A bacteriophage-resistant Bacillus subtilis and its construction method and application

Abstract

The present invention belongs to the field of genetic engineering, and specifically relates to a phage-resistant Bacillus subtilis and a construction method and application thereof. The present invention uses Bacillus subtilis BsRX17 as a starting strain, and identifies a restriction modification system (Restriction modification system) from its genome that plays a role in Bacillus subtilis resisting phage infection. The system is a type II RM system composed of three genes, YdiR, YdiS, and YdjA. It has been verified that YdiR and YdjA genes play an important role in the anti-phage function of this type II RM system. Through element combination optimization and genome integration expression, a Bacillus subtilis engineered bacterium BsRX17-YdiR / YdjA-OE that can resist infection against a variety of phages is obtained, and has an effect of resisting phage contamination during fermentation. At the same time, the growth curve of this engineered bacterium is not significantly different from the starting strain, indicating that the bacterium can maintain normal growth ability while having a broad-spectrum anti-phage ability, and can be applied to the biotechnology development of Bacillus subtilis and phage contamination prevention and control in industrial fermentation.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to a phage-resistant Bacillus subtilis and a construction method and application thereof. Background Art

[0002] With the continuous growth of demand for fermented products and the continuous advancement of production processes, the fermentation industry is facing increasingly severe challenges in microbial safety. In the microbial fermentation production process of enzymes, amino acids, dairy products and antibiotics, bacteriophage contamination is a common cause of fermentation abnormalities. Bacillus is a Gram-negative bacterium widely distributed in soil and other natural environments. It has many excellent characteristics such as simple nutritional requirements, resistance to adverse environments, a wide variety of enzymes and high yields, strong heat resistance, inhibition of pathogenic bacteria, and safety and non-toxicity. It is more suitable for industrial production and has been recognized as a GRAS industrial strain by many institutions. Bacillus can effectively prevent enteritis in aquatic animals, decompose toxic and harmful substances in water, promote the degradation of nutrients in feed, adjust intestinal flora imbalance, reduce intestinal bacterial infections, and produce resistance substances to inhibit the growth and reproduction of pathogenic bacteria. Therefore, it is widely used in aquaculture, animal husbandry, forestry, food industry and pharmaceutical industry. However, the Bacillus fermentation process is extremely susceptible to bacteriophage infection, which can affect production. When bacteriophages appear, it can cause a long fermentation cycle and affect production, or even cause the factory to stop production, causing huge economic losses to the company.

[0003] Phage infection provides the main driving force for bacterial evolution. In response to this strong evolutionary pressure, bacteria have developed a series of anti-phage systems, which can be defined as single genes or genomes that provide partial or complete anti-phage resistance to the host. According to the way bacteria resist phages, the bacterial tolerance to phage infection can be divided into five types: preventing phage adsorption, preventing phage DNA injection, preventing DNA replication, aborting infection, and preventing phage assembly and release. For example, at the level of receptor defense to prevent phage adsorption, phages dig out receptors that are spatially inhibited, modify receptor binding proteins and adapt to new receptors, which cannot be completely solved by receptor specificity in anti-phage. The process of preventing phage DNA injection evolved the superinfection exclusion (Sie) system, which is a defense system mediated by prophage-encoded proteins to prevent other phage DNA from entering the cell, but the anti-phage is not extensive enough. The restriction modification system (RM system) has a faster response capability than other anti-phage mechanisms (such as CRISPR-Cas system or membrane barrier) and can play a role in the early stages of phage invasion. It also has strong specificity and can accurately identify and cut specific phage DNA, reducing the impact on the host cell's own genes. The system is derived from bacteria themselves, has high safety and compatibility, and is suitable for application in industrial strains to improve survival advantages. Therefore, in-depth research on the mechanism of phage contamination and the introduction of external restriction modification systems have become important strategies to improve the stability of the fermentation industry and product quality.

[0004] Phage contamination is difficult to control, so the problem of phage contamination during the fermentation process should be comprehensively controlled and prevented first. Reasonable factory design, strain rotation strategy, and screening of inhibitors that have a significant inhibitory effect on phages while not affecting the normal growth of Bacillus subtilis can reduce the risk of phage infection to a certain extent. However, compared with environmental management, drug addition, and traditional strain spontaneous mutation screening methods, the use of genetic engineering technology to obtain phage-resistant strains is a more thorough way to solve the problem of phage infection, and can also improve the fermentation and production level of resistant strains. Summary of the invention

[0005] In order to overcome the deficiencies of the above-mentioned prior art, the present invention provides a phage-resistant Bacillus subtilis and a construction method and application thereof. The present invention uses Bacillus subtilis BsRX17 with industrial application prospects as a starting strain, and identifies a restriction modification system (Restriction modification system) from its genome that plays a role in Bacillus subtilis's resistance to phage infection. The system is a type II RM system composed of three genes, YdiR, YdiS, and YdjA. It has been verified that the YdiR and YdjA genes play an important role in the anti-phage function of this type II RM system. After element combination optimization and genome integration expression, a Bacillus subtilis engineered bacterium BsRX17-YdiR / YdjA-OE that can resist infection against a variety of phages is obtained, and has an anti-phage contamination effect during the fermentation process. Moreover, the growth curve of this engineered bacterium is not significantly different from that of the starting strain, indicating that the strain can maintain normal growth ability while having a broad-spectrum anti-phage ability, and can be applied to the biotechnology development of Bacillus subtilis and the prevention and control of phage contamination during industrial fermentation.

