M2 macrophage targeting exosome and application thereof

Abstract

The invention discloses an application of an M2 macrophage exosome (M2-Exo) lncRNA D130043N08 in regulation and control of macrophage polarization in viral myocarditis, a reagent targeting the M2 macrophage exosome lncRNA D130043N08 is an effective amount of a reagent for reducing expression of the lncRNA D130043N08 in the M2 macrophage exosome, the reagent is generally a nucleic acid targeting reagent, and further, the reagent is siRNA or antisense oligonucleotide. The invention effectively verifies that M2-Exo participates in regulation and control of polarization of macrophages through lncRNA D130043N08, provides theoretical data for functional research of macrophages, and provides a theoretical basis and a clinical basis for pathogenesis and treatment targets of viral myocarditis.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to an application of M2 macrophage exosomes (M2-Exo) lncRNA D130043N08 in regulating macrophage polarization in viral myocarditis. Background Art

[0002] Viral myocarditis (VM) is a virus-induced inflammatory disease of the heart, which usually presents as acute myocarditis and may further develop into chronic viral myocarditis, dilated cardiomyopathy, and even heart failure. Coxsackievirus B3 (CVB3) is considered to be an important pathogen of VM. However, to date, there is no specific and effective treatment due to insufficient understanding of the pathogenic mechanism of CVB3-induced VM. Extensive clinical and experimental studies have shown that in addition to direct virus-mediated damage, immunopathological cardiac inflammation is an important pathogenic mechanism of CVB3-induced VM. Therefore, immune modulation has become one of the most promising strategies for the treatment of VM. Elucidating the mechanism of cardiac immune response will help to better understand the key processes of VM pathogenesis and provide some clues for the development of new therapeutic strategies.

[0003] Macrophages have been shown to play an important role in the development of VM. They are not only the first inflammatory cells recruited to cardiac tissue, but also the main infiltrating cell subset in the early stage of VM. Macrophages can be polarized to the classically activated M1 or alternatively activated M2 phenotype, depending on the cardiac microenvironment. M1 macrophages induced by lipopolysaccharide (LPS) and interferon-γ (IFN-γ) usually promote myocardial inflammation and tissue destruction by producing proinflammatory cytokines. In contrast, M2 macrophages induced by IL-4 or IL-13 can secrete anti-inflammatory cytokines associated with tissue repair. Studies have shown that M1 macrophages significantly aggravate VM, while M2 macrophages reduce myocardial inflammation. Changes in the balance between M1 and M2 macrophages contribute to earlier and more M2 macrophage infiltration, which may be a potential target for the treatment of VM.

[0004] Exosomes are 30–150 nm cell-derived nanovesicles that are present in all tissues, body fluids (including blood and urine), and cell culture media. Exosomes have been reported to act as functional paracrine units of cells and can partially recapitulate the bioactive functions of their parent cells, suggesting that they may provide an alternative therapeutic option. The mechanisms of exosome-mediated physiological and pathological processes largely rely on the transfer of exosomal contents, including noncoding RNA (ncRNA) and proteins, to recipient cells. Therefore, the composition of exosomes and their bioactivity largely depend on the physiological status of their parent cells.

[0005] Recent studies have shown that the biomolecular composition of exosomes released by macrophages reflects the characteristics of the original cells: strong immune or inflammatory regulatory activities. Recently, the role of exosomes or extracellular vesicles derived from macrophages of M1 or M2 phenotype has been elucidated. For example, exosomes released by M1-like macrophages derived from obese adipose tissue contain abundant miRNAs, such as miR-155 and miR-146a, which lead to insulin resistance in mice. In the myocardial infarction microenvironment, M1-like macrophage-derived exosomes inhibit angiogenesis and aggravate cardiac dysfunction. In addition, extracellular vesicles enriched with miRNA-421-3p derived from M2 bone marrow-derived macrophages (BMDMs) attenuate apoptosis and promote motor function recovery by inhibiting mTOR in spinal cord injury. M2 macrophage exosomes reduce the hematopoietic and inflammatory status of circulating monocytes and macrophages in atherosclerotic plaques. However, the function of exosomes secreted by M2 macrophages and the impact of their content lncRNA in VM have not been reported. Summary of the invention

[0006] The present invention aims at the above-mentioned problems existing in the prior art, overcomes the shortcomings of the prior art, and finds that M2 macrophage exosomes (M2-Exo) can effectively alleviate viral myocarditis. Through exosome lncRNA sequencing and in vitro functional assays, it was found that D130043N08 in M2-Exo promoted macrophage polarization to M2 and protected mice from the effects of CVB3-induced viral myocarditis. Therefore, the present invention effectively verifies that M2-Exo participates in the regulation of macrophage polarization through lncRNA D130043N08, provides theoretical data for the functional study of macrophages, and provides a theoretical basis and clinical basis for the pathogenesis and therapeutic targets of viral myocarditis.

