Hybridoma cell strain secreting anti-large yellow croaker T lymphocyte surface CD4-2 molecular monoclonal antibody

Abstract

The invention discloses a hybridoma cell strain CD4-2-2E7 secreting an anti-large yellow croaker T lymphocyte surface CD4-2 monoclonal antibody, the hybridoma cell strain CD4-2-2E7 is registered and preserved in China Center for Type Culture Collection on May 29, 2024, and the preservation number is CCTCC (China Center for Type Culture Collection) NO: C2024143. The anti-large yellow croaker T lymphocyte surface CD4-2 monoclonal antibody secreted by the hybridoma cell strain CD4-2-2E7 has strong specificity and high sensitivity, and can provide a powerful tool for research on proliferation, differentiation, functions and related immunological mechanisms of large yellow croaker CD4 + T lymphocytes. The method has important theoretical and practical significance for research on adaptive immune response rules of large yellow croakers and immune prevention and control of diseases, and has a wide prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of monoclonal antibody preparation, and specifically relates to a hybridoma cell line CD4-2-2E7 secreting anti-large yellow croaker T lymphocyte surface CD4-2 monoclonal antibody and an application thereof. Background Art

[0002] As early as 5 million years ago, bony fish had already produced B lymphocytes and T lymphocytes, and evolved an acquired immune system that can resist the invasion of various external pathogens, becoming the most important line of defense in the vertebrate immune system. The occurrence, development mechanism and function of T cells have made great progress in mammals, but there is still a lack of extensive and in-depth research in bony fish (Ding Ning. Molecular characteristics of CD3 of large yellow croaker and preparation of CD3ε polyclonal antibodies [D]. Fujian Agriculture and Forestry University, 2021). In recent years, with the continuous expansion of aquaculture scale, aquaculture diseases have increased year by year, and the prevention and control of aquaculture diseases has become a key research direction in the field of aquaculture. How to improve the immunity of large yellow croaker by studying its T lymphocytes, thereby resisting pathogen invasion, preventing and treating diseases, is the research direction of this invention.

[0003] The cellular immune response mediated by T lymphocytes is an important component of the adaptive immune response of bony fish. It is divided into two subsets: helper T lymphocytes (Th) and cytotoxic T lymphocytes (CTLs) (Sizemore RC, Miller NW, Cuchens MA, et al. Phylogeny of lymphocyte heterogeneity: The cellular requirements for in vitro mitogenic responses of channel catfish leukocytes[J]. The Journal of Immunology, 1985, 133(6):2920-2924). CD4 is a Th cell surface molecule marker. Teleost Th cells contain two membrane surface antigen molecules, CD4-1 and CD4-2 (Kaiqiong Mao, Wei Chen, Yinnan Mu, JingqunAo, Xinhua Chen, Molecular characterization and expressionanalysis during embryo development of CD4-1homologue in large yellow croakerLarimichthys crocea, Fish & Shellfish Immunology, Volume 64, 2017, Pages 146-154, ISSN 1050-4648). Fish CD4-1 molecules can be expressed not only on CD4 + The CD4-2 molecule in fish is expressed only on the surface of CD4 + On the surface of T lymphocytes, it can be used as CD4 + T lymphocyte-specific molecular markers (Takizawa F, Magadan S, Parra D, Xu Z, Korytář T, Boudinot P, Sunyer JO. Novel Teleost CD4-Bearing Cell Populations Provide Insights into the Evolutionary Origins and Primordial Roles of CD4 + Lymphocytes and CD4 +Macrophages. J Immunol. 2016 Jun 1;196(11):4522-35.). Therefore, the monoclonal antibody against fish CD4-2 molecule was prepared. + It provides an effective tool for the sorting of T lymphocytes and related functional studies. + There are few studies on the sorting and function of T lymphocytes. With the help of high-quality anti-large yellow croaker CD4-2 monoclonal antibodies, large yellow croaker CD4-2 can be sorted and analyzed. + T lymphocytes can be sorted and identified for CD4 + It provides a powerful tool for the study of T lymphocyte proliferation, differentiation, function and related immunological mechanisms, and has important theoretical and practical significance for the study of the adaptive immune response laws of large yellow croaker and the immune prevention and control of diseases. Summary of the invention

[0004] The object of the present invention is to provide a hybridoma cell line CD4-2-2E7 which secretes high-quality anti-large yellow croaker T lymphocyte surface CD4-2 monoclonal antibody.