[0006] In order to achieve the purpose of the present invention, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention provides a bacteriophage-resistant Bacillus subtilis, comprising a bacteriophage-resistant coding gene;

[0008] The coding gene is any one of the following (a1)-(a7):

[0009] (a1) Restriction modification enzyme encoding gene YdiR;

[0010] (a2) Sequence-specific protein coding gene YdiS;

[0011] (a3) methyltransferase encoding gene YdjA;

[0012] (a4) restriction enzyme encoding gene YdiR and methyltransferase encoding gene YdjA;

[0013] (a5) restriction enzyme encoding gene YdiR, sequence specific protein encoding gene YdiS and methyltransferase encoding gene YdjA;

[0014] (a6) a restriction enzyme encoding gene YdiR and a methyltransferase encoding gene YdjA, wherein the copy number of the restriction enzyme encoding gene is 2 or more;

[0015] (a7) a restriction enzyme encoding gene YdiR and a methyltransferase encoding gene YdjA, wherein the number of copies of the restriction enzyme encoding gene is 2 or more, and the number of copies of the methyltransferase encoding gene is 2 or more;

[0016] Among them, the nucleotide sequence of the restriction modification enzyme encoding gene YdiR is shown in SEQ ID NO.1; the nucleotide sequence of the YdjA gene is shown in SEQ ID NO.2; and the nucleotide sequence of the YdiS is shown in SEQ ID NO.3.

[0017] The starting strain of the anti-phage Bacillus subtilis is Bacillus subtilis ( Bacillus subtilis ) BsRX17, deposited in China Center for Type Culture Collection, and its biological deposit number is: CCTCC NO: M 2022888.

[0018] The second aspect of the present invention provides a method for constructing the phage-resistant Bacillus subtilis according to the first aspect, comprising: constructing a recombinant vector containing a phage-resistant coding gene, and integrating the phage-resistant coding gene into the genome of the host strain.

[0019] Furthermore, the preparation method of the recombinant vector includes connecting the anti-phage coding gene or its gene expression cassette into a plasmid;

[0020] The coding gene is any one of the following (a1)-(a7):

[0021] (a1) Restriction modification enzyme encoding gene YdiR;

[0022] (a2) Sequence-specific protein coding gene YdiS;

[0023] (a3) methyltransferase encoding gene YdjA;

[0024] (a4) restriction enzyme encoding gene YdiR and methyltransferase encoding gene YdjA;

[0025] (a5) restriction enzyme encoding gene YdiR, sequence specific protein encoding gene YdiS and methyltransferase encoding gene YdjA;

[0026] (a6) a restriction enzyme encoding gene YdiR and a methyltransferase encoding gene YdjA, wherein the copy number of the restriction enzyme encoding gene is 2 or more;

[0027] (a7) a restriction enzyme encoding gene YdiR and a methyltransferase encoding gene YdjA, wherein the number of copies of the restriction enzyme encoding gene is 2 or more, and the number of copies of the methyltransferase encoding gene is 2 or more;

[0028] Among them, the nucleotide sequence of the restriction modification enzyme encoding gene is shown in SEQ ID NO.1; the nucleotide sequence of the methyltransferase encoding gene is shown in SEQ ID NO.2; and the nucleotide sequence of the sequence-specific protein encoding gene is shown in SEQ ID NO.3.

[0029] Further, in the construction of the plasmid: the coding gene expression cassette is connected to the Bm I and Hind III double-digested pDG364 linear vector.

[0030] Furthermore, the host strain is Bacillus subtilis BsRX17, and the integration site is the amyE site.

[0031] The third aspect of the present invention provides the use of the above-mentioned anti-bacteriophage Bacillus subtilis in any one or more of the following:

[0032] (c1) Preparation of products with broad-spectrum anti-bacteriophage activity in industrial fermentation;

[0033] (c2) improving the growth performance of bacteriophage-resistant Bacillus subtilis;

[0034] Furthermore, the bacteriophage includes SPP1, SPBc2, phIS3501 and PM1.

[0035] A fourth aspect of the present invention provides a method for screening anti-phage encoding genes, comprising the following steps:

[0036] (b1) Cloning and connecting the coding genes to be screened into the expression frames of the host's free expression plasmids to obtain free expression plasmids carrying different anti-phage coding genes to be screened;

[0037] (b2) using the Spizizen transformation method, the expression plasmids were transferred into the host strains respectively;

[0038] (b3) performing anti-phage ability identification on the transformants of the obtained recombinant strains, screening the anti-phage ability of different transformed strains, selecting strains with strong anti-phage ability, and identifying the coding genes to be screened and their combinations contained in the recombinant strains with strong anti-phage ability;

[0039] Among them, the coding genes to be screened are YdiR gene, YdiS gene and YdjA gene; the free expression plasmid is pHP13-P43; and the host strain is Bacillus subtilis BsRX17.

[0040] One or more of the above technical solutions have the following beneficial effects:

[0041] The present invention uses genetic engineering technology to obtain a phage-resistant strain BsRX17-YdiR / YdjA-OE that can simultaneously resist infection by multiple phages, including SPP1, SPBc2, phIS3501, and PM1, thereby solving the problem of multiple phage infections. At the same time, the growth curve of the engineered bacteria is not significantly different from that of the starting strain, indicating that the strain has a broad-spectrum anti-phage ability while not affecting the growth ability, and can be applied to the biotechnology development of Bacillus subtilis and the anti-phage contamination application in industrial fermentation processes. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0043] Figure 1 Schematic diagram of the Type II RM system in the BsRX17 genome.