[0007] Among them, the sequence number of lncRNA D130043N08 in M2 macrophage exosomes is shown in SEQ ID NO:1.

[0008] SEQ ID NO: 1:

[0009] gcctggctgacccaggcttcagctccacttctagacgcctggggttcagtctgtgttagaacctgttatagtttgcatcctgat

[0010] gtatctagtaggagttccgttaagctgaccatgcttgtatttatccctcgtcttatgcaactaatcaaatcaaccaaaaaaagga

[0011] aaaaaaaaaaaaaaaaagaaacgaaaaaagaaccatcaccatgagatcctgtatttgtctttttttactacacgtatgacctcc

[0012] cccgtgagtgagtactgtagtcctccatctcaaggcagccttacttcagacacatttcaaactggtgcaaacagaaaagactt

[0013] ctctcttttcttctgaggctaaagacaagaatgtcacgctatacaggtgcaactcaatccttgaaaacagaaaccaatgcaga

[0014] cagagacattttaccccttgatgtagctgtgagtcccaacctagtgccattgtttttatttttatttttattttgggaaatggctttaga

[0015] actttccaagttatccttgaattgtctgaccacggacatcaacagctgcctcccttctaccatgtagaatcctatgacttaactttt

[0016] cttccagatatagaggggtacctgcctgtttttcaaagtgtttatttactgctgttactatttgattagaatgtatcaaataaaaaca

[0017] aacctgacttttacaagttgcactcattactttgagttgtaggtgtacatttccatgctaataaaaggtcgccataaaaactcatta

[0018] tcaagtgaaataaactaagcaatcagctcagggtagaacattaactcgcttgcctccaaataaggcccacacctgctctatgt

[0019] gttttagaaagcatggttcacaggctaggaatcgtcaagacagcctgatcatgtgcaggccggatgggcacaatccttgtgc

[0020] atttcaaaagcaatggtttagaagcgataaaagttacgtcagggtctaaactctaacaagttccgcagccgctttctcttggcc

[0021] acccagtctcacgactgctgtagcatgccatcttctctagagtctagacactatgcctcttgcccgccctgtacatgtttcctgg

[0022] ccgggccgtaggttcctgtgtgtccagggtgaaaggagaacctggggcgtcatgtgcacgctctaagtgaataggaaatta

[0023] taaaagtgcagaataatagaactgacttaccttgcagggtttgaagtccccagttttacaccaggaaggaaacattaagtttat

[0024] ccaacctggatggattgctgggtgtggcttgggaagagcctgcttcgctctgctgggtggtggggcaatactaggcttccc

[0025] gctaggatacttagatctcccttttgcacactgatgatgatggttctctggtagaacgcttgggctagcaaggggctttgtgga

[0026] atccttttcaggtctccctgctgttcctcaggtattgggagtgaggaggcagtcagaagaccctgtgcctgtggagttatgac

[0027] aagctcccgagtgttgcgttcagcgcctgcaggtgtgtgtgtattgggagcccagattcactgcttggggctgtgatatggat

[0028] caccttatctaactctagtcctgatggcaaggaagttgataggcatcaggggacagttttgttttgtttttgttttcttgctttatagt

[0029] ttttaatatatttactgagttccttgtgtgccagcctctgactcaatacttcataatatctcatttgatcctcggaaggaccaaaag

[0030] agcaaagtccaggatttatgggaagtgaatagttccacactgatccagttaacaagttagagcaggctgtaatagcagtctttt

[0031] tgctgcggcctcaaccagactagtgcagatactgtaattagtgttgcgtcctctctcgctttaaaaacattttcaagaagtggttt

[0032] cttggtgcatgtgtgtatgtgtatgcatgtgccatgtcatatatgtgggaggtgtggcacagcttctccgttcttgcctctcgctg

[0033] cgtgggctccagggattggacctcagtctttaccgacaagcacccttacccattgagacatcttgtcagccctccagtcagtc

[0034] tggccaatggctttttttttttttgaagatccctgaaataagtggtaaagtgggggtggggagggagtttgtccccttcctgggt

[0035] gactactaaatgatgccaggtatcactgactgtcccatctaacaacagaaacaaaactggattcacccaaggtgtcctcaac

[0036] agaggctggaaaatttctctttcactgttgtttttctatggggggtggtgtgaagcattagtaaggacatttattattgagattcta

[0037] attgttgctgttcttgtggcctgtcctgtgctctgtcgcaggatttgtgtatccacccccgacttcagtgactgctatgagtttctg

[0038] ttcagaggacgcagaggtgaaggagcgtatgtcatcccatctaaagttaccaacacagataacagatgtaatgacatctgct

[0039] ttctttttagaaacagggacccccagtttgtgtgcgcttggaggtcttgcttagtgttattagtatgaaggttttgacttcatcgta