[0005] To achieve the above object, the present invention adopts the following technical solution: The present invention first provides a hybridoma cell line CD4-2-2E7 of an anti-large yellow croaker T lymphocyte surface CD4-2 monoclonal antibody. The hybridoma cell line CD4-2-2E7 has been deposited in the China Center for Type Culture Collection on May 29, 2024, with a deposit number of CCTCC NO: C2024143, and a deposit address of Wuhan University, Wuhan City, Hubei Province.

[0006] The invention also provides a monoclonal antibody against CD4-2 on the surface of large yellow croaker T lymphocytes. The monoclonal antibody is secreted and produced by a hybridoma cell line CD4-2-2E7 with a deposit number of CCTCC NO: C2024143.

[0007] The present invention also provides a method for preparing the above-mentioned anti-large yellow croaker T lymphocyte surface CD4-2 monoclonal antibody, comprising the following steps: combining the hybridoma cell line CD4-2-2E7 with the limiting dilution method and the ELISA method to screen out the hybridoma cell line CD4-2-2E7 that secretes the anti-large yellow croaker T lymphocyte surface CD4-2 monoclonal antibody, and then obtain the monoclonal antibody.

[0008] The present invention also provides a method for treating a yellow croaker T lymphocyte surface CD4-2 monoclonal antibody in a manner that specifically recognizes CD4-2 in yellow croaker head kidney leukocytes. + Application in T lymphocytes.

[0009] The beneficial effects of the present invention are: The present invention is to immunize animals with purified large yellow croaker recombinant CD4-2 / Fc fusion protein, and then fuse spleen cells (taken from animals immunized with antigens) that produce monoclonal antibodies against CD4-2 on the surface of large yellow croaker T lymphocytes with myeloma cells to obtain a hybridoma cell line that can secrete specific antibodies. The cell line can secrete monoclonal antibodies against CD4-2 on the surface of large yellow croaker T lymphocytes. This antibody has strong specificity and high sensitivity, and can be used for large yellow croaker CD4 + The research on T cell-mediated cellular immune response has important theoretical and practical significance for the immune prevention and control of large yellow croaker diseases and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 : Western-blot results of recombinant CD4-2 / Fc fusion protein and recombinant CD4-2 / His fusion protein; Figure 2 : Flow cytometry was used to detect lymphocytes labeled with CD4-2 monoclonal antibody on the surface of large yellow croaker T lymphocytes.

[0011] Figure A: Yellow croaker head kidney leukocyte sample labeled with isotype primary antibody control; Figure B: Yellow croaker head kidney leukocyte sample labeled with CD4-2 monoclonal antibody, CD4-2 monoclonal antibody can specifically label CD4 in Yellow croaker head kidney leukocytes + T lymphocytes.

[0012] Figure 3 : Immunofluorescence labeling of leukocytes and lymphocytes in the head kidney of large yellow croaker; In the figure, blue indicates the cell nucleus labeled with DAPI, and green indicates CD4 specifically labeled with monoclonal antibodies. + T cells.

[0013] Figure 4 : RT-RCR results of monoclonal antibody specifically recognizing lymphocytes from head kidney of large yellow croaker. DETAILED DESCRIPTION In order to make the contents of the present invention easier to understand, the technical solution of the present invention is further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0015] The hybridoma cell line CD4-2-2E7 of the present invention was deposited in the China Center for Type Culture Collection on May 29, 2024, with a deposit number of CCTCC NO: C2024143, and the deposit address is: Wuhan University, Wuhan City, Hubei Province.

[0016] Example 1 Preparation and identification of large yellow croaker CD4-2 monoclonal antibody 1 Preparation of large yellow croaker specific antigen A pair of primers for specific amplification of the extracellular segment of CD4-2 were designed based on the sequence of large yellow croaker CD4-2: Upstream primer F: CTTGTCAC GAATTC GAATGTGTTCGTCACAAAACCAGAG, Downstream primer R:CCCGCTGGG AGATCT CCACTTGAGGCCCAGCAAGTC; (1) Preparation of large yellow croaker CD4-2 immunogen: The target fragment is obtained after PCR amplification using the above primers and can be directly connected to the plasmid that has also been double-digested with EcoR I and Bgl II.