[0044] Figure 2 Schematic diagram of pHP13-P43-TypeII-RM expression plasmid.

[0045] Figure 3 Schematic diagram of pHP13-P43-YdiR expression plasmid.

[0046] Figure 4 Schematic diagram of pHP13-P43-YdiS expression plasmid.

[0047] Figure 5 Schematic diagram of pHP13-P43-YdjA expression plasmid.

[0048] Figure 6 Schematic diagram of the evaluation of the role of Type II RM system in Bacillus subtilis anti-phage, wherein A is a double-layer plate image after phage (SPP1, SPBc2, phIS3501, PM1) infects Bacillus subtilis engineered bacteria BsRX17-TypeII-RM; B is the bacterial solution concentration at different time periods after 30 hours of culture of wild-type Bacillus subtilis BsRX17 and Bacillus subtilis engineered bacteria BsRX17-TypeII-RM infected by phage (SPP1, SPBc2, phIS3501, PM1), and the bacterial solution concentration is expressed as the OD value measured at a wavelength of 600nm.

[0049] Figure 7Schematic diagram of the evaluation of the role of each component of the Type II RM system in Bacillus subtilis anti-phage, wherein A is a double-layer plate image after phage (SPP1, SPBc2, phIS3501, PM1) infects wild-type Bacillus subtilis BsRX17 and engineered Bacillus subtilis (BsRX17-YdiR, BsRX17-YdiS, BsRX17-YdjA); B is the bacterial solution concentration after 30 hours of culture of wild-type Bacillus subtilis BsRX17 and engineered Bacillus subtilis (BsRX17-YdiR, BsRX17-YdiS, BsRX17-YdjA) infected by phage (SPP1, SPBc2, phIS3501, PM1), and the bacterial solution concentration is expressed as the OD value measured at a wavelength of 600 nm.

[0050] Figure 8 Schematic diagram of the combination optimization and genome integration of Type II RM system components.

[0051] Fig. 9 Figure 3 is a schematic diagram of the evaluation of the anti-phage ability and growth performance of the BsRX17-YdiR / YdjA-OE engineered bacteria, wherein A is a double-layer plate diagram of phage (SPP1, SPBc2, phIS3501, PM1) infecting the engineered bacteria BsRX17-YdiR / YdjA-OE; B is the bacterial solution concentration after 30 hours of culture of phage (SPP1, SPBc2, phIS3501, PM1) infecting wild-type Bacillus subtilis BsRX17 and Bacillus subtilis engineered bacteria (BsRX17-PT1, BsRX17-PT2, BsRX17-PT3, BsRX17-PT4, BsRX17-PT5), and the bacterial solution concentration is expressed as the OD value measured at a wavelength of 600 nm; C is the growth curve of the engineered bacteria BsRX17-YdiR / YdjA-OE and the wild-type Bacillus subtilis BsRX17. DETAILED DESCRIPTION

[0052] A typical embodiment of the present invention provides a bacteriophage-resistant Bacillus subtilis, which contains a bacteriophage-resistant coding gene;

[0053] The coding gene is any one of the following (a1)-(a7):

[0054] (a1) Restriction modification enzyme encoding gene YdiR;

[0055] (a2) Sequence-specific protein coding gene YdiS;

[0056] (a3) methyltransferase encoding gene YdjA;

[0057] (a4) restriction enzyme encoding gene YdiR and methyltransferase encoding gene YdjA;

[0058] (a5) restriction enzyme encoding gene YdiR, sequence specific protein encoding gene YdiS and methyltransferase encoding gene YdjA;

[0059] (a6) a restriction enzyme encoding gene YdiR and a methyltransferase encoding gene YdjA, wherein the copy number of the restriction enzyme encoding gene is 2 or more;

[0060] (a7) a restriction enzyme encoding gene YdiR and a methyltransferase encoding gene YdjA, wherein the number of copies of the restriction enzyme encoding gene is 2 or more, and the number of copies of the methyltransferase encoding gene is 2 or more;

[0061] Wherein, the restriction modification enzyme encoding gene nucleotide sequence is shown in SEQ ID NO.1; the methyltransferase encoding gene nucleotide sequence is shown in SEQ ID NO.2; the sequence-specific protein encoding gene nucleotide sequence is shown in SEQ ID NO.3;

[0062] The anti-phage Bacillus subtilis is an engineered bacterium transformed by genetic engineering, and its starting strain is Bacillus subtilis ( Bacillus subtilis ) BsRX17, deposited in China Center for Type Culture Collection, and its biological deposit number is: CCTCC NO: M 2022888.

[0063] The YdiR, YdiS and YdjA genes described in the present invention are genes encoding restriction modification enzymes, sequence-specific proteins and methyltransferases in the type II RM system, which were identified from the genome of Bacillus subtilis BsRX17. Through the previous whole genome sequencing and fine genome mapping work on BsRX17 (SUB14618371; BioProject: PRJNA1138901; BioSample: SAMN42746665), the detailed gene information of YdiR, YdiS and YdjA was obtained ( Figure 1 ).