[0040] attacatcattcaaataggtgacagaaagggactgttggttgttccacacggtttattttcttgggaagcctttctttcccctgcttt

[0041] tagaaaattgtaccctgcttggcggagggtaggagacagacacgtcatcaagtaatccaagggatggaatgtcccgagag

[0042] cagactatgcccttctggttgtgggtttgggcacagggcaggagggggctgtggctctaacagctgggccgaagcctcac

[0043] tggctcccagaagtcctgtccatcttctagacctctacccagaatgtggctctgggcctgtcattccctcagaggctctgcgtt

[0044] ctcctcatccagttgttaactccctagaatcctggagtccggaacacactgtttgggtcactcagcccaggtcctttataggaa

[0045] ccagaacatttcagattcagggactagaaatctagtcagcaaatgggcaacatacaaacccagagcttaggtccggtggaa

[0046] gctccacccttctgccctcccttcaaaccgcctgtgcccttctttgctgcagttactgtaacttaaaacttgcttcctctgacatg

[0047] caaaatcaggttttgggatgtcaccacagcaggatactttcaattcttagctcctgccccactctccaggattaccccttttgtc

[0048] gtgatccactgtataatgagatatgtattaatttgaattctttagttctttttttaatcattttggagattgaacgtaggtctttccccac

[0049] gcttggcaagcatcctaccgttgagccacatctccagtccatgtcaatgtctctctaatctgtttgctgtttgaaagccgaagtc

[0050] ctccggtccttgctgtgtggtgatctcatgacacgtctgccagatgtcacccacacatggccagggtgcccagctgactcta

[0051] ctctcctgtgtttgcttaccagtagagtctgttttggcttttgcctcctcttacatgcaggtagctcctgccttactctctcctgctct

[0052] tcccacgatgctgtctttttagatggtcgattagagaagtcctgggtggctgtatgatgggccagcgaaggatgggaattcaa

[0053] gtctacttgaattaggtaaactgacagatttagggtccttaggattaagtctgtgtctgtttctctttagttctcttcaggatttaaaa

[0054] accaaagccagttcctaacaccacatttcaacacttt

[0055] The lncRNA D130043N08 siRNA sequence in M2 macrophage exosomes is shown in Table 1

[0056] Table 1

[0057]

[0058] The present application provides an M2 macrophage exosome containing the lncRNA D130043N08. The exosome can treat viral myocarditis, and the long non-coding RNA lncRNA D130043N08 can regulate the expression of M1 or M2 macrophages, and can treat viral myocarditis, especially viral myocarditis caused by polarization of M1 or M2 macrophages.

[0059] The present application also provides an M2 macrophage exosome lncRNA siRNA, which is an siRNA mixture containing three ASOs and three siRNAs, including:

[0060] ASO1:GTCAAGACAGCCTGATCAT;

[0061] ASO2:CAATCCTTGTGCATTTCAA;

[0062] ASO3: CTCGCTTGCCTCAAATAA;

[0063] siRNA1:TGCTGGGTGTGGCTTGGGAA;

[0064] siRNA2:TTCTCTTGGCCACCCAGTCT; and

[0065] siRNA3:CCATCTTCTCTAGAGTCTAG.

[0066] The present application also provides the use of the lncRNA siRNA in regulating the polarization of M1 or M2 macrophages, which makes M1 macrophages (CD11b + iNOS + ) increased significantly. At the same time, M2 macrophages (CD11b + CD206 + ) was reduced by D130043N08 knockdown.

[0067] The present invention provides an M2 macrophage exosome (M2-Exo) lncRNA D130043N08, which can regulate macrophage polarization and is used in viral myocarditis. The reagent targeting M2 macrophage exosome lncRNA D130043N08 is an effective amount of a reagent that reduces the expression of lncRNA D130043N08 in M2 macrophage exosomes, usually a nucleic acid targeting reagent, and further, siRNA or antisense oligonucleotide. The present invention effectively verifies that M2-Exo participates in the regulation of macrophage polarization through lncRNA D130043N08, provides theoretical data for the functional study of macrophages, and provides a theoretical basis and clinical basis for the pathogenesis and treatment targets of viral myocarditis. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art.

[0069] Figure 1 Characterization of M2-Exo. (A and B) Size distribution of M2-Exo was determined by nanoparticle tracking assay (NTA) analysis and flow cytometry. (C) M2-Exo was observed by transmission electron microscopy (TEM). Scale bar: 200 nm. (D) Immunoblotting was used to detect M2-Exo markers (Alix and CD9, etc.). Figure 2 .Intramyocardial injection of M2-Exo alleviates myocardial inflammation and cardiac dysfunction in VM mice. When constructing the VM model, mice were intramyocardially injected with PBS or M2-Exo. The phenotype of the VM model was evaluated. (A) Heart H&E staining. Scale bar = 0.05 mm. (B) ELISA was used to determine the level of cTnI in mouse serum. (C) Changes in mouse body weight. (D) The survival rate of mice was observed on day 10 after infection. (E) ELISA was used to determine the protein levels of IFN-γ, IL-4, and IL-13 in cardiac tissue homogenates. (F) Echocardiography was performed at week 5 (day 35). The left ventricular shortening fraction (FS) and ejection fraction (EF) were analyzed by a small animal ultrasound imaging system. The experiment was repeated three times in triplicate, with 8 mice in each group. The bar graph data are expressed as mean ± SD, *P < 0.05, **P < 0.01.