[0017] The pINFUSE-mIgG2b-Fc2 vector was treated with EcoR I and Bgl II enzymes, mixed with the target fragment at a volume ratio of 1:4, and added to T 4 DNA ligase was added and connected overnight to obtain CD4-2 / Fc recombinant plasmid. The above recombinant plasmid was transferred into DH5α competent cells, spread on LB solid medium plates containing 20 μg / mL Zeocin, and inverted for 16 hours at 37°C. A single colony was picked and inoculated into 500 μL LB liquid medium and shaken at 37°C for 2 hours, and then DNA was extracted and sequenced from the bacterial solution. The plasmid was extracted from the bacterial solution with correct sequencing.

[0018] The recombinant plasmid was transfected to a density of 8×10 5 cells / mL in 293F cells (transfection medium: OptiPRO TM SFM SerumFree Medium [-]L-Glutamine ) at 37°C and 5% CO 2 Incubate incubator for 7-8 days, centrifuge at 1000 rpm for 5 minutes, and take the supernatant; centrifuge at 8000 rpm for 40 minutes, take the supernatant, filter through 0.22 μm filter membrane, load onto Protein A affinity column, and track and measure the protein concentration of the eluate with UV spectrophotometer. When eluting, first use 0.1 M phosphate solution (pH 7.2) to elute impurities, then use 0.1 M citric acid solution (pH 2.7) to elute proteins, and collect the full band of the protein peak, which is the high-purity large yellow croaker recombinant CD4-2 / Fc fusion protein, the molecular weight of which is about 65 kD ( Figure 1 ).

[0019] (2) Preparation of large yellow croaker CD4-2 detection source: The target fragment was obtained by amplifying the above primers by PCR, and cloned using pEASY®-Blunt Simple CloningKit (All-in-one Gold CB111-01). The target fragment was connected to the Blunt Simple vector, and the ligation product was transferred into DH5α competent cells and spread on LB solid medium containing 100 μg / mL ampicillin. After culturing at 37°C overnight, a single colony was picked and transferred to 4 mL LB liquid medium containing 50 μg / mL ampicillin, and shaken at 37°C for 2 h. DNA was then extracted and sequenced from the bacterial solution, and the plasmid was extracted from the bacterial solution with correct sequencing.

[0020] Use BamH Ⅰ and Xho Ⅰ double restriction enzymes to digest the vector pFastBac TM 1, mixed with the above target fragment at a volume ratio of 1:4, and added T 4 DNA ligase was used to obtain CD4-2 / His recombinant plasmid after ligation. The recombinant plasmid was transformed into competent cells DH10Bac and cultured at 37°C overnight. First, 100 μL of Blue-Gal and IPTG mixture was applied on LB culture plates (triple antibody plates) containing kanamycin, gentamicin and tetracycline. The Blue-Gal and IPTG mixture was 70 μL Blue-Gal (20 mg / ml) and 30 μL IPTG (0.5 mol / L) and dried slightly. 10 μL of the above-mentioned transformed cells was taken, diluted 10 times with LB liquid culture medium, and then applied on the triple antibody plate and cultured in a 37°C incubator for 48 h. Then, white spots were picked for PCR amplification, and the amplified products were detected by 1.0% agarose gel electrophoresis. The colonies with the correct bands were inoculated into LB liquid culture medium for culture, and then the plasmids were extracted.

[0021] The recombinant protein was expressed in insect cells. The recombinant plasmid was transfected into insect cells at a density of 5×10 5 cells / mL of SF 21 insect cells, cultured in SF-900 medium at 28°C incubator for 5 days, centrifuged at 500 g for 5 min, and took the supernatant. The supernatant was cultured for 3 days at a ratio of 1:20 to SF 21 insect cells, and repeated 2-3 times until the quantitative supernatant was taken for Western blot detection with correct and obvious bands (bands around 30 kD), centrifuged at 500 g for 5 min, collected all the supernatant, and added to 5×10 5cells / mL, the cells were cultured in SIM HF medium at 28°C for 3 days, centrifuged at 500 g for 5 min, the supernatant was taken, combined with nickel medium at 4°C overnight, and then treated with 0 mM imidazole (0.5 mM NaCl + 20 mM NaH 2 PO 4 ·2H 2 O), 20 mM imidazole, 60 mM imidazole to elute impurities, and then 500 mM imidazole to elute the protein, thus obtaining a high-purity large yellow croaker recombinant CD4-2 / His fusion protein with a molecular weight of about 30 kD ( Figure 1 ).

[0022] The sequence of the extracellular segment of CD4-2 is as follows:.

