Phytophthora plant pathogenic oomycete histone lysine methyl transfer protein as well as coding gene and application thereof

Abstract

The invention discloses a phytophthora plant pathogenic oomycete histone lysine methyl transfer protein as well as a coding gene and application thereof. Wherein the phytophthora sojae histone lysine methyltransferase KMT3-1 is as shown in a sequence 2 in the specification, and the phytophthora sojae histone lysine methyltransferase KMT3-1 is as shown in a sequence 2 in the specification; the coding gene is shown as a sequence 1. Experiments prove that the KMT3-1 protein plays an important role in the growth and development process of phytophthora sojae, specifically, after the protein is deleted, the growth rate of phytophthora hyphae is slowed down, the sporangium yield is remarkably reduced, the release of zoospores is stopped, the oospore yield is reduced, the pathogenicity is reduced, and the like. Corresponding histone methyltransferase inhibitors have different degrees of activity on typical plant pathogenic oomycetes such as phytophthora sojae, phytophthora capsici and phytophthora infestans. The gene provided by the invention has great application potential in the aspect of preventing and controlling the crop epidemic diseases caused by phytophthora plant pathogenic oomycetes, and a novel bactericide developed on the basis of the protein as an action target has important practical significance in controlling the occurrence and prevalence of the crop epidemic diseases caused by phytophthora.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a histone lysine methyltransferase KMT3-1 (lysine methyltransferase 3-1) protein PsKMT3-1 from Phytophthora sojae, a coding gene thereof and an application thereof; in particular, it relates to a histone lysine methyltransferase KMT3-1 from Phytophthora spp. in a plant pathogenic oomycete, a coding gene thereof and an application thereof. Background Art

[0002] Oomycetes can be divided into animal pathogenic oomycetes and plant pathogenic oomycetes, which are widely distributed. Among them, plants can harm a variety of agricultural crops, causing huge economic losses to agricultural production around the world. Although oomycetes and fungi are similar in terms of hyphal morphology and nutrient absorption methods, oomycetes are more distantly related to fungi and more closely related to diatoms, both of which belong to the kingdom of the tricholoma. Among them, the Phytophthora oomycetes are one of the "main forces" that harm crops, including a variety of oomycetes with huge harm, such as the potato late blight (Phytophthora infestans) that caused the "Irish famine" in 1845, and the pathogenic fungus of soybean blight (Phytophthora sojae) known as the "destructive disease of soybean". Due to the differences in phylogeny between oomycetes and filamentous fungi and the increasingly serious problem of drug resistance, the development of oomycete fungicides based on new targets is particularly important and urgent.

[0003] Phytophthora sojae is a typical soil-borne plant pathogen, classified as one of the top ten plant pathogenic oomycetes, and has become a model species for international research on Phytophthora oomycetes. Phytophthora sojae can cause soybean seed rot, root rot, stem rot, and seedling wilt. At the same time, brown spots will appear on the microtubule bundles inside the stem base, which is also one of the main biological phenotypic indicators for identifying Phytophthora sojae, causing serious damage to soybean production. Unlike most Phytophthora fungi, it has a strong host specialization and can only cause harm to soybeans.

[0004] Histone lysine methylation is one of the most classic epigenetic marks that can change chromatin structure to regulate gene expression, mainly including H3K4me3, H3K9me3, H3K27me3, and H3K36me3. Among them, H3K36me3 is deposited on chromatin after RNA polymerase II (Pol II) elongation, usually marking the active gene body region. In addition to the discovery that H3K36me3 is associated with actively transcribed genes, emerging evidence shows that H3K36me3 is involved in regulating a variety of cellular molecular biological processes, including DNA replication and damage repair, RNA alternative splicing and modification, DNA methylation, etc. In yeast, once H3K36me3 is deposited on the active transcribed gene body, it will recruit histone deacetyl complexes to reset the activation of chromatin, thereby preventing the initiation of cryptic transcription. H3K36me3 methyltransferase was originally identified as Set2 in yeast and then identified as homologous KMT3a in mammalian cells. H3K36me3 plays an important role in normal mammalian development and response to adverse stress. However, the biological functions of H3K36me3 modification and its methyltransferase in plant pathogenic oomycetes are still unclear.

[0005] Compared with fungi, there are fewer drugs for the prevention and control of oomycete diseases. In addition, due to the increasingly serious problem of drug resistance in the field, it is urgent to develop oomycete fungicides with new drug targets. The present invention has important guiding significance for the creation of new oomycete inhibitors with histone lysine methylation H3K36me3 methyltransferase PsKMT3-1 as a molecular target. