wherein the amino acid sequence of the protein encoded by the BnaC06.ADH1 gene is shown in SEQ ID NO:3.

[0009] In the above technical solution, the plant includes a plant of the genus Brassica in the family Cruciferae.

[0010] In the above technical solution, the plant includes Brassica napus.

[0011] In a third aspect, the present invention provides the use of a biological material related to the above-mentioned BnaC06.ADH1 gene or a protein encoded by the above-mentioned BnaC06.ADH1 gene in improving plant salt tolerance, wherein the biological material is any one of the following:

[0012] a) an expression cassette containing a DNA fragment having a nucleotide sequence as shown in SEQ ID NO: 1;

[0013] b) a recombinant vector containing a DNA fragment having a nucleotide sequence as shown in SEQ ID NO: 1;

[0014] c) recombinant microorganisms, recombinant cells, transgenic plant tissues or transgenic plants containing the recombinant vector described in item b);

[0015] d) tissue cultures or protoplasts produced from regenerable cells of the transgenic plant as described in c).

[0016] In the above scheme, the recombinant vector is an overexpression vector.

[0017] In a fourth aspect, the present invention provides a method for improving plant salt tolerance, wherein the BnaC06.ADH1 gene or an expression vector encoding the gene is introduced into a plant cell, wherein the nucleotide sequence of the BnaC06.ADH1 gene is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:2.

[0018] In the above technical solution, the expression vector includes pCAMBIA2300.

[0019] In a fifth aspect, the present invention provides the use of the BnaC06.ADH1 gene or an overexpression vector comprising the BnaC06.ADH1 gene in cultivating salt stress-tolerant transgenic plants, wherein the nucleotide sequence of the BnaC06.ADH1 gene is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:2.

[0020] In the above technical solution, the plant includes Brassica napus.

[0021] The beneficial effect of the present invention is that the present invention screened and identified the BnaC06.ADH1 gene, and the phenotypic identification based on its overexpression plants showed that it can improve the salt stress resistance under salt treatment, indicating that the BnaC06.ADH1 gene can positively regulate the salt tolerance of plants, providing a new option for screening superior stress resistance genes, and has important application value in the field of forest genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : A gel image showing the positive identification of the recombinant plasmid cloned with the BnaC06.ADH1 gene in the cDNA of Brassica napus. Explanation of the accompanying drawings: The size of the DNA Marker bands (2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp from top to bottom).

[0023] Figure 2 :Temporal expression pattern of BnaC06.ADH1 gene under different salt concentration stresses.

[0024] Figure 3 :Schematic diagram of the construction of pCAMBIA2300-BnaC06.ADH1 overexpression vector.

[0025] Figure 4 : Positive identification gel image of regenerated plants genetically transformed with pCAMBIA2300-BnaC06.ADH1 overexpression vector.

[0026] Figure 5 : The expression levels of BnaC06.ADH1 overexpression positive plants and ZS11 under 0.0% and 1.0% NaCl conditions.

[0027] Figure 6 : Phenotypes of BnaC06.ADH1 overexpression positive plants and ZS11 germinated for 7 days under 0.0% and 1.0% NaCl conditions.

[0028] Figure 7 : Root length phenotype statistics of BnaC06.ADH1 overexpression positive plants and ZS11 germinated for 7 days under 0.0% and 1.0% NaCl conditions.

[0029] Figure 8 : Phenotypic statistics of hypocotyls of BnaC06.ADH1 overexpression positive plants and ZS11 germinated for 7 days under 0.0% and 1.0% NaCl conditions. DETAILED DESCRIPTION

[0030] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. The present invention can be implemented in many different forms and should not be construed as being limited to the embodiments set forth herein. On the contrary, these embodiments are provided so that this disclosure will be thorough and complete, and the concept of the present invention will be fully conveyed to those skilled in the art, and the present invention will only be limited by the claims.

[0031] Example 1 Cloning and overexpression vector construction of BnaC06.ADH1 gene and expression analysis under salt stress

[0032] 1. RNA extraction and cDNA acquisition

[0033] Zhongshuang11 seedlings germinated for 7 days under 0.0%, 0.4%, 0.8%, 1.0% (CK, T1, T2, T3) NaCl treatment conditions were taken in liquid nitrogen. Three individual plants were used as a biological replicate. RNA was extracted using a kit (Promega), and cDNA was synthesized using 3 μg RNA as a template (Thermo Fisher). Each cDNA was diluted to 500 μL and stored at -20°C for use.

[0034] 2. Using cDNA as template and pCAMBIA2300 vector plasmid as backbone, PCR amplification was performed using the following primers to construct the BnaC06.ADH1 overexpression vector pCAMBIA2300-BnaC06.ADH1( Figure 3 ):

[0035] pCAMBIA2300-BnaC06.ADH1-F:gatagccactgcaggtcgactctagagATGAAAAAATTAGATGGTGAGATTAA;

[0036] pCAMBIA2300-BnaC06.ADH1-R: agcttgtcgagaattcgagctcggtacTCAAGCACCCATGTCGATGACG (SEQ ID NO: 4-5).