[0064] A second typical embodiment of the present invention provides a method for constructing the above-mentioned phage-resistant Bacillus subtilis, comprising: constructing a recombinant vector containing a phage-resistant coding gene, and integrating the phage-resistant coding gene into the genome of the host strain. The specific steps are as follows:

[0065] (1) Screening of key coding genes for anti-phage

[0066] Using the genomic DNA of Bacillus subtilis BsRX17 as a template, the primer sequences shown in Table 1 were used to clone the plasmid homology arms and upstream and downstream restriction sites ( Bm I and EcoR I) were connected to the Type II-RM, YdiR, YdiS, and YdjA gene expression cassettes that were double-digested ( Bm I and EcoR I) pHP13-P43 linear vector was used to construct pHP13-P43-TypeII-RM ( Figure 2 )、pHP13-P43-YdiR( Figure 3 )、pHP13-P43-YdiS( Figure 4 ) and pHP13-P43-YdjA expression vector ( Figure 5 ). The four expression vectors were transferred into Bacillus subtilis BsRX17 using the Spizizen transformation method to obtain Bacillus subtilis engineered bacteria that overexpress TypeII-RM and its components. Phage infection experiments were carried out using four enriched Bacillus subtilis phages (SPP1, SPBc2, phIS3501, PM1). Phage resistance experiments verified that the type II RM system has anti-phage function, and the YdiR and YdjA genes were screened out to play an important role in the anti-phage function of the type II RM system.

[0067] Table 1 Primer sequences used for construction of expression vectors for Type II-RM and its components

[0068]

[0069] (2) Optimization and integration of key coding gene combinations into the genome

[0070] The key coding genes in step (1) are designed and combined to obtain any one of the following PT1 to PT5 coding gene expression cassettes:

[0071] PT1: The coding gene expression cassette is P566-YdiR-RBS-P566-YdjA connected sequentially from 5' to 3' direction;

[0072] PT2: the coding gene expression cassette is P566-YdiR-RBS-P566-YdiR-RBS-P566-YdjA connected sequentially from 5' to 3' direction;

[0073] PT3: the coding gene expression cassette is P566-YdiR-RBS-P566-YdiR-RBS-P566-YdiR-RBS-P566-YdjA connected sequentially from 5' to 3' direction;

[0074] PT4: the coding gene expression cassette is P566-YdiR-RBS-P566-YdiR-RBS-P566-YdiR-RBS-P566-YdjA-RBS-P566-YdjA connected sequentially from 5' to 3' direction;

[0075] PT5: The coding gene expression cassette is P566-YdiR-RBS-P566-YdjA-RBS-P566-YdiR-RBS-P566-YdjA-RBS-P566-YdiR connected in sequence from 5' to 3' direction, and its nucleotide sequence is shown in SEQ ID NO.20.

[0076] Among them, the nucleotide sequence of the strong promoter P566 is shown in SEQ ID NO.4, SEQ ID NO.4:

[0077] AAAAAACGGCCTCTCGAAATAGAGGGTTGACACTCTTTTGAGAATATGTTATATTATCAG.

[0078] The nucleotide sequence of the RBS sequence is shown in SEQ ID NO.5, SEQ ID NO.5: GCCACCTAAAAAGGAGCGATTTA.

[0079] The above PT1~PT5 coding gene expression cassettes were sent to Anhui General Biotechnology Co., Ltd. for synthesis, and connected to the pUC57 vector for sequencing to verify the correct sequence. Subsequently, primers (F: 5'-GATAAGCTGTCAAACATGAGAATTCACCTCGCGAATGCATCTAGA-3' (SEQ ID NO.16); R: 5'-CCGGCGCTCAGGATCCTAGAAGCTTCAGTCGACGGGCCCGGGATC-3' (SEQ ID NO.17)) containing plasmid homology arms and upstream and downstream restriction sites were used to amplify the PT1~PT5 coding gene expression cassettes from the pUC57 vector, and the synthetic sequences were connected to the pUC57 vector. Bm I and HindIII enzyme digested integrative plasmid pDG364, transformed by Spizizen method and integrated into the amyE site on the BsRX17 genome, and confirmed by PCR that the gene expression cassette was integrated into the amyE site, and BsRX17-PT1, BsRX17-PT2, BsRX17-PT3, BsRX17-PT4, and BsRX17-PT5 were obtained respectively, and the verification primers were: F: 5'-CAAGTGAACGATGGTAAACTG-3' (SEQ ID NO.18); R: 5'-TCAATGGGGAAGAGAACCGCT-3' (SEQ ID NO.19). The Bacillus subtilis engineered strain overexpressing the coding gene obtained by the above construction method has significantly improved anti-phage ability.

[0080] A third typical embodiment of the present invention provides the use of the above-mentioned anti-bacteriophage Bacillus subtilis in any one or more of the following:

[0081] (c1) Preparation of products with broad-spectrum anti-bacteriophage activity in industrial fermentation;

[0082] (c2) improving the growth performance of bacteriophage-resistant Bacillus subtilis;

[0083] The above-mentioned application also includes improving the application effect of Bacillus subtilis in biotechnology development, specifically improving the ability of Bacillus subtilis to prevent and control phage contamination in biotechnology development applications; the biotechnology development refers to the preparation of products containing Bacillus subtilis in the fields of agriculture, food industry and medicine.

[0084] In some embodiments, the bacteriophage includes SPP1, SPBc2, phIS3501 and PM1.

[0085] A fourth typical embodiment of the present invention provides a method for screening anti-phage encoding genes, characterized in that it comprises the following steps:

[0086] (b1) Cloning and connecting the coding genes to be screened into the expression frames of the host's free expression plasmids to obtain free expression plasmids carrying different anti-phage coding genes to be screened;

[0087] (b2) using the Spizizen transformation method, the expression plasmids were transferred into the host strains respectively;

[0088] (b3) The transformants of the obtained recombinant strains are respectively subjected to anti-phage ability identification, the anti-phage ability of different transformed strains is screened, the strains with strong anti-phage ability are selected, and the coding genes to be screened and their combinations contained in the recombinant strains with strong anti-phage ability are identified.

[0089] The anti-phage encoding gene is a restriction modification system-related gene that plays a role in Bacillus subtilis's resistance to phage infection. The system is a type II RM system composed of three genes: YdiR, YdiS, and YdjA.

[0090] Specifically, the genomic DNA of Bacillus subtilis BsRX17 was used as a template to clone the plasmid homology arms and upstream and downstream restriction sites ( Bm I and EcoR I) were connected to the Type II-RM, YdiR, YdiS, and YdjA gene expression cassettes that were double-digested ( Bm I and EcoR I) pHP13-P43 linear vector was used to construct pHP13-P43-TypeII-RM ( Figure 2 )、pHP13-P43-YdiR( Figure 3 )、pHP13-P43-YdiS( Figure 4 ) and pHP13-P43-YdjA expression vector ( Figure 5 ), the four expression vectors were respectively transferred into Bacillus subtilis BsRX17 using the Spizizen transformation method to obtain Bacillus subtilis engineered bacteria that overexpress TypeII-RM and its components. Four Bacillus subtilis phages (SPP1, SPBc2, phIS3501, PM1) were enriched and cultured to determine the coding genes to be screened in the recombinant strains with strong anti-phage ability through plaque experiments and growth activity tests.

[0091] In the present invention, the inventors used Bacillus subtilis BsRX17, which has industrial application prospects, as a host strain for screening key anti-phage genes and a starting strain for transformation, and identified a restriction modification system (Restriction modification system) from its genome that plays a role in Bacillus subtilis's resistance to phage infection. The system is a type II RM system composed of three genes, YdiR, YdiS, and YdjA. It has been verified that the YdiR and YdjA genes play an important role in the anti-phage function of this type II RM system. After element combination optimization and genome integration expression, Bacillus subtilis engineered bacteria BsRX17-PT1, BsRX17-PT2, BsRX17-PT3, BsRX17-PT4, and BsRX17-PT5 that can resist infection against a variety of phages were obtained, and they have the effect of resisting phage contamination during their fermentation process.

[0092] In order to further understand the present invention, the technical scheme in the embodiment of the present invention will be clearly and completely described below in conjunction with the embodiment of the present invention. Obviously, the described embodiment is only a part of the embodiment of the present invention, rather than all embodiments. Based on the embodiment in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work premise belong to the scope of protection of the present invention. Unless otherwise specified, the reagents involved in the embodiments of the present invention are all commercially available products, and can be purchased through commercial channels.

[0093] Source of biological materials: Bacillus subtilis ( Bacillus subtilis ) BsRX17, deposited in China Center for Type Culture Collection, abbreviated as CCTCC, address: Wuhan University, Wuhan, China, its biological deposit number is: CCTCC NO: M2022888, and the deposit date is: 2022-06-15.

[0094] Bacteriophages SPP1, SPBc2, phIS3501, and PM1 were purchased from Zhongyuan Biotechnology (ATCC China Agent);

[0095] Escherichia coli DH5α, T4 ligase, high-fidelity Taq enzyme, etc. were purchased from Nanjing Novozyme Co., Ltd.;

[0096] Plasmids pHP13-P43 and pDG364 were purchased from Miaoling Plasmid Platform;

[0097] Restriction enzymes Bm I. EcoR I. Hind III was purchased from NEB;

[0098] Chloramphenicol and LB medium were purchased from Shanghai Sangon Biotechnology Co., Ltd.

[0099] Bacterial genome extraction kit, plasmid extraction kit, endotoxin-free plasmid extraction kit, and DNA recovery kit were purchased from Beijing Tiangen.

[0100] Example 1 Analysis of Type II RM System in the Genome of Bacillus subtilis BsRX17

[0101] Based on the previous whole genome sequencing and fine genome mapping work on BsRX17 (SUB14618371; BioProject: PRJNA1138901; BioSample: SAMN42746665), a Type II restriction modification system (Type II RM) was discovered among its 4440 coding genes. The system is composed of three genes, YdiR, YdiS, and YdjA, and is located on the chromosome at Chr1:659207-662626. YdiR (RX17_GM000669, Chr1:659207:660163) encodes a restriction enzyme, YdjA (RX17_GM000671, Chr1:661229:662626) encodes a methyltransferase, and YdiS (RX17_GM000670, Chr1:660195:661226) encodes a sequence specificity factor. Figure 1 ). The nucleotide sequences of YdiR, YdjA and YdiS are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0102] Example 2 Cloning of Type II RM System, YdiR, YdiS and YdjA Gene Sequences and Construction of Expression Vectors

[0103] (1) Cloning of type II RM system, YdiR, YdiS and YdjA gene sequences

[0104] The genomic DNA of Bacillus subtilis BsRX17 was extracted according to the instructions of the Bacterial Genome Extraction Kit (Beijing Tiangen).

[0105] Using genomic DNA as a template, the complete sequence of the Type II RM gene expression cassette was amplified. The amplification primers were: Type II-RM-F: ATGCTGCAGGTCGACGGATCCATGGGGGTAAAATCAATGAC (SEQ ID NO. 6) and Type II-RM-R: AAAACGACGGCCAGTGAATTCCTAATTTTTATCACTTAATCT (SEQ ID NO. 7).

[0106] Using genomic DNA as a template, the complete sequence of the YdiR gene expression cassette was amplified, and the amplification primers were: YdiR-F: ATGCTGCAGGTCGACGGATCCATGGGGGTAAAATCAATGACT (SEQ ID NO. 8) and YdiR-R: AAAACGACGGCCAGTGAATTCTTAGTTATTTTCAAAGTCTTC (SEQ ID NO. 9).

[0107] The complete sequence of the YdiS gene expression cassette was amplified using genomic DNA as a template. The amplification primers were: YdiS-F: ATGCTGCAGGTCGACGGATCCATGGAAATATCCAAACAAACTT (SEQ ID NO. 10) and YdiS-R: AAAACGACGGCCAGTGAATTCTTAATCACTCACAAAAGACGAA (SEQ ID NO. 11).

[0108] Using genomic DNA as a template, the complete sequence of the YdjA gene expression cassette was amplified, and the amplification primers were: YdjA-F: ATGCTGCAGGTCGACGGATCCATGGATAAGTCAAGTAAGTTCT (SEQ ID NO. 12) and YdjA-R: AAAACGACGGCCAGTGAATTCCTAATTTTTATCACTTAATCTT (SEQ ID NO. 13).

[0109] PCR amplification was performed using high-fidelity PCR polymerase (Nanjing Novozyme) to obtain a fragment with restriction sites ( Bm I and EcoR I) type II RM system, YdiR, YdiS and YdjA gene expression cassette; the PCR products were subjected to 1% agarose gel electrophoresis, and the amplified DNA fragments were recovered using a DNA recovery kit (Beijing Tiangen); the DNA fragments were connected to the T vector and sequenced to verify the correctness of the sequence, thereby obtaining the complete sequence of type II RM system, YdiR, YdiS and YdjA gene expression cassette.

[0110] (2) Double restriction digestion of DNA fragments and expression vectors

[0111] The recovered type II RM system, YdiR, YdiS and YdjA gene expression cassettes and vector pHP13-P43 were lysed with restriction endonucleases. Bm I and EcoR I was used for double digestion; the digestion products were subjected to 1% agarose gel electrophoresis, the target band was cut from the gel, and the digested DNA fragments and the linearized pHP13-P43 plasmid were recovered using a DNA recovery kit.

[0112] (3) Construction of overexpression vector

[0113] The DNA fragment was connected to the expression vector using T4 ligase, and the type II RM system, YdiR, YdiS and YdjA gene expression cassettes were connected to the linearized pHP13-P43 vector, respectively, and the reaction system was 10 μL.

[0114] Take 50 μL of DH5α competent cells and 10 μL of the ligation system, mix and incubate for plasmid transformation, and then spread on an LB plate containing 50 μg / mL chloramphenicol resistance; after culturing at 37°C for 10-15 hours, pick the positive colonies and transfer them to LB liquid culture medium containing 50 μg / mL chloramphenicol, and culture them at 37°C and 200 rpm for 10-15 hours. Send the bacterial solution to a sequencing company for verification. The sequencing verification primers are: Primer-YZ-F: GTTTAAATAAAAGCCGGGAA (SEQ ID NO.14) and Primer-YZ-R: GGAGGCATATCAAATGAACT (SEQ ID NO.15).

[0115] The expression vector pHP13-P43-TypeII-RM ( Figure 2 )、pHP13-P43-YdiR( Figure 3 )、pHP13-P43-YdiS( Figure 4 ) and pHP13-P43-YdjA expression vector ( Figure 5 ).

[0116] (4) Conversion

[0117] The four expression vectors obtained in step (2) were respectively transferred into Bacillus subtilis BsRX17 using the Spizizen transformation method to obtain Bacillus subtilis engineered bacteria BsRX17-TypeII-RM, BsRX17-YdiR, BsRX17-YdiS, and BsRX17-YdjA that overexpress TypeII-RM and its components.

[0118] Example 3 Identification of the anti-phage ability of the type II RM system and the engineered bacteria overexpressing each component

[0119] (1) Enrichment of phage stock solution

[0120] Bacillus subtilis BsRX17 and the four Bacillus subtilis phages required for detection (SPP1, SPBc2, phIS3501, PM1) were inoculated into LB medium respectively. After culturing at 37°C for 10-15 h, the four phages required for detection (SPP1, SPBc2, phIS3501, PM1) were enriched and centrifuged. The supernatant was filtered with a filter membrane with a pore size of 0.22 μm to obtain the phage stock solution for the test. After the phage solution was diluted 10 times in a gradient, 100 μL was taken and mixed with 300 μL of the host bacterial solution in the early logarithmic phase, poured into double-layer plates, counted after overnight culture, and the phage titer was calculated. The titers of the four phages (SPP1, SPBc2, phIS3501, PM1) were adjusted to 10 6 PFU / mL.