[0023] 2. Mouse immunization Five female BALB / c mice aged 6-8 weeks were immunized. The immunization procedure included three basic immunizations and one booster immunization. The basic immunization time was: 0 d, 15 d, and 30 d; the booster immunization time was: 3 days before fusion. In the first immunization, the recombinant CD4-2 / Fc fusion protein was mixed with an equal volume of Freund's complete adjuvant. After complete emulsification by a mixing oscillator, it was subcutaneously injected at multiple points on the back of the neck at a dose of 150 μg / mouse. In the second and third immunizations, Freund's complete adjuvant was replaced with Freund's incomplete adjuvant, and the antigen injection dose was adjusted to 75 μg / mouse. The other steps were the same as the first immunization. Before the booster immunization, blood was collected from the ocular venous plexus of the mouse to determine the titer, and the mouse with the highest titer was selected for booster immunization. Three days before fusion, the recombinant CD4-2 / Fc fusion protein was diluted with physiological saline, filtered and sterilized, and directly injected into the mouse peritoneum at a dose of 125 μg / mouse for the final booster immunization.

[0024] 3. Establishment of hybridoma cell lines (1) Preparation of myeloma cell (SP 2 / 0) suspension Select and collect myeloma cells with good growth status and cell density of 70% in the logarithmic growth phase, centrifuge and discard the supernatant, collect the cell pellet, wash it once with RPMI-1640 incomplete medium, and then resuspend it with 10 mL RPMI-1640 incomplete medium to obtain a myeloma cell suspension.

[0025] (2) Preparation of mouse spleen lymphocyte suspension BALB / c mice 3 days after booster immunization were killed by cervical dislocation, and the mouse carcasses were immersed in 75% v / v ethanol for 5 min. The abdominal cavity was aseptically cut open to remove the spleen, which was washed with RPMI-1640 incomplete medium and then transferred to a plate containing RPMI-1640 incomplete medium. The spleen was ground with the tail of a syringe until no obvious red agglomerates were present. The ground cell suspension was filtered through a 70 μm filter, the filtrate was collected in a 50 mL centrifuge tube, and the volume of RPMI-1640 incomplete medium was supplemented to 40 mL. The tube was centrifuged at 1000 rpm at room temperature for 7 min, the supernatant was discarded, the cell pellet was collected, and the pellet was resuspended with RPMI-1640 incomplete medium to obtain a spleen cell suspension.

[0026] (3) Fusion of spleen cells and myeloma cells Count the cell suspensions in steps (1) and (2) and mix them in a ratio of 1:5, transfer them into a 50 mL centrifuge tube, centrifuge at 1000 rpm for 5 min, discard the supernatant, and collect the cell pellet. Take out the PEG-1500 (Sigma, catalog number 10783641001) preheated in a 37°C incubator for 2 h, gently knock the cell pellet, slowly drop 1 mL of PEG-1500 into the centrifuge tube, gently shake it while adding, and control the addition time to about 1 min. Then slowly add 1 mL of RPMI-1640 incomplete medium within 1 min, add 1 mL of RPMI-1640 incomplete medium slightly faster in the 2nd minute, and finally add 8 mL of RPMI-1640 incomplete medium to terminate the reaction. The entire reaction is carried out in a 37°C water bath. Stand in a 37°C incubator for 3 min, centrifuge at 800 rpm for 5 min, discard the supernatant, and collect the cell pellet. The cell pellet was gently knocked loose, and 2 mL of RPMI-1640 complete medium containing HAT (RPMI-1640 medium + 50×HAT + 10% Clone easy + 1% PS + 10% FBS) was added to resuspend the cells, and RPMI-1640 complete medium containing HAT (RPMI-1640 medium + 50×HAT + 10% Clone easy + 1% PS + 10% FBS) was added to 100 mL to obtain a cell suspension. The above cell suspension was transferred to a 96-well cell culture plate, 200 μL per well, and placed at 37°C, 5% CO 2 After culturing in an incubator for 7 days, the wells with positive clones were replaced with RPMI-1640 complete medium containing HAT (RPMI-1640 medium + 50×HAT + 10% Clone easy + 1% PS + 10% FBS) and incubated at 37°C, 5% CO 2 cultured in an incubator.

[0027] (4) Screening and cloning of positive hybridoma cells The next day, 100 μL of the cell culture supernatant in step (3) was taken for ELISA titer detection, and the recombinant CD4-2 / His fusion protein antigen with a concentration of 500 ng / mL was coated at 4°C overnight, blocked with PBS containing 5% BSA, the primary antibody was 100 μL of cell culture supernatant, the secondary antibody was Goat anti mouse HRP (1:5000 dilution), TMB color development solution was added, and the ELISA stop solution (Solebol) was added to stop the reaction and then the OD450 nm value was measured.

