Saccharomyces cerevisiae and application thereof in clostridium butyricum fermentation

Abstract

The invention belongs to the technical field of micro-ecology, and provides saccharomyces cerevisiae as well as a method and application thereof in clostridium butyricum fermentation. The invention provides a Saccharomyces cerevisiae strain, and the preservation number of the Saccharomyces cerevisiae strain is CGMCC (China General Microbiological Culture Collection Center) No. 17260. The invention also provides a mixed fermentation method of the saccharomyces cerevisiae and clostridium butyricum. According to the method, the fermentation time of the clostridium butyricum can be shortened, the fermentation cost is reduced, and the viable count and the spore count of the fermented clostridium butyricum are high.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a strain of brewer's yeast and a method and application thereof in Clostridium butyricum fermentation. Background Art

[0002] At present, aquaculture has a high density and a large amount of feeding, but most aquaculture animals have short intestines, simple digestive organs, and weak digestive capacity. For example, shrimps have only hepatopancreas in their digestive system, which is prone to enteritis in poor water or bottom conditions, manifested by redness of the hepatopancreas and intestines, and sticky and thin jejunum and feces.

[0003] Clostridium butyricum, also known as butyric acid bacteria or Miyari bacteria, is a strict anaerobic bacterium that can quickly colonize and reproduce in the intestines of aquatic animals. The rich short-chain fatty acids it produces can be quickly utilized as an energy source, repair intestinal mucosal damage, resist the stress of adverse environments, and enhance animal immunity; the digestive enzymes it produces can promote the digestion and absorption of nutrients by the intestine and improve feed utilization, and it is an important probiotic in the animal intestine. This strain requires absolute anaerobic conditions during the fermentation process, otherwise there will be problems such as a long fermentation lag period, a small number of bacteria in the fermentation liquid, low strain activity, and a low spore rate. Most studies have improved the strain activity and spore production rate by introducing nitrogen, using a large amount of composite culture medium, or by adding culture medium during the fermentation process. However, these methods are costly and complex, and mixed fermentation of Clostridium butyricum with other aerobic strains is a simple and effective way. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a Saccharomyces cerevisiae strain, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, and the preservation time is February 25, 2019; the classification name is: Saccharomyces cerevisiae; the address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the preservation number is CGMCC No.17260.

[0005] Furthermore, the ITS sequence of the Saccharomyces cerevisiae is shown as SEQ ID No.1.

[0006] The invention also provides a Clostridium butyricum fermentation method, which comprises mixing Clostridium butyricum with the brewer's yeast for fermentation, and when the Clostridium butyricum transsporulation rate is greater than 90%, raising the temperature to inhibit or kill the yeast, thereby stopping the fermentation.

[0007] Further, the Clostridium butyricum fermentation method comprises the following steps:

[0008] (1) Prepare fermentation medium, adjust pH to 7.5-8.0, and sterilize at 115°C for 30 min.

[0009] (2) Seed solution preparation: Prepare Clostridium butyricum and Saccharomyces cerevisiae seed solutions respectively, inoculate them into the fermentation medium and mix them evenly.

[0010] (3) Fermentation parameter control: fermentation temperature 33-37°C, tank pressure 0.02-0.05Mpa, deep static fermentation.

[0011] (4) Yeast heating treatment: When the fermentation rate of Clostridium butyricum is greater than 90%, heat at 60-65°C for 20 minutes.

[0012] (5) Stop fermentation when the temperature drops to 37°C. The total fermentation time is 20 to 21 hours.

[0013] Furthermore, in the step (2), the first-level seed solution of Clostridium butyricum is heated, the inoculation amount of the second-level seed solution is 2%, and the fermentation time is 14 to 18 hours, preferably 14 hours.

[0014] Furthermore, in the step (2), the inoculation ratio of the acid Clostridium to the cerevisiae Saccharomyces cerevisiae is 2:(1-4), preferably 2:2.

[0015] The present invention also provides a composite microecological preparation, which is prepared by fermenting the Clostridium butyricum and the Saccharomyces cerevisiae.