[0121] (2) Plaque assay

[0122] According to the ratio of Bacillus subtilis: phage = 1000:1, the four phages (SPP1, SPBc2, phIS3501, PM1) were mixed with the corresponding concentrations of wild-type Bacillus subtilis BsRX17 and the suspensions of BsRX17-TypeII-RM, BsRX17-YdiR, BsRX17-YdiS, and BsRX17-YdjA Bacillus subtilis engineered bacteria obtained in Example 2, and allowed to stand at 37°C for 20 min. The bacterial suspension after standing was mixed with semi-solid LB agar medium (agar concentration of 0.6%), poured on the surface of solid LB agar (agar concentration of 1%) medium, and cultured at 37°C without inversion for 16 h to 24 h, and the infection of different phages on the double-layer plate was observed.

[0123] (3) Growth activity of different Bacillus subtilis engineered strains after phage infection

[0124] The wild-type Bacillus subtilis BsRX17 and the monoclones of the Bacillus subtilis engineered bacteria BsRX17-TypeII-RM, BsRX17-YdiR, BsRX17-YdiS, and BsRX17-YdjA overexpressing TypeII-RM obtained in Example 2 and its components were inoculated into 10 mL centrifuge tubes containing 2 mL LB medium, respectively, and cultured in a shaking incubator at 37°C overnight, and expanded to a 250 mL conical flask containing 50 mL LB medium at a ratio of 1:100. After culturing at 37°C and 220 rpm to OD600 = 0.1, the four phages were added respectively, and the time was positioned at 0 h, and then the OD600 value of the culture solution was measured at 30 h.

[0125] (4) Experimental results

[0126] Results: Figure 6 (A) and Figure 6 As shown in (B), the type II RM system has the effect of improving the anti-phage ability of Bacillus subtilis; Figure 7 (A) and Figure 7 As shown in (B), among its three functional genes, the YdiR gene encoding a restriction endonuclease and the YdjA gene encoding a methylase play an important role in the anti-phage function of this type II RM system.

[0127] Example 4 Construction and genomic integration expression of anti-phage elements based on type II RM system

[0128] (1) Combinatorial optimization design of anti-phage encoding gene modules

[0129] According to the experimental results of Example 3, five anti-phage encoding gene expression cassettes composed of a strong promoter P566, an RBS sequence, a YdiR gene, and a YdjA gene were designed based on the YdiR gene and the YdjA gene and sent to the company for synthesis to obtain DNA fragments encoding genes of PT1, PT2, PT3, PT4, and PT5, respectively ( Figure 8 ), which was ligated into the pUC57 vector and verified to be correct by sequencing.

[0130] (2) Gene cloning of anti-phage encoding gene module

[0131] The pUC57 plasmids of PT1, PT2, PT3, PT4, and PT5 were used as templates, and high-fidelity PCR polymerase (Nanjing Novozyme) was used to amplify the complete sequences of the PT1, PT2, PT3, PT4, and PT5 anti-phage encoding gene expression cassettes. The amplification primers were: F: GATAAGCTGTCAAACATGAGAATTCACCTCGCGAATGCATCTAGA (SEQ ID NO.16), R: CCGGCGCTCAGGATCCTAGAAGCTTCAGTCGACGGGCCCGGGATC (SEQ ID NO.17). The PCR products were subjected to 1% agarose gel electrophoresis, and the amplified DNA fragments were recovered using a DNA purification and recovery kit (Beijing Tiangen); the DNA fragments were connected to the T vector, and the correctness of the sequence was verified by sequencing to obtain the complete sequences of the PT1, PT2, PT3, PT4, and PT5 encoding genes.

[0132] (3) Double restriction digestion of DNA fragments and expression vectors

[0133] The DNA fragments and vector pDG364 recovered in step (2) were Bm I and HindIII double digestion, the digestion products were subjected to 1% agarose gel electrophoresis, the target band was cut from the gel, and the digested DNA fragments and the linearized integration plasmid pDG364 were recovered using a DNA recovery kit.

[0134] (4) Construction of overexpression vector

[0135] The DNA fragment obtained in step (2) was connected to the expression vector using T4 ligase. The DNA fragments encoding the PT1, PT2, PT3, PT4, and PT5 genes were connected to the linearized integration plasmid pDG364, respectively. The reaction system was 10 μL.

[0136] Take 50 μL of DH5α competent cells and 10 μL of the ligation system, mix and incubate for plasmid transformation, and then spread on an LB plate containing 50 μg / mL chloramphenicol resistance; after culturing at 37°C for 10-15 hours, pick positive colonies and transfer them to LB liquid culture medium containing 50 μg / mL chloramphenicol, and culture them at 37°C and 200 rpm for 10-15 hours. Send the bacterial solution to a sequencing company for verification, and the sequencing verification primers are consistent with the above amplification primers.

[0137] The overexpression vector verified by sequencing was extracted using an endotoxin-free plasmid extraction kit (Beijing Tiangen).

[0138] (5) Conversion

[0139] The overexpression vector constructed above was transformed by Spizizen method and integrated into the amyE site on the BsRX17 genome, and verified by PCR with primers: F: CAAGTGAACGATGGTAAACTG (SEQ ID NO.18); R: TCAATGGGGAAGAGAACCGCT (SEQ ID NO.19). It was confirmed that the anti-phage encoding gene expression cassette was integrated into the amyE site, and BsRX17-PT1, BsRX17-PT2, BsRX17-PT3, BsRX17-PT4, and BsRX17-PT5 were obtained respectively.

