Construction method of apostichopus japonicus embryo protein transport defect model

Abstract

The invention discloses a construction method of an apostichopus japonicus embryo protein transport defect model, which comprises the following steps: soaking an early embryo of an apostichopus japonicus blastocyst in an SRalpha gene specific vivo Morphholino with the concentration of 2.5 M / L for 24 hours, and the DNA (deoxyribonucleic acid) sequence of the SRalpha gene specific vivo Morphholino is as shown in SEQ ID NO: 1; the soaked embryos are placed under a microscope to be observed, survived and malformed embryos are selected, and the apostichopus japonicus embryo protein transport defect model is obtained and specifically shows protein transport signal channel gene expression disorder, cytoplasm internal ribosome stress, cell ubiquitination pathway activation, tissue morphology malformation and the like. The reliable construction method of the apostichopus japonicus embryonic period protein transport defect model provided by the invention can be used for deeply researching a protein transport pathway, a protein degradation mechanism and an embryonic development malformation mechanism in an animal embryonic period, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the field of aquaculture gene functions, and in particular relates to a method for constructing a sea cucumber embryo protein transport defect model. Background Art

[0002] Sea cucumbers belong to the phylum Echinodermata, class Holothuria, order Otocheiridae, family Stichopus, and genus Stichopus, and are important aquatic resources. As the earliest deuterostome, it has a special evolutionary status and biological characteristics such as pentaradial symmetry and strong regeneration ability. It is a good model for studying the molecular mechanisms of biological processes such as system evolution, development and regeneration. The correct synthesis and normal transport of proteins are closely related to the growth, immunity and disease of organisms, but there is currently a lack of research on the protein transport mechanism during the embryonic development of sea cucumbers.

[0003] The SRP pathway is the main protein transport pathway in eukaryotes and is primarily responsible for targeting secretory proteins to the endoplasmic reticulum. SRα The receptor is one of the most conserved components in the SRP pathway and is a key element that ensures the accuracy of protein targeting in the SRP pathway. In mammals, damage to the SRP pathway during embryonic development can lead to abnormal protein transport, protein ectopic location and degradation, embryonic malformation and ultimately death. SRa The consistency of the main functional domains of the gene, SRP54_N and SRP54 domain, with those of mammals, fish and mollusks is between 60% and 87%, suggesting that the function of the gene is conserved from invertebrates to vertebrates. In marine invertebrates, including sea cucumbers, the lack of an effective in vivo gene function research technology has hindered the research on the regulatory mechanisms of key biological processes such as growth and immunity. Therefore, it is urgent to develop a reliable and effective method for studying the function of sea cucumber genes. Studies have shown that in aquatic animals such as zebrafish, direct immersion or intraperitoneal injection of target gene-specific vivo Morpholino during the embryonic period can successfully block the translation process of the original mRNA and achieve the purpose of gene knockdown.

[0004] However, there has been no report on the construction of a sea cucumber embryo protein transport defect model based on in vivo Morpholino. Summary of the invention

[0005] The present invention aims to solve the above technical problems existing in the prior art and provides a method for constructing a sea cucumber embryo protein transport defect model.

[0006] The technical solution of the present invention is: a method for constructing a sea cucumber embryo protein transport defect model, wherein the sea cucumber embryo is immersed in a 2.5 μM / L concentration of SRαThe immersion time in the gene-specific vivo Morpholino is 24 hours. SRα The DNA sequence of the gene-specific vivo Morpholino is shown in SEQ ID NO: 1. The soaked embryos are placed under a microscope for observation, and the embryos that survive and have deformities are selected to obtain a sea cucumber embryo protein transport defect model.

[0007] The invention soaks the sea cucumber blastocyst early embryo SRα Gene-specific in vivo Morpholino silencing SRα The expression of the gene leads to the damage of SRP protein transport pathway, which is specifically manifested as disordered expression of protein transport signaling pathway genes, cytoplasmic ribosome stress, activation of cellular ubiquitination pathway, tissue morphological deformity, etc., thus constructing a sea cucumber embryo protein transport defect model with a success rate of more than 81%. The sea cucumber embryo protein transport defect model provided can provide basic data for in-depth research on the mechanism of action of the SRP pathway in invertebrates, cytoplasmic ribosome stress and cellular ubiquitination pathway and other scientific issues, breaking through the bottleneck of in vivo gene function research of invertebrate marine animals, and has very important scientific significance and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1 This is a histological observation diagram of the embryo of the sea cucumber embryo protein transport defect model constructed by the present invention.

[0009] Figure 2 It is a gene expression change diagram of the sea cucumber embryo protein transport defect model constructed by the present invention. DETAILED DESCRIPTION

[0010] The method for constructing the sea cucumber embryo protein transport defect model of the present invention is carried out according to the following steps: Step 1. SRα Gene sequence, design a vivoMorpholino site that blocks translation in the sequence of the target gene, query and compare the target site sequence in the sea cucumber genome database, and confirm that the selected target site is the only site in the sea cucumber genome. Rα Gene-specific vivo Morpholino, the sequence of which is as follows: TTGTGAAAAGGTCTAGCATGATGAA (SEQ ID NO: 1); Step 2. During the breeding season of sea cucumbers, female and male sea cucumbers in good development status were selected, artificial induction of spawning was performed, sperm and eggs were collected respectively, artificial insemination was performed, and the fertilized eggs were collected and placed in a large beaker filled with sterilized seawater, and cultured at a constant temperature of 22° C. with air circulation maintained; Step 3. Observe under a microscope, wait for the embryo to develop to the early blastocyst stage, remove the membrane, take out an appropriate amount of embryos, and put them into a final concentration of 2.5 µM / L SRα The embryos were immersed in a gene-specific vivo Morpholino at a constant temperature of 22°C for 24 hours with air circulation. The immersed embryos were observed under a microscope, and the embryos that survived and showed deformities were selected to obtain the sea cucumber embryo protein transport defect model.