[0016] The present invention also provides the use of the composite microecological preparation in the preparation of medicines or feeds for preventing and treating intestinal diseases of white shrimp. Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention provides a strain of brewer's yeast, which can be combined with Clostridium butyricum for high-density fermentation without anaerobic fermentation equipment, and can shorten the industrial fermentation time of Clostridium butyricum by 10 hours (fermentation time is shortened from 30 hours to 20 hours), reduce the fermentation cost, and achieve a viable bacterial count of 9.02×10 8 cfu / mL, spore production rate>90%. It has been proven that this liquid microecological preparation can effectively alleviate the jejunal problems of shrimp. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a comparison chart of fermentation rates of different Clostridium butyricum;

[0019] Figure 2 The effect of the inoculum size of Clostridium butyricum on the fermentation start-up speed;

[0020] Figure 3 The effect of buffer and Tween 80 on the fermentation start-up rate;

[0021] Figure 4Comparison of the growth curves of Clostridium butyricum (A) and Saccharomyces cerevisiae (B);

[0022] Figure 5 This is a diagram showing the effect of mixed fermented microecological preparations on improving the jejunum of shrimp. DETAILED DESCRIPTION

[0023] The embodiments of the present invention will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. If specific conditions are not specified in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0024] The effect of the present invention is studied below through specific embodiments:

[0025] Example 1: Mixed fermentation of Clostridium butyricum and Saccharomyces cerevisiae

[0026] 1. Comparison of fermentation start-up speed of different Clostridium butyricum strains

[0027] Clostridium butyricum is a strict anaerobe, but strains with higher oxygen tolerance can be obtained by deep static fermentation. In this experiment, 10 strains of Clostridium butyricum were screened by fermentation. The OD value of the fermentation liquid was detected after 6 hours. 600 The strain with the fastest fermentation start-up speed was selected as the Clostridium butyricum strain in the mixed fermentation. The inoculation amount was 1%, the fermentation temperature was 37℃, and the results were as follows Figure 1 As shown, DBNDS3 was determined to be a strain for mixed fermentation of Clostridium butyricum. Clostridium butyricum DBNDS3 is a strain owned by our laboratory, see patent CN202311192104.2 for details, deposited at the General Microbiological Center (CGMCC) of the China Microbiological Culture Collection Administration; deposited at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; deposited on June 16, 2022, deposited at CGMCC No. 25100.

[0028] 2. Effect of Clostridium butyricum inoculation amount on fermentation start-up speed

[0029] In this example, the fermentation start-up speed of Clostridium butyricum was evaluated by OD 600 As an evaluation index, a method for producing Clostridium butyricum seed and the optimal inoculation amount were provided. A single colony of Clostridium butyricum DBNDS3 was selected and inoculated into 150 mL of modified RCM medium, and fermented at 37°C for 24 hours to obtain seed liquid, which was heated at 80°C for 10 minutes and not heated, respectively, and three inoculation amounts of 1%, 2%, and 3% were set. Figure 2As shown, the OD of the treatment group with 8h fermentation, heating treatment of seed solution and 2% inoculation amount 600 Higher value.

[0030] Improved RCM medium: peptone 10.0 g / L, beef powder 10.0 g / L, yeast powder 3.0 g / L, glucose 5.0 g / L, soluble starch 1.0 g / L, sodium chloride 5.0 g / L, sodium acetate 3.0 g / L, L-cysteine ​​hydrochloride 0.5 g / L, agar 0.5 g / L, Tween 80 1 mL.

[0031] 3. Effects of buffer and Tween 80 on fermentation start-up speed

[0032] No additional substances were added as the control, and ammonium citrate was used as the buffer substance. Three treatments were set up, including adding 2% ammonium citrate, 1% Tween 80, and both. 600 The effects of buffer substances and Tween 80 on the fermentation start-up rate were analyzed as indicators. Figure 3 As shown, the results showed that after 6 hours of fermentation, the bacterial concentrations in the treatment groups with single addition of Tween 80 and addition of Tween 80 and buffer substances were higher, but the bacterial growth in the treatment group with single addition of buffer substances was weaker than that in the control, indicating that the addition of Tween 80 can accelerate the fermentation start-up speed.