[0070] Figure 3 Effects of M2-Exo on macrophage infiltration and polarization after VM. To construct a mouse VM model, PBS or M2-Exo were injected intramyocardially. The phenotype of the VM model was evaluated. (A) Myocardial infiltrating macrophages were isolated from the heart after trypsin digestion. Flow cytometric analysis of CD11b + iNOS + CD11b+ Arg1 + (B) qRT-PCR was used to measure the expression of NOS2, Arg1, FIZZ1 and YM1 in sorted CD11b + Expression in macrophages. (C) Protein levels of iNOS and Arg1 in mouse hearts were evaluated by Western blotting. (D) On day 7 of the VM model, paraffin sections were made from the hearts of mice. CD68 (red, macrophage marker), iNOS (green, M1 marker) and Arg1 (green, M2 marker) were then detected by immunofluorescence. DAPI was used for nuclear staining (blue). Scale bar = 100 μm. The experiment was repeated three times in triplicate, with 10-15 mice in each group. Bar graph data are expressed as mean ± standard deviation, *P < 0.05, ***P < 0.001.

[0071] Figure 4 .Identification of lncRNA D130043N08. (A) lncRNA D130043N08 was selected by intersection of lncRNAs upregulated in macrophage polarization and lncRNAs enriched in M2-Exo through lncRNA sequencing analysis. (B) Expression level of D130043N08 in M1 and M2 macrophages was determined by qRT-PCR. GAPDH was used as an internal reference. (C) Expression level of D130043N08 in M2-Exo was analyzed by qRT-PCR. (D) D130043N08 is located in the intron 1 region of the SOCS2 gene on mouse chromosome 10. (E) RNA FISH detected endogenous D130043N08 in BMDM (green). DNA (blue) was stained with DAPI. Scale bar = 5 μm. (F) CPC program predicted the coding potential of D130043N08, SOCS2, and HOTIAR. D130043N08 and HOTAIR were predicted as non-coding RNAs, while SOCS2 RNA was predicted as a coding gene. (G) Time course expression analysis of D130043N08 in macrophage polarization. (H) The expression level of D130043N08 in macrophages was determined by qRT-PCR 24 hours after M1 was repolarized to M2 by IL-4. (I) The expression level of D130043N08 in macrophages was determined by qRT-PCR 24 hours after M2 was repolarized to M1 by LPS and IFN-γ. (J) Time course expression analysis of D130043N08 in cardiac tissues with acute myocarditis (n=3 / group). The experiment was repeated three times in triplicate, and the data are expressed as the mean ± SD of three independent experiments, *P<0.05, **P<0.01.

[0072] Figure 5.M2-Exo promotes macrophage polarization to M2 phenotype in inflammatory environment. (A) Immunofluorescence detection of M2-Exo labeled with PKH26 (red) in BMDM cells. Scale bar = 50 μm. (B) Knockdown of D130043N08 in M2-Exo. M2-Exo was isolated from BMDM cells transfected with negative control (NC) or D130043N08 smart silencer. The expression of D130043N08 in M2-Exo (si-NC) or M2-Exo (si-D130043N08) was evaluated by qRT-PCR. BMDM were co-cultured with M2-Exo (si-NC) or M2-Exo (si-D130043N08) for 24 h and then stimulated with LPS+IFN-γ or IL-4 for another 24 h. (C) qRT-PCR detection of the effect of knockdown of D130043N08 on the expression of M1 markers (NOS2) and M2 markers (Arg1, FIZZ1 and YM-1). (D) The activity of M2 marker arginase was evaluated by urea produced in BMDM treated with M2-Exo (si-NC) or M2-Exos (si-D130043N08). (E) After culture with M2-Exo (si-NC) or M2-Exo (si-D130043N08), the levels of M1 marker iNOS and M2 marker Arg1 in BMDM cells were evaluated by Western blotting, respectively. The experiment was repeated three times in triplicate. The bar graph data are expressed as mean ± SD, **P < 0.01, ***P < 0.001. Figure 6 Knockdown of D130043N08 in M2-Exo reduced the efficacy of M2-Exo in vivo. When constructing the VM model, mice were intramyocardially injected with M2-Exo(si-NC) or M2-Exo(si-D130043N08). The phenotype of the VM model was evaluated. (A) Myocardial infiltrating macrophages were isolated from the heart after trypsin digestion. CD11b was analyzed by flow cytometry + iNOS + CD11b + CD206 + The percentage of cells. (B) Mice were sacrificed on day 7 after infection, and the hearts were stained with HE. Scale bar = 0.05 mm. (C-D) Echocardiographic M-mode tracings of VM model mice. Echocardiographic analysis of EF and FS of mice in each group. The experiment was repeated three times in triplicate, with 20 mice in each group. The bar graph data are expressed as mean ± SD; ns, not statistically significant, *P < 0.05, **P < 0.01. DETAILED DESCRIPTION