[0011] Control experiment 1: Step 1. SRα Gene sequence, design a vivoMorpholino site that blocks translation in the sequence of the target gene, query and compare the target site sequence in the sea cucumber genome database, and confirm that the selected target site is the only site in the sea cucumber genome. Rα Gene-specific vivo Morpholino, whose sequence is as follows: TTGTGAAAAGGTCTAGCATGATGAA (SEQ ID NO: 1); meanwhile, a meaningless sequence vivo Morpholino was synthesized as a control group, whose sequence information is as follows: CCTCTTACCTCAGTTACAATTTATA (SEQ ID NO: 12); Step 2. During the breeding season of sea cucumbers, female and male sea cucumbers in good development status were selected, artificial induction of spawning was performed, sperm and eggs were collected respectively, artificial insemination was performed, and the fertilized eggs were collected and placed in a large beaker filled with sterilized seawater, and cultured at a constant temperature of 22° C. with air circulation maintained; Step 3. Observe under a microscope, wait for the embryos to develop to the early blastocyst stage, remove the membrane, and pipette an appropriate amount of embryos into 6-well plates, each group including 3 wells, of which the experimental group is added SRα The final concentration of gene-specific vivo Morpholino was 2.5 µM / L. The control group was added with the same concentration of control vivo Morpholino and immersed in a constant temperature environment of 22℃ for 12 hours and 24 hours with air circulation.

[0012] The embryos were observed under a microscope and the survival rate and deformity rate of the embryos were calculated. Figure 1 As shown in the figure, 12 hours after immersion, there was no significant difference in the survival rate and deformity rate between the experimental group and the control group; 24 hours after immersion, the embryos of the control group developed normally to the late gastrula stage, while the concave part of the embryos of the experimental group showed obvious deformity. Figure 1 The red circled part is the part with developmental deformity, and the survival rate and deformity rate of the experimental group are 90% and 81.1% respectively. Explanation: The present invention can successfully construct a model of protein transport defect in sea cucumber embryos, and the success rate can reach 81%.

[0013] Control experiment 2: The embryos of the control group and the experimental group were immersed for 24 hours for protein transport defect model detection: Total RNA was extracted from embryonic tissues and the expression of SRP pathway was detected by fluorescence quantitative PCR. SRβ Genes, ubiquitination-related genes Ubc , apoptosis marker genes Bax and Casp 8 The expression changes of the internal reference gene were NADH. The primer sequences used are shown in Table 1, corresponding to SEQ ID NOs: 2-11.

[0014] Table 1

[0015] The specific method is as follows: Embryos from the control group and the experimental group were taken after soaking for 24 hours, the seawater was removed, and they were placed in 1.5mL centrifuge tubes and quickly frozen in liquid nitrogen for later use. The total RNA of the embryo samples was extracted using the classic Trizol method, and the quality of the extracted RNA was detected by agarose gel electrophoresis. The RNA concentration was determined using a spectrophotometer, and then 1µg of RNA was reverse transcribed into cDNA as a template for fluorescent quantitative PCR amplification. The fluorescent quantitative DNA polymerase used in the experiment was Hieff ® qPCR SYBR Green Master Mix. The amplification system used is: Hieff ® qPCR SYBR Green Master Mix 10μl, upstream and downstream primers 0.8μl each, sterile water 6.4μl, 2μl cDNA template under different treatments, the total reaction system is 20μl. Fluorescence quantitative PCR reaction program is: 95℃ 10min; 95℃ 15s, 60℃ 60s, 35 cycles; 95℃ 10s, 65℃ 1min, 97℃ 1s, read the CT value after the reaction. NADH The gene was used as the internal reference gene, and 2 -ΔΔCt Methods Gene expression was calculated, and the significance analysis was performed using the one-way ANOVA method using Spass software. GraphPad Prism 5 software was used to plot and organize the fluorescence quantitative data. For variance analysis, data transformation was in accordance with the variance homogeneity test. P When <0.05, the difference was considered statistically significant.

[0016] Control group and Example 2 SRβ Genes, ubiquitination-related genes Ubc, Apoptosis marker genes Bax and Casp 8 The expression results of Figure 2 As shown, Figure 2 The “*” represents P When the value is less than 0.05, the data have significant differences. The results of gene expression change detection show that: SRβ The gene expression level was downregulated by 80.65%, indicating that the SRP signaling pathway was damaged; ubiquitination-related genes Ubc Expression was upregulated by 3.45 times; apoptosis marker gene Bax The expression level was increased by 4.96 times. Casp 8 The expression level of was upregulated by 3.23 times, which means that the protein transport is abnormal and the embryo initiates cell apoptosis, indicating that Example 1 of the present invention successfully constructed a sea cucumber embryo protein transport defect model.

Claims

1. A method for constructing a sea cucumber embryo protein transport defect model, characterized in that: The early blastocyst embryos of sea cucumbers were immersed in 2.5 μM / L SRα The immersion time in the gene-specific vivo Morpholino is 24 hours. SRα The DNA sequence of the gene-specific vivo Morpholino is shown in SEQ ID NO:

1. The soaked embryos are placed under a microscope for observation, and the embryos that survive and have deformities are selected to obtain a sea cucumber embryo protein transport defect model.

Images