[0033] 4. Selection of yeast for mixed fermentation with Clostridium butyricum

[0034] (1) Yeast screening

[0035] Healthy sea bass and shrimp intestinal samples were placed in a grinder, and an appropriate amount of sterile saline was added to the grinder to grind into a homogenate, which was diluted and spread on Bengal red culture medium and cultured at 30°C for 2 to 3 days. Different types of ripe fruit samples (crabapple, grape, apple, jujube, peach, plum) were taken (peel and pulp), mashed to take 2.0 g, added to a centrifuge tube containing 5 mL of sterile saline, and allowed to ferment at 30°C until a distinct wine aroma was produced, diluted and spread on malt extract agar culture medium, and cultured at 30°C for 3 days. Milky white colonies with neat edges, round shapes, and protrusions were selected for isolation and purification, and morphological observation was performed. As a result, a total of 77 yeast strains were isolated.

[0036] (2) Gas production capacity evaluation

[0037] The gas production capacity of yeast can reflect its fermentation performance to a certain extent. 77 yeast strains were inoculated into YPD liquid medium containing Dulbecco's tubules at a 1% inoculation rate to measure the gas production capacity. After 18 hours of fermentation, 12 strains with 75% to 100% empty Dulbecco's tubules were initially screened out, as shown in Table 1. Among them, Y4, Y8, Y15, Y16, Y59, and Y75 reached full tubes in 16 hours, and the fermentation cycle was short.

[0038] Table 1 Evaluation of yeast fermentation speed

[0039]

[0040] Note: + means the gas production reaches 25% of the Dulbecco's tubules, ++ means the gas production reaches 50% of the Dulbecco's tubules, +++ means the gas production reaches 75% of the Dulbecco's tubules, and ++++ means the gas production reaches 100% of the Dulbecco's tubules.

[0041] (3) Low pH resistance test

[0042] The six yeast strains with faster fermentation speed were inoculated with 1% inoculation into YPD medium with pH values ​​of 1.0, 2.0, 3.0, 4.0, and 5.0, cultured at 30°C and 180 rpm for 24 hours, and then diluted and spread to determine the number of viable bacteria. The results are shown in Table 2. Y4, Y8, Y59, and Y75 can adapt to a wide range of acidic environments.

[0043] Table 2 Results of yeast strains resistant to low pH

[0044]

[0045] (4) ITS sequence determination

[0046] ITS sequence determination and comparison showed that strains Y4 and Y8 were most similar to Saccharomyces cerevisiae, both isolated from the intestine of sea bass, while strains Y59 and Y75 were most similar to Hansenia sporapseudoguilliermondii, isolated from apple and grape.

[0047] 5. Effect of composite fermentation of different yeasts and Clostridium butyricum on the number of viable Clostridium butyricum

[0048] Clostridium butyricum DBNDS3 was fermented with four selected yeast strains (Y4, Y8, Y59 and Y75) in a triangular flask, and the control group (CK) was fermented with Clostridium butyricum alone.

[0049] (1) Preparation and sterilization of fermentation medium. The fermentation medium consists of: peptone 10.0 g / L, yeast powder 3.0 g / L, glucose 5.0 g / L, tapioca starch 1.0 g / L, sodium chloride 5.0 g / L, sodium acetate 3.0 g / L, L-cysteine ​​hydrochloride 0.5 g / L, agar 0.5 g / L, Tween 80 1 mL. pH 7.5-8.0, sterilized at 115°C for 30 min.

[0050] (2) Seed solution preparation:

[0051] Preparation of Clostridium butyricum seed solution: The Clostridium butyricum strain was inoculated from the glycerol tube onto the solid culture medium, cultured anaerobically at 37°C for 24 hours, and activated by streaking twice. Pick a single colony in the primary seed production medium and ferment at 37°C for 24 hours. Then heat at 80°C for 10 minutes, transfer 2% inoculation to the secondary seed production medium, and culture at 37°C for 14 hours to complete the secondary seed production. The culture medium for preparing Clostridium butyricum seed solution is: peptone 10.0g / L, beef powder 10.0g / L, yeast powder 3.0g / L, glucose 5.0g / L, soluble starch 1.0g / L, sodium chloride 5.0g / L, sodium acetate 3.0g / L, L-cysteine ​​hydrochloride 0.5g / L, agar 0.5g / L, Tween 80 1mL.