[0037] The PCR reaction conditions were as follows: 98°C pre-denaturation for 3 min; 98°C for 10 sec, 56°C for 30 sec, 72°C for 15 sec, 34 cycles; 72°C extension for 5 min. The PCR product was recovered using a purification recovery kit (Tiangen) and connected to the pCAMBIA2300 vector at 37°C for 30 min using the homologous recombination method (homologous recombination enzyme purchased from Novezan). The restriction sites of pCAMBIA2300 were F: BamHI and R: SalⅠ, and the restriction enzymes were digested in a water bath at 37°C using Thermo Fisher restriction enzymes, and purified and recovered using a purification recovery kit (Tiangen).

[0038] 3. The recombinant plasmid was transformed into DH5α (Qingke Biotechnology) by heat shock transformation method, and single clones were picked for PCR positive detection after 10-12 hours ( Figure 1 ) and sent to Qingke Biotechnology for sequencing. The sequencing primers are as follows:

[0039] pCAMBIA2300-BnaC06.ADH1-F:

[0040] gatagccactgcaggtcgactctagagATGAAAAAATTAGATGGTGAGATTAA(SEQ ID NO:4)

[0041] M13-48:AGCGGATAACAATTTCACACAGGA(SEQ ID NO:6)

[0042] By comparing the sequencing results with the ZS11 reference genome, it was determined that its coding sequence is shown in SEQ ID NO:2, and the protein sequence encoded by the gene is shown in SEQ ID NO:3.

[0043] The correct recombinant plasmid was introduced into Agrobacterium strain GV3101 by conventional freeze-thaw method.

[0044] 4. Analysis of the expression pattern of BnaC06.ADH1 gene under salt stress

[0045] Using the diluted cDNA obtained in step 1 as a template, design primers:

[0046] Qpcr-ADH1-F: CAACAGCACCAAGACCGAAA

[0047] Qpcr-ADH1-R:GGCAAACCCATTCACCACTT(SEQ ID NO:7-8)

[0048] and BnaActin primers

[0049] BnaActin-F:GTACTGAGTCTGCAAAGAGAGG

[0050] BnaActin-R: TTCGCTTCATGATCACAGACAT (SEQ ID NO:9-10)

[0051] It was used as an internal reference primer for relative quantitative analysis.

[0052] The results are as follows Figure 2 As shown, the expression level of BnaC06.ADH1 gene increased significantly under salt stress, indicating that it can respond to salt stress.

[0053] Example 2 Transformation of BnaC06.ADH1 gene and screening and identification of positive plants

[0054] The tested material was Brassica napus ZS11.

[0055] The specific steps are as follows:

[0056] (1) Brassica napus seeds ZS11 were sterilized with 0.1% mercuric chloride solution for 10-12 min, and then rinsed with sterile water for 3-4 times. The seeds were sown in M0 medium and cultured in the dark for 7 days.

[0057] (2) On the evening of the sixth day, take out Agrobacterium GV3101 containing pCAMBIA2300-BnaC06.ADH1 stored in a -80°C refrigerator, inoculate the bacteria in 50 mL of LB medium containing kanamycin and gentamicin, and culture overnight in a shaking incubator at 28°C and 200 rpm. Collect the colonies and suspend them in acetosyringone (AS) as a suspension.

[0058] (3) The hypocotyls of dark-cultured Brassica napus were cut into small segments of 0.5-1 cm and infected with the suspended Agrobacterium for 10 min.

[0059] (4) The infected hypocotyls were placed in M1 medium (specific components are described later) and cultured in the dark for 24 h.

[0060] (5) After the co-cultivation, the cells were inoculated into M2 medium (specific components are described below) and cultured in a light culture room (16 h light, 8 h dark, temperature 22°C).

[0061] (6) After 2 weeks, the cells were inoculated into M3 medium (specific components are described below) and cultured in a light culture room (16 h light, 8 h dark, temperature 22°C).

[0062] (7) The redifferentiated tissue culture seedlings are inoculated into M4 medium (specific components are described later) until complete plants are obtained.

[0063] (8) Transplant the rooted plants into pots and extract DNA for positive identification.

[0064] (9) Extract RNA from positive plants and perform qRT-PCR to detect relative expression levels.

[0065] The results are as follows Figure 4 , Figure 5 As shown, the BnaC06.ADH1 gene was successfully overexpressed in the positive plants.

[0066] The culture medium formula used in this example

[0067] LB medium: Trypone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0068] M0 medium: MS 2.2 g / L, sucrose 15 g / L, agar powder 6 g / L, adjust pH to 5.9-6.0.

[0069] M1 medium: MS 4.4g / L, sucrose 30g / L, mannitol 18g / L, 2,4-D 1000μL / L, KT 1000μL / L, agar powder 6g / L, adjust pH to 5.9-6.0. After sterilization, add AS and aliquot for later use.