[0073] The present invention will be further described below in conjunction with the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and cannot be used to limit the protection scope of the present invention.

[0074] BALB / c male mice (6–8 weeks old, weighing 20–25 g) were purchased from Qinglongshan Laboratory Animal Center (Nanjing, China) and housed in specific pathogen-free (SPF) cages. All animal experimental procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals (Ministry of Health of China, 1998). The Animal Ethics Committee of Wannan Medical College approved all animal experimental protocols.

[0075] Statistical analysis

[0076] Data are shown as mean ± standard deviation. Two-tailed independent Student's t-test and analysis of variance were used for statistical analysis of data. The survival status of mice was tested by Kaplan-Meier (KM) plot, and the survival time was analyzed using the log-rank test. All analyses were performed using GraphPad Prism v5.0 (GraphPad Software). P < 0.05 was considered statistically significant.

[0077] Example 1 Isolation and identification of M2 macrophage exosomes (M2-Exo)

[0078] 1.1 Isolation and culture of primary BMDM

[0079] Primary bone marrow-derived macrophages (BMDM) were isolated from the femur and tibia of mice and cultured in 6-well plates or 10 cm cell culture dishes with DMEM medium (Gibco) containing 20% ​​fetal bovine serum (FBS, Gibco, Life Technologies, NY, USA) and 20% L929 cell supernatant at 37°C and 5% CO2 (M0). After 7 days, the cells were transferred to fresh RPMI-1640 medium containing 10% FBS for an additional 24 hours. BMDM were treated with DMEM medium (10% FBS) containing 100 ng / ml LPS (Sigma, USA) and 20 ng / ml IFN-γ (PeproTech, Cranbury, NJ, USA) for 24 hours to stimulate M1 polarization, or treated with 20 ng / ml IL-4 (PeproTech) for 48 hours to stimulate M2 polarization.

[0080] 1.2 Isolation and identification of M2 macrophage exosomes (M2-Exo)

[0081] Exosomes were isolated from conditioned medium using an exosome isolation kit (Umibio, Shanghai, China). When M2 macrophages reached 80% confluence, the medium was replaced with exosome-free FBS (Gibco). After 48 h, the supernatant was collected. Subsequently, the supernatant was centrifuged at 4°C, 3000g for 10 min, and then at 4°C, 10000g for 20 min to remove cells and debris. The reagents were added in proportion to the starting sample volume, and the mixture was vortexed and incubated at 4°C for 2 h, and then centrifuged at 4°C, 10000g for 60 min to precipitate the exosomes. The exosomes were washed once with 1× PBS. After centrifugation at 4°C, 3000g for 10 min, the exosomes were suspended in 100 μl PBS and stored at -80°C before use.

[0082] Differential ultracentrifugation was also used for the separation of M2-Exo. Culture serum FBS was centrifuged at 300 × g for 20 minutes, at 3,000 × g for 20 minutes, and then at 10,000 × g for 60 minutes to remove cells, debris, and large vesicles, all at 4 ° C. The supernatant was then filtered using a 0.22 μm filter and ultracentrifuged at 110,000 × g for 2 hours at 4 ° C (Optima XPN-100Ultra centrifuge, Beckman Coulter, USA) to separate M2-Exo.

[0083] The BCA protein detection kit was used to determine the protein concentration of purified exosomes in the extracted M2-Exo. Western blot was used to detect the expression of markers such as Alix, Annexin V, CD54 / ICAM-1, CD9, GM130, EpCAM, HSP70, and Flotillin-1 in M2-Exo. The size distribution was measured using a flow cytometer and a nanoparticle tracking analyzer (Particle Metrix, Germany). The size and morphology of exosomes were observed using a scanning electron microscope (TEM).