[0052] Preparation of Saccharomyces cerevisiae seed solution: Saccharomyces cerevisiae strain was inoculated from the glycerol tube onto solid culture medium, streaked and activated twice, and two single colonies were picked into 150 mL YPD liquid culture medium and cultured at 28°C, 180 rpm for 16 h. The culture medium for seed solution preparation was: peptone 10 g / L, yeast powder 5 g / L, glucose 20 g / L. The inoculation amount of the secondary seed solution was 2%.

[0053] (3) Mixed fermentation: Clostridium butyricum and yeast were inoculated into the fermentation medium at a ratio of 2%:2% and mixed evenly. The fermentation temperature was 33-37°C, and the fermentation was allowed to stand in an incubator for 24 hours. The number of live bacteria was counted using iron sulfite agar medium.

[0054] The results are shown in Table 3. Compared with the control fermentation of Clostridium butyricum alone, the number of viable bacteria in the mixed fermentation of Saccharomyces cerevisiae Y4 and Clostridium butyricum was the highest.

[0055] Saccharomyces cerevisiae Y4 was named LMY and deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on February 25, 2019; the classification name was Saccharomyces cerevisiae; the address was No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the deposit number was CGMCC No. 17260. After ITS sequence determination, the ITS sequence of Saccharomyces cerevisiae Y4 was shown in SEQ ID No. 1.

[0056] Table 3 Effect of mixed fermentation of different yeast strains and Clostridium butyricum on the number of viable Clostridium butyricum

[0057]

[0058] 6. Determination of growth curves of Clostridium butyricum and Saccharomyces cerevisiae

[0059] To provide better parameter support for the mixed fermentation of the two strains, the growth curves of Clostridium butyricum DBNDS3 (A) and Saccharomyces cerevisiae Y4 (B) were determined. Figure 4As shown, 8-9h is the late logarithmic growth stage of Clostridium butyricum, and 14-16h is the late logarithmic growth stage of Saccharomyces cerevisiae.

[0060] 7. Effect of Clostridium butyricum age on mixed fermentation

[0061] When the fermentation of Clostridium butyricum DBNDS3 reaches the stable period, spores begin to form. Only when it develops into mature spores, that is, completely becomes a hollow dormant body, will it have better resistance to the harsh external environment and a higher survival rate. The seed liquid of Clostridium butyricum fermented for 6h, 8h, 10h, 12h, 14h, and 18h ​​was mixed with the seed liquid of Saccharomyces cerevisiae fermented for 14h, and the inoculation ratio was (2%:1%). The fermentation temperature was 37℃, and the culture was static for 24h. The count was analyzed to analyze the effect of seed age on the mixed fermentation of Clostridium butyricum DBNDS3 and Saccharomyces cerevisiae Y4. The results showed that the seed age of Clostridium butyricum significantly affected the effect of mixed fermentation with Saccharomyces cerevisiae. The number of viable Clostridium butyricum was the highest after mixed fermentation of 14h seed liquid with Saccharomyces cerevisiae, reaching 7.08×10 8 cfu / mL, as shown in Table 4.

[0062] Table 4 Effect of the age of Clostridium butyricum on mixed fermentation of Clostridium butyricum and Saccharomyces cerevisiae

[0063]

[0064]

[0065] 8. Effect of the ratio of mixed fermentation of Clostridium butyricum and Saccharomyces cerevisiae on the number of viable Clostridium butyricum

[0066] The inoculation amount of Clostridium butyricum DBNDS3 was 2%, and different inoculation ratios of Saccharomyces cerevisiae Y4 (2:0.25, 2:0.5, 2:1, 2:2, and 2:4) were set for mixed fermentation at 37°C. The number of live butyric acid bacteria was detected for 24 hours. Results When the ratio of Clostridium butyricum to Saccharomyces cerevisiae was 2:2, the number of live Clostridium butyricum was the highest, reaching 9.5×10 8 cfu / mL, as shown in Table 5.

[0067] Table 5 Effect of inoculation ratio of Clostridium butyricum and yeast strains on the number of viable Clostridium butyricum

[0068]

[0069] 9. Effect of initial pH on mixed fermentation

[0070] The initial pH was set at 5.5, 6.0, 6.5, 7.0, 7.5, 8.0 and 8.5 respectively, and Clostridium butyricum DBNDS3 and Saccharomyces cerevisiae Y4 were mixed and fermented at 37°C. The results showed that the number of live bacteria of Clostridium butyricum fermentation was the highest when the pH was 7.5-8.0, as shown in Table 6.