[0028] The positive hybridoma cells obtained by screening were cloned by limiting dilution method. The positive hybridoma cells obtained above were gently blown off from the culture wells, 20 μL was taken for counting, 100 μL of RPMI-1640 complete medium containing HT (RPMI-1640 medium + 50×HT + 10% Clone easy + 1% PS + 10% FBS) was added to each well of the 96-well plate in advance, and the cells were resuspended with RPMI-1640 complete medium containing HT (RPMI-1640 medium + 50×HT + 10% Clone easy + 1% PS + 10% FBS) to make 4000 cells in 200 μL of culture medium, and the cell suspension was added to the A1 well of the 96-well plate, and then diluted vertically and horizontally in turn, and finally the volume was supplemented to 200 μL / well, and placed in 37°C, 5% CO 2 Culture in the incubator for 7 days. Do not move the 96-well plate during this period. Use ELISA to detect the antibody specificity. If the cell wells with positive specific antibodies are detected, select cells with high antibody titer, single clone growth, and good growth conditions to continue subcloning. Move the cells in the positive wells to the 24-well culture plate, and add fresh RPMI-1640 complete medium containing HT (RPMI-1640 medium + 50×HT + 10% Clone easy + 1% PS + 10% FBS) to the corresponding original wells for continued culture to prevent contamination of the two or cell death. Finally, the hybridoma cell line CD4-2-2E7 that can stably secrete monoclonal antibodies is obtained. When the cells in the 24-well plate grow well, freeze them in time.

[0029] The cryopreservation method of hybridoma cell line CD4-2-2E7 is as follows: take the hybridoma cell line CD4-2-2E7 with vigorous growth and good morphology, make a cell suspension, centrifuge at 1000 rpm for 5 min, discard the supernatant, add 1 mL of cryopreservation solution (90% FBS + 10% DMSO), and the final cell density is 1×10 6 cells / mL, put 1 mL of cell suspension into a cryovial, tighten the screw cap, and then put the cryovial into a -80℃ ultra-low temperature freezer overnight (8-12 h), and then immerse it in liquid nitrogen for long-term storage. Hybridoma cells with full appearance, round and translucent, and vigorous division can be obtained.

[0030] (5) Purification and preparation of ascites 1 to 2 weeks before inoculation of hybridoma cells, 0.5 mL of Freund's incomplete adjuvant was injected intraperitoneally into 8-10 week-old female BALB / c mice. The cloned hybridoma cells were centrifuged at 1000 rpm, the supernatant was discarded, and the cell pellet was resuspended in 1× PBS (pH 7.2) to prepare a density of 2×10 6cells / mL of cell suspension, and inject 0.5 mL of the above cell suspension into the peritoneal cavity of each mouse; about 10 days after inoculation, the mouse abdomen was obviously swollen, and the mouse abdominal skin was disinfected with alcohol cotton balls, and the ascites was extracted with a 5 mL syringe. The ascites was centrifuged at 3000 rpm at 4°C for 20 min, the supernatant was taken, diluted 10 times with 1× PBS (pH 7.2), and then stored at 4°C.

[0031] Purification of ascites: Monoclonal antibodies were purified from ascites using Protein A column affinity chromatography. The ascites prepared above was slowly bound to the Protein A column at a flow rate of 0.2 mL / min, first rinsed with 1× PBS (pH 7.2), and then eluted with 0.1 MGlycine solution (pH 2.6). The full band of the protein peak was collected and treated with a desalting column (Pierce™ polyacrylamide desalting column (1.8K MWCO, 5 mL), Thermo-43426). The protein concentration was determined to be 1 mg / mL using a BCA kit, and then the purified monoclonal antibody was aliquoted and frozen at -80°C.

[0032] Example 2 Specificity verification of anti-large yellow croaker CD4-2 monoclonal antibody 1 Flow cytometry Take the head kidney tissue of healthy large yellow croaker, add 2 mL of L-15 culture medium containing 25 IU / mL heparin sodium, carefully grind with the tail end of a syringe, and filter through a 70 μm mesh to obtain the head kidney leukocytes.