[0084] Bone marrow derived macrophages (BMDM) were isolated from the femur and tibia of mice and activated into M2 macrophages. Exosomes were purified from the culture supernatant of M2 macrophages using an exosome isolation kit. The morphology and phenotype of the isolated particles were identified based on the characteristics of the exosomes. To characterize the purified particles in detail, we performed NTA (Nano Particle Tracking Apparatus) and flow cytometry to measure the size distribution of the vesicles. Almost all particles had a diameter between 30 and 150 nm ( Figure 1 A and 1B). The morphological characteristics of the isolated particles were directly detected by TEM (transmission electron microscopy). The particles appeared to be cup-shaped membrane-structured vesicles with a diameter of about 100 nm ( Figure 1C). In addition, Western blot analysis showed that the particles were highly enriched for Alix, Annexin V, CD54 / ICAM-1, CD9, GM130, EpCAM, HSP70, and Flotillin-1, which are marker proteins of exosomes ( Figure 1 D). Therefore, the above analysis indicated that the particles secreted by M2 macrophages (M2 exosomes, M2-Exo) collected in our study were exosomes.

[0085] Example 2 M2-Exo reduces myocardial inflammation and cardiac dysfunction in VM mice

[0086] To induce VM model, mice were injected intraperitoneally with CVB3 (Nancy strain). Before infection, the virus titer was routinely determined by 50% tissue culture infectious dose (TCID50) assay of HeLa cell (ATCC No.: CCL-2) monolayer. 1×10 5 CVB3 plaque forming units (PFU) were diluted in 100 μl PBS and injected intraperitoneally. After 7 days, the success of the VM model was confirmed by histopathological examination (HE staining).

[0087] To verify the cardioprotective effect of M2-Exo in vivo, on day 0 of VM model establishment, 2 × 10 11 M2-Exo or PBS was injected into the myocardium of mice (particles / site).

[0088] We used hematoxylin and eosin (HE) staining to evaluate the histopathology of VM. The hearts of mice were collected. The tissues were fixed in 10% formalin and embedded in paraffin. 5 μm thick sections were cut and stained with HE (YEASEN, China). Two pathologists blindly evaluated the inflammatory cell infiltration in the transverse tissue sections of the heart.

[0089] Serum cTnI levels were measured using the DXI800 (Becman Coulter, USA) immunoassay analyzer from Yijishan Hospital; IFN-γ, IL-4, and IL-13 cytokine levels in cell supernatants were detected using cytokine ELISA kits (R&D Systems, USA); transthoracic echocardiography was performed using Vevo 3100LT and MX550D linear array transducers (FUJIFILM VisualSonics). Cardiac function was measured on left ventricular long-axis B-mode images.

[0090] To investigate the role of M2-Exo in VM, exosomes or PBS were injected into myocardial tissue after the VM model was successfully established. The dose of exosomes was determined based on our preliminary dose range experiment. On the first day of CVB3 infection, M2-Exo and PBS were injected into mice intramyocardially. On the 7th day after CVB3 infection, M2-Exo led to a reduction in myocardial inflammation, such as a reduction in localized inflammatory lesions and inflammatory area ( Figure 2 A). Consistent with this result, M2-Exo significantly reduced serum cTnI levels associated with systemic diseases and alleviated the symptoms of weight loss ( Figure 2 B and C). In addition, M2-Exo significantly increased the survival rate after CVB3 infection from approximately 50% to 75% ( Figure 2 D). We also detected the concentrations of pro-inflammatory cytokine IFN-γ and anti-inflammatory cytokines (IL-4 and IL-13) in the heart tissue of VM mice after treatment with M2-Exo or PBS. The results showed that injection of M2-Exo reduced the production of IFN-γ and increased the levels of IL-4 and IL-13 ( Figure 2 E). Shortening fraction and ejection fraction play a role in predicting the future of cardiac function. M2-Exo improved the cardiac function of VM mice that survived for 5 weeks by increasing the left ventricular short axis shortening rate (%) and ejection fraction (%). Figure 2 F). Taken together, these results suggest that M2-Exo exerts a protective effect by reducing mortality and cardiac dysfunction in CVB3-induced VM mice.

[0091] Example 3 M2-Exo promotes the transition of macrophages to M2 phenotype

[0092] Flow cytometry was used to detect macrophage phenotype. First, gentleMACS TM Single cell suspensions of the heart were prepared by tissue dissociators (Miltenyi Biotec, Auburn CA) and stained with anti-CD11b (eBioscience; BD Pharmingen; Biolegend) for 30 minutes. Cells were fixed and permeabilized using fixative and permeabilization solutions (eBiocience) and then stained with anti-iNOS (eBioscience) and anti-Arg1 or anti-CD206 (Thermo Flyscience). After staining, samples were measured using a flow cytometer (Cytoflex, Becman Coulter) and data were analyzed using FlowJo software (Treestar, USA).

[0093] Immunofluorescence: Hybridization was performed with fixed cultured cells at 60°C. For immunofluorescence, fixed cells were incubated with the primary antibody at 37°C. After 2 hours, cells were treated with fluorescently labeled secondary antibodies for 1 hour at 37°C. Finally, cell DNA was stained with DAPI (Sigma). The information of the antibodies is as follows: CD68 antibody (Abcam, UK), iNOS antibody (Abcam), arginase antibody (Abcam), goat anti-mouse IgG (Abcam). Images were captured and analyzed using a Zeiss LSM800 confocal microscope.