[0071] Table 6 Effect of different initial pH on mixed fermentation

[0072]

[0073] 10. Effect of temperature on mixed fermentation

[0074] The fermentation temperature was set at 30℃, 35℃, 37℃, 40℃, and 45℃, pH was 7.5, and Clostridium butyricum DBNDS3 and Saccharomyces cerevisiae Y4 were mixed and fermented for 24 hours. The results showed that the number of live Clostridium butyricum was the highest when the fermentation temperature was 37℃, as shown in Table 7.

[0075] Table 7 Effect of different fermentation temperatures on the number of viable Clostridium butyricum in mixed fermentation

[0076]

[0077] Example 2: Comparison of results of single-bacterium fermentation and mixed industrial fermentation of Clostridium butyricum

[0078] 1. Fermentation of Clostridium butyricum

[0079] The fermentation medium and the seed production method are detailed in Example 1 (point 5), with a liquid volume of 60%, an inoculum size of 2%, and static fermentation at 37°C. During the fermentation gas production stage, the tank pressure is controlled to be 0.01-0.02 MPa. When more than 90% of the bacteria in the field of view have sporulated, the fermentation is stopped, and the number of live bacteria and spores is counted (the statistical method of the number of spores: after the fermentation liquid is treated at 85°C for 10 minutes, iron sulfite agar medium is used for statistical counting).

[0080] 2. Mixed fermentation method of Clostridium butyricum and Saccharomyces cerevisiae in fermentation tank

[0081] (1) Sterilization of fermentation medium: Prepare fermentation medium, fill with 60% liquid, adjust pH to 7.5-8.0, sterilize at 115°C for 30 min. Sterilization parameter control: The speed is 50-60 rpm before the medium temperature reaches 90°C, and the speed is adjusted to 0 after 90°C. After sterilization, stop stirring, do not pass steam, and try to reduce dissolved oxygen. The components of the mixed fermentation medium are detailed in Example 1 (point 5).

[0082] (2) Seed production method: See Example 1 (point 5) for details.

[0083] (3) Inoculation: Clostridium butyricum and Saccharomyces cerevisiae are inoculated into the fermentation medium in sequence. The inoculation amount of Clostridium butyricum is 2% to 4%, and the inoculation amount of Saccharomyces cerevisiae is 1.5 to 2.0%. Preferably, the inoculation amounts of Clostridium butyricum and Saccharomyces cerevisiae are 2% respectively.

[0084] (4) Fermentation control: The pH value was adjusted to 6.0-6.5 for 6-16 hours of fermentation. The fermentation temperature was 33-37°C. The fermentation was stopped when the spore exudation rate of Clostridium butyricum in the field of view was about 90% or more. The number of live bacteria and spores was counted in the same way as above. The results showed that the number of live Clostridium butyricum in mixed fermentation was significantly higher than that in single fermentation, with the number of live bacteria reaching 9.02×10 8 cfu / mL, as shown in Table 8. The composite fermentation method significantly shortens the industrial fermentation time, and the whole fermentation time is shortened by 10 hours compared with single bacteria fermentation.

[0085] Table 8 Comparison of single-bacteria fermentation and mixed fermentation results

[0086]

[0087] Example 3: Comparison of heating effects of mixed fermentation of Clostridium butyricum and Saccharomyces cerevisiae

[0088] Control group: Clostridium butyricum DBNDS3 and Saccharomyces cerevisiae Y4 were mixed and fermented for 20-21 hours, the spore exudation rate of Clostridium butyricum was greater than 90%, and 50% of the fermentation liquid was filled.

[0089] Experimental group: The remaining 50% of the fermentation liquid was heated at 60-65°C for 20 min to inactivate the brewer's yeast, and the temperature was lowered to 37°C to stop the fermentation.

[0090] The appearance was observed and the number of live bacteria was counted every 30 days, and the test was continued for 3 months. As shown in Table 9, the results showed that after 3 months, the properties of the fermentation liquid treated with heating were better than those without heating treatment, and the bottle did not swell, the fermentation liquid had precipitation but could be mixed evenly, and there was no flocculent precipitation. The number of live Clostridium butyricum was 7.2×10 8 cfu / mL, which is better than no heating treatment.