[0070] M2 medium: MS 4.4g / L, sucrose 30g / L, mannitol 18g / L, 2,4-D 1000μL / L, KT 1000μL / L, agar powder 6g / L, adjust pH to 5.9-6.0. After sterilization, add TMT, kanamycin and STS and aliquot for later use.

[0071] M3 medium: MS 4.4g / L, glucose 10g / L, xylose 0.25g / L, MES 0.6g / L, agar powder 6g / L, pH adjusted to 5.9-6.0. After sterilization, add TMT, anti-zeatin, kanamycin and auxin and dispense for later use.

[0072] M4 medium: MS 4.4g / L, sucrose 10g / L, agar powder 6g / L, adjust pH to 5.9-6.0. After sterilization, add kanamycin and aliquot for later use.

[0073] The basic MS culture medium formula described in the above culture medium formula is: macroelements (KNO3 1.9g / L, NH4NO31.65g / L, KH2PO4 0.17g / L, MgSO4﹒7H2O 0.37g / L, CaCl2﹒2H2O0.44g / L), trace elements (KI 0.83mg / L, H3BO3 6.2mg / L, MnSO4﹒4H2O22.3mg / L, ZnSO4﹒7H2O 8.6mg / L, Na2MoO4﹒2H2O0.25mg / L, CuSO4﹒5H2O0.025mg / L, CoCl2 0.025mg / L), iron salts (Na2﹒EDTA 37.3mg / L, FeSO4﹒7H2027.8mg / L), organic components (inositol 100mg / L, Gly 2mg / L, VB 10.1mg / L, VB 60.5mg / L, VB50.5mg / L).

[0074] Example 3 Study on the salt tolerance function of BnaC06.ADH1

[0075] pCAMBIA2300-BnaC06.ADH1 was transferred into Brassica napus ZS11 by Agrobacterium-mediated genetic transformation. The recipient ZS11 was used as the control material, and the positive families OE-ADH1_5 and OE-ADH1_1 were used as the experimental groups. 0.0% NaCl was used as the control, and 1.0% NaCl was used as the experimental group for 7 days of germination stress treatment (16 hours of light, 8 hours of darkness, temperature 22°C).

[0076] Example 4 Phenotypic Observation

[0077] Phenotypic observations and statistics were performed on Example 3. The salt tolerance phenotype was observed in the transgenic T2 generation and compared with the ZS11 variety to verify the function of the introduced candidate gene. The phenotype is shown in the attached Figure 6 The results showed that in the transgenic positive T2 generation plants, both overexpression lines significantly enhanced the salt tolerance of rapeseed during the germination period. Figure 6 This is the transgenic line and Z11 phenotype after germination for one week. Figure 7 and Figure 8 The statistical results of hypocotyl and root length under 0.0% NaCl and 1.0% NaCl conditions were shown in Figure 1. Finally, it was determined that BnaC06.ADH1 can significantly enhance the salt tolerance of rapeseed during the germination period and is a positive regulatory gene for salt tolerance of rapeseed.

[0078] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. Application of BnaC06.ADH1 gene in improving plant salt tolerance, characterized in that: The nucleotide sequence of the BnaC06.ADH1 gene is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:

2.

2. Application of the protein encoded by the BnaC06.ADH1 gene in improving plant salt tolerance, characterized in that: The amino acid sequence of the protein encoded by the BnaC06.ADH1 gene is shown in SEQ ID NO:

3.

3. The use according to any one of claims 1-2, characterized in that: The plants include plants of the genus Brassica in the family Cruciferae.

4. The use according to any one of claims 1-2, characterized in that: The plants include Brassica napus.

5. Use of a biological material related to the BnaC06.ADH1 gene of claim 1 or the protein encoded by the BnaC06.ADH1 gene of claim 2 in improving plant salt tolerance, characterized in that: The biological material is any of the following: a) an expression cassette containing a DNA fragment having a nucleotide sequence as shown in SEQ ID NO: 1; b) a recombinant vector containing a DNA fragment having a nucleotide sequence as shown in SEQ ID NO: 1; c) recombinant microorganisms, recombinant cells, transgenic plant tissues or transgenic plants containing the recombinant vector described in item b); d) tissue cultures or protoplasts produced from regenerable cells of the transgenic plant as described in c).

6. The application according to claim 5, characterized in that: The recombinant vector is a knockout vector, a knockdown vector or an overexpression vector.

7. A method for improving plant salt tolerance, characterized in that: The BnaC06.ADH1 gene or an expression vector encoding the same is introduced into plant cells. The nucleotide sequence of the BnaC06.ADH1 gene is shown in SEQ ID NO: 1, and the CDS sequence is shown in SEQ ID NO:

2.

8. The method according to claim 7, characterized in that: The expression vector includes pCAMBIA2300.

9. Use of the BnaC06.ADH1 gene or an overexpression vector comprising the BnaC06.ADH1 gene in cultivating salt stress-tolerant transgenic plants, characterized in that: The nucleotide sequence of the BnaC06.ADH1 gene is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:

2.

10. The use according to claim 9, characterized in that: The plants include Brassica napus.

Images