[0094] Flow cytometric analysis showed that M1 macrophages (CD11b + iNOS + ) decreased, while the proportion of M2 macrophages (CD11b + Arg1 + ) increased in proportion ( Figure 3 A). In addition, qRT-PCR analysis also showed that M2-Exo inhibited the expression of M1 markers (NOS2) and induced the expression of M2 markers (Arg1, FTZZ1, and YM1) ( Figure 3 B). Western blot analysis confirmed that the M1 marker iNOS was lowly expressed and the M2 marker Arg1 was highly expressed in VM mice treated with M2-Exo ( Figure 3 C). Fluorescence results showed that the co-localization of the M2 marker (Arg1) and the macrophage marker CD68 in the heart tissue of VM mice treated with M2-Exo was significantly increased, but the co-localization of the M1 marker (iNOS) and CD68 was barely detected ( Figure 3 D) These data suggest that in the VM model, M2-Exo suppresses the M1 macrophage phenotype and promotes the polarization of M2-Exo toward the M2 phenotype.

[0095] Example 4 lncRNA D130043N08 in M2-Exo regulates macrophage polarization

[0096] Sequencing of M2-Exo lncRNA: performed by RiboBio (Guangzhou, China). lncRNA D130043N08smart silencer (a siRNA mixture containing three ASOs and three siRNAs, as shown in Table 1) was synthesized by RiboBio. lncRNA D130043N08 smartsilencer was transfected into BMDM using riboFECTTM CP (RiboBio) according to the manufacturer's instructions. After 24 hours, the cells were used for subsequent experiments.

[0097] Exosomes can mediate intercellular communication by exchanging lncRNA with recipient cells. To explore the role of lncRNA in the cardioprotection of M2-Exo, lncRNA sequencing analysis of M2-Exo was performed by RiboBio. D130043N08, the sequence is shown in SEQ ID NO: 1, which is highly expressed in M2 macrophages and M2-Exo ( Figure 4 B and C). D130043N08 is located on chromosome 10 and is a sequence of approximately 3847 nt, originating from the intron 1 region of the coding gene SOCS2 ( Figure 4 D). SOCS2 is a key signaling molecule that determines the polarization phenotype of macrophages. RNA FISH analysis showed that D130043N08 is mainly located in the nucleus ( Figure 4 E). In addition, coding potential calculation software predicted that D130043N08 had almost no protein coding capacity ( Figure 4 F).

[0098] Subsequently, we further analyzed the role of D130043N08 in macrophage polarization. Compared with M1 macrophages, expression time course analysis showed that the expression of D130043N08 in M2 macrophages increased at 18 hours and peaked at 30 hours ( Figure 4 G). We detected the expression of D130043N08 in macrophages during the dynamic process of macrophage repolarization. Macrophages with M1 phenotype were repolarized to M2 phenotype by treatment with IL-4. Macrophages with M2 phenotype were repolarized to M1 phenotype by treatment with LPS and IFN-γ. We found that the expression of D130043N08 in macrophages increased during the polarization of M1 to M2, but decreased during the polarization of M2 to M1 ( Figure 4 H and I). In addition, during VM, the expression of D130043N08 was significantly reduced ( Figure 4 J). In conclusion, our data suggest that D130043N08 plays a key role in promoting macrophage polarization.

[0099] Example 5 D130043N08 in M2-Exo was involved in macrophage polarization in vitro.

[0100] For in vitro uptake of M2-Exo, PKH26 (Umibio)-labeled M2-Exo (200 μg / ml) was added to BMDM. After incubation for 24 h at 37 °C, BMDM were washed three times with PBS to remove excess M2-Exo. Then, BMDM were fixed with 4% paraformaldehyde for 10 min and stained with DAPI for 5 min. Images were acquired with a LSM800 confocal microscope (Zeiss, Mainz, Germany). Cells or exosomes collected for immunoblotting were lysed in sample buffer (Sigma, USA). Protein concentration was determined using a BCA protein assay kit (Beyotime). Protein lysates were separated by SDS-PAGE and transferred to NC filters (Millipore). Then, the NC membranes were subsequently incubated with primary antibodies: iNOS (Abcam), Arg1 (Abcam), and β-actin (Abcam). β-actin served as a control. After incubation with secondary antibodies and ECL (enhanced chemiluminescence, Millipore), protein bands were analyzed by Bio-Rad ChemiDoc Touch Imaging System (Bio-Rad, Hercules, CA, USA). Protein bands were quantitatively analyzed using ImageJ software.