[0033] (1) The crude white blood cells of the head kidney are about 1×10 7 cells, resuspended in 500 μL of L-15 medium containing 5% goat serum, and blocked at 4°C for 1 h; (2) Add 1 mL of anti-large yellow croaker CD4-2 monoclonal antibody (1 μg / mL) and incubate at 4°C for 45 min; (3) Resuspend in 1 mL of L-15 medium, centrifuge at 500 g for 5 min, discard the waste liquid, and wash twice with L-15 medium; (4) Add 1 mL of L-15 medium containing Goat anti mouse IgG1 Alexa Fluor 647 (2 μg / mL) to resuspend and incubate at 4°C for 30 min. (5) Resuspend in 1 mL of L-15 medium, centrifuge at 500 g for 5 min, discard the waste liquid, and wash twice with L-15 medium; (6) Resuspend in 1× PBS (pH 7.2), filter the cell suspension through a 70 μm mesh, and then analyze by flow cytometry.

[0034] The negative control group was incubated with the primary antibody Purified Mouse IgG1, κ Isotype Ctrl Antibody (BioLegend), and the other steps were the same.

[0035] The results showed that compared with the negative control, the monoclonal antibody labeled 20-30% of the cells with fluorescence. The monoclonal antibody prepared by the present invention can specifically recognize CD4-2 in the leukocytes of the head kidney of large yellow croaker. + T lymphocytes ( Figure 2 ).

[0036] 2 Immunofluorescence experiments (1) Take 3×10 cells from the flow cytometry step (6) 5 cells, fixed with 4% paraformaldehyde for 10 min and washed twice with 1× PBS (pH 7.2); (2) DAPI (2 μg / mL) staining for 5 min, followed by washing twice with 1× PBS (pH 7.2); (3) Transfer the sample to a 35 mm confocal culture dish, centrifuge at 500 g for 5 min, and perform laser confocal imaging.

[0037] The results showed that positive cells were round cells with a diameter of about 8 μm, with a large nucleus and a circle of green fluorescence around the cells. Negative cells were cells without green fluorescence, including B lymphocytes with a similar morphology to positive cells, and larger macrophages ( Figure 3 ).

[0038] 3 RT-PCR (1) Take the head kidney tissue of healthy large yellow croaker, add L-15 culture medium containing 25 IU / mL heparin sodium, carefully grind with the tail end of a syringe, and filter through a 70 μm mesh to obtain the head kidney leukocytes.

[0039] (2) After the cells were treated with the same experimental procedure as step 1, they were sorted using a flow cytometer. The resulting cells were CD4-2 + T cells and CD4-2 - T cells; (3) RNA was extracted and converted to cDNA according to the instructions of RNAprep Pure Micro-Sample Total RNA Extraction Kit (Tian Gen, DP420); (4) Perform PCR amplification according to the following procedure:

[0040] (5) Prepare 1.5% nucleic acid gel and perform electrophoresis at 150 V; The results show Figure 4As shown, CD4-2 + T cells contain marker genes for CD3, CD4-1, and CD4-2, but not B lymphocytes and CD8 + T cell marker gene; in contrast, CD4-2 - T cells do not contain the marker gene of CD4-2, which is consistent with the expected results, indicating that the monoclonal antibody prepared by the present invention can specifically recognize CD4-2 in the leukocytes of the head kidney of large yellow croaker. + T lymphocytes ( Figure 4 ).

[0041] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A hybridoma cell line CD4-2-2E7 secreting a monoclonal antibody against CD4-2 on the surface of T lymphocytes of large yellow croaker, characterized in that: The hybridoma cell line CD4-2-2E7 was deposited in the China Center for Type Culture Collection on May 29, 2024, with the deposit number CCTCC NO: C2024143, and the deposit address is: Wuhan University, Wuhan City, Hubei Province.

2. A monoclonal antibody against CD4-2 on the surface of T lymphocytes of large yellow croaker, characterized in that: The monoclonal antibody is secreted and produced by the hybridoma cell line CD4-2-2E7 with the deposit number CCTCC NO: C2024143.

3. A method for preparing the anti-large yellow croaker T lymphocyte surface CD4-2 monoclonal antibody as claimed in claim 2, characterized in that: The hybridoma cell line CD4-2-2E7 was screened out by combining limiting dilution method and ELISA method to secrete anti-large yellow croaker T lymphocyte surface CD4-2 monoclonal antibody, and then obtain the monoclonal antibody.

4. The anti-large yellow croaker T lymphocyte surface CD4-2 monoclonal antibody as claimed in claim 2 specifically recognizes large yellow croaker CD4-2 + Application in T lymphocytes.

Images