[0091] Table 9 Comparison of the effects of heating treatment on the shelf life of Clostridium butyricum

[0092]

[0093]

[0094] Example 4: Effects of mixed fermentation of Clostridium butyricum and Saccharomyces cerevisiae on the intestinal health of shrimp

[0095] Location: Dongshan County, Zhangzhou City, Fujian Province. Two whiteleg shrimp ponds with similar breeding conditions have shown that the shrimps eat slowly and have empty intestines.

[0096] Control pond: Daily feeding amount reduced by 1 meal

[0097] Test pond: Reduce the daily feeding amount by one meal, mix the fermentation liquid of Clostridium butyricum and Saccharomyces cerevisiae with the shrimp feed and feed it. Mix and feed once a day for 3 consecutive days (1L fermentation liquid mixed with 20kg shrimp feed). Observe the shrimp's feeding situation after 3 days. The results show that the shrimp's feeding situation has returned to normal, the jejunal phenomenon has improved significantly, and the intestines are clear and full. Figure 5 shown.

[0098] The above description is only a preferred embodiment of the present invention. For those skilled in the art, without departing from the technical principle of the present invention, improvements or modifications that are the same or similar to the present invention should also be regarded as within the protection scope of the present invention.

[0099] Sequence Listing

[0100] SEQ ID No.1

[0101] AAATTAATAATTTTGAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACT

[0102] GGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCT

[0103] TGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTT

[0104] GTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTG

[0105] CAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAA

[0106] TTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAA

[0107] AATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGC

[0108] GAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGC

[0109] ACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAA

[0110] ACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTT

[0111] CATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAG

[0112] TACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGA

[0113] ACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCA

[0114] AATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAAAAAAAGGGGGAGAAAA。

Claims

1. A strain of Saccharomyces cerevisiae, It is characterized in that Its accession number is CGMCC No.17260.

2. The Saccharomyces cerevisiae strain according to claim 1, It is characterized in that Its ITS sequence is shown as SEQ ID No.

1.

3. A Clostridium butyricum fermentation method, It is characterized in that The butyric clostridium and the brewer's yeast according to claim 1 are mixed and fermented until the clostridium butyricum transsporulation rate is greater than 90%, and the temperature is raised to inhibit or kill the yeast, thereby stopping the fermentation.

4. The fermentation method according to claim 3, It is characterized in that The following steps are involved: (1) Prepare fermentation medium, adjust pH to 7.5-8.0, and sterilize at 115°C for 30 min. (2) Seed solution preparation: Prepare Clostridium butyricum and Saccharomyces cerevisiae seed solutions respectively, inoculate them into the fermentation medium and mix them evenly. (3) Fermentation parameter control: fermentation temperature 33-37°C, tank pressure 0.02-0.05Mpa, deep static fermentation. (4) Yeast heating treatment: When the fermentation rate of Clostridium butyricum is greater than 90%, heat at 60-65°C for 20 minutes. (5) Stop fermentation when the temperature drops to 37°C. The total fermentation time is 20 to 21 hours.

5. The fermentation method according to claim 4, It is characterized in that In the step (2), the first-level Clostridium butyricum seed solution is fermented for 24 hours and then heated at 80° C. for 10 minutes. The inoculation amount of the second-level seed solution is 1% to 2%, and the fermentation time is 14 to 18 hours.

6. The fermentation method according to claim 5, It is characterized in that The first-level seed solution of Clostridium butyricum in step (2) is fermented for 24 hours and then heated at 80° C. for 10 minutes. The inoculation amount of the second-level seed solution is 2% and the fermentation time is 14 hours.

7. The fermentation method according to claim 4, It is characterized in that In the step (2), the inoculation ratio of the Clostridium butyricum to the Saccharomyces cerevisiae is 2:(1-4).

8. The fermentation method according to claim 7, It is characterized in that In the step (2), the inoculation ratio of the Clostridium butyricum to the Saccharomyces cerevisiae is 2:

2.

9. A composite microecological preparation, It is characterized in that The product is prepared by fermenting Clostridium butyricum with the brewer's yeast according to claim 1.

10. Use of the composite microecological preparation according to claim 9 in the preparation of medicines or feeds for preventing and treating intestinal diseases of Penaeus vannamei.

Images