[0101] Real-time fluorescence quantitative PCR (qRT-PCR) Total RNA from cells or tissues was extracted using Trizol reagent (Ambion, Life Technologies, CA, USA). Total RNA was then reverse transcribed into cDNA using QuantiTect reverse transcription kit (Thermo Scientific, USA). SYBR Green dye-based quantitative RT-PCR was performed using SYBR Green PCR Master Mix (Qiagen, Germany) and Bio-Rad's CFX96 RT-PCR system. GAPDH was used as an internal reference. Cycle threshold (2 -ΔΔCT ) method to calculate the expression level of mRNA or lncRNA.

[0102] Arginase activity assay BMDM were treated with M2-Exo (si-NC) or M2-Exo (si-D130043N08) for 48 h and then stimulated with IL-4 for another 24 h. Arginase activity was then detected. BMDM were lysed with 0.1% Triton X-100 for 30 min and then incubated with an equal volume of 50 mM Tris-HCl / 10 mM Cl2Mn·4H2O (pH 7.5) at 55°C for 10 min. L-Arginine was hydrolyzed by 0.5 M L-arginine ester (pH 9.7) and the reaction was terminated with {H2SO4 / H3PO4 / H2O (1:3:7, v / v / v)} solution and 9% 2-isonitroisopropylphenol. Samples were measured at 540 nm by a microplate reader (BioTek Epoch, Winooski, Vermont). The final concentration of urea was calculated by generating a standard curve.

[0103] result

[0104] We found that M2-Exo was taken up into macrophages and localized in the cytoplasm within 6 hours ( Figure 5 A). To examine the role of D130043N08 in M2-Exo, we transfected BMDM with D130043N08 smart silencer to inhibit the expression of D130043N08 in M2-Exo, and then purified exosomes from the culture supernatant. qRT-PCR showed that the expression of D130043N08 was knocked down in M2-Exo (si-D130043N08) ( Figure 5 B). Meanwhile, in macrophages treated with M2-Exo (si-D130043N08), the expression of M1 marker (NOS2) was increased, and the expression of M2 markers (Arg1, FIZZ1, and YM1) was decreased ( Figure 5 C). Consistently, M2-Exo (si-D130043N08)-treated BMDM macrophages showed upregulation of M1 markers (iNOS) and downregulation of M2 markers (Arg1) and arginase activity ( Figure 5 D and E). These results indicate that D130043N08 present in M2-Exo is involved in the regulation of macrophage polarization.

[0105] Example 6 D130043N08 participates in the protection of myocardium by M2-Exo

[0106] To explore the involvement of D130043N08 in the cardioprotective effect of M2-Exo in vivo, we established a VM model in BALB / c mice and used flow cytometry analysis to detect the phenotypes of M1 and M2 macrophages after mice were treated with M2-Exo (si-NC) or M2-Exo (si-D130043N08). Figure 6 A). Compared with the M2-Exo(si-NC) group, the M1 macrophages (CD11b + iNOS + ) increased significantly. At the same time, M2 macrophages (CD11b + CD206 + ) was reduced by D130043N08 knockdown. Our results suggest that D130043N08 is involved in M2-Exo-mediated macrophage polarization in VM.

[0107] In addition, we investigated the level of myocarditis and myocardial function after M2-Exo(si-D130043N08) treatment of VM mice. HE staining showed that the area of ​​focal inflammatory cell infiltration in cardiomyocytes was significantly increased in the M2-Exo(si-D130043N08) group mice compared with the M2-Exo(si-NC) group ( Figure 6 B). At week 5, we performed echocardiography on VM mice. After D130043N08 silencing, left ventricular ejection fraction and fractional shortening were significantly reduced ( Figure 6 C and D). In conclusion, our results suggest that D130043N08 may be a key inclusion factor in the regulatory role of M2-Exo, responsible for the modulation of macrophage polarization and cardioprotection.

[0108] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An M2 macrophage exosome, characterized in that: It contains lncRNA D130043N08, whose sequence is shown in SEQ ID NO:

1.

2. Use of the exosomes according to claim 1 in the preparation of a drug for treating viral myocarditis.

3. Use of a long non-coding RNA in the preparation of a drug for treating viral myocarditis, characterized in that: The long non-coding RNA is lncRNA D130043N08, and its sequence is shown in SEQ ID NO:

1.

4. A M2 macrophage exosome lncRNA siRNA, characterized in that: is a siRNA cocktail containing three ASOs and three siRNAs, including: ASO1:GTCAAGACAGCCTGATCAT; ASO2:CAATCCTTGTGCATTTCAA; ASO3: CTCGCTTGCCTCAAATAA; siRNA1:TGCTGGGTGTGGCTTGGGAA; siRNA2: TTCTCTTGGCCACCCAGTCT; and siRNA3: CCATCTTCTCTAGAGTCTAG.

5. Use of the lncRNA siRNA according to claim 4 in regulating M1 or M2 macrophage polarization, wherein the use is a non-disease treatment method.

Images