[0140] Example 5 Identification of anti-phage function and growth performance evaluation of Bacillus subtilis engineered bacteria expressing anti-phage elements

[0141] (1) Identification of anti-phage function

[0142] Plaque assay and growth activity detection experimental methods: same as Example 3.

[0143] The engineered bacteria are the Bacillus subtilis engineered bacteria BsRX17-PT1, BsRX17-PT2, BsRX17-PT3, BsRX17-PT4, and BsRX17-PT5 prepared in Example 4.

[0144] The results are as follows Fig. 9 (A) and Fig. 9 As shown in (B), among the above five phage-resistant Bacillus subtilis engineered bacteria, the Bacillus subtilis engineered bacteria BsRX17-PT5 (P566-YdiR-RBS-P566-YdjA-RBS-P566-YdiR-RBS-P566-YdjA-RBS-P566-YdiR) gave the Bacillus subtilis engineered bacteria the strongest resistance to infection by four bacteriophages (SPP1, SPBc2, phIS3501, PM1) after genome integration and expression. It was named BsRX17-YdiR / YdjA-OE, and subsequent growth performance was evaluated.

[0145] (2) Growth performance evaluation

[0146] The wild-type Bacillus subtilis BsRX17 and the engineered Bacillus subtilis BsRX17-YdiR / YdjA-OE were inoculated into 10 mL centrifuge tubes with 2 mL LB medium, placed in a 37°C shaker overnight culture, and expanded to a 250 mL conical flask with 50 mL LB medium at a ratio of 1:100. The culture was continued at 37°C shaker until OD600 = 0.6, and then continued to be shaken in a 37°C shaker. Samples were taken every 2 hours to measure the OD600 value of the culture solution. A growth curve was drawn with time as the horizontal axis and the OD600 value of the culture solution as the vertical axis. The results are shown in Fig. 9 As shown in (C), the modified engineered bacteria BsRX17-YdiR / YdjA-OE has a growth phenotype consistent with the wild-type Bacillus subtilis BsRX17, indicating that the genomic integration expression of this set of anti-phage elements has no effect on the growth and normal physiological function phenotype of the wild-type strain, indicating that this engineered bacteria can maintain normal growth ability while having broad-spectrum anti-phage ability.

[0147] Although the above describes the specific implementation mode of the present invention in conjunction with the accompanying drawings, it is not intended to limit the scope of protection of the present invention. Those skilled in the art should understand that various modifications or variations that can be made by those skilled in the art on the basis of the technical solution of the present invention without creative work are still within the scope of protection of the present invention.

Claims

1. A bacteriophage-resistant Bacillus subtilis, characterized in that: Containing an anti-phage encoding gene expression cassette, the encoding gene expression cassette is P566-YdiR-RBS-P566-YdjA-RBS-P566-YdiR-RBS-P566-YdjA-RBS-P566-YdiR connected in sequence from 5' to 3', and its nucleotide sequence is shown in SEQ ID NO.20; the starting strain of the anti-phage Bacillus subtilis is Bacillus subtilis ( Bacillus subtilis )BsRX17, deposited in China Center for Type Culture Collection, its biological accession number is: CCTCC NO: M 2022888.

2. The method for constructing the bacteriophage-resistant Bacillus subtilis according to claim 1, characterized in that: A recombinant vector containing an anti-phage encoding gene expression cassette is constructed, and the anti-phage encoding gene expression cassette is integrated into the genome of the host strain.

3. The method for constructing the bacteriophage-resistant Bacillus subtilis according to claim 2, characterized in that: The preparation method of the recombinant vector comprises connecting the anti-phage encoding gene expression cassette into the plasmid; The coding gene expression cassette is P566-YdiR-RBS-P566-YdjA-RBS-P566-YdiR-RBS-P566-YdjA-RBS-P566-YdiR connected in sequence from 5' to 3' direction, and its nucleotide sequence is shown in SEQ ID NO.

20.

4. The method for constructing the phage-resistant Bacillus subtilis according to claim 3, characterized in that: In the construction of plasmid: the coding gene expression cassette is connected to the Bm I and Hind III double-digested pDG364 linear vector.

5. The method for constructing the bacteriophage-resistant Bacillus subtilis according to claim 2, characterized in that: The host strain is Bacillus subtilis BsRX17.

6. The method for constructing the bacteriophage-resistant Bacillus subtilis according to claim 2, characterized in that: The integration site is the amyE site.

7. Use of the phage-resistant Bacillus subtilis according to claim 1 and / or the phage-resistant Bacillus subtilis obtained by any one of the construction methods of claims 2 to 6 in any one or more of the following: (c1) Used for the prevention and control of bacteriophage contamination during the industrial fermentation of Bacillus subtilis; (c2) Improving the application of Bacillus subtilis in biotechnology development; The (c2) application is specifically to improve the ability of Bacillus subtilis to prevent and control phage contamination in biotechnology development applications; the biotechnology development refers to the preparation of products containing Bacillus subtilis in the fields of agriculture, food industry and medicine; the phages include SPP1, SPBc2, phIS3501 and PM1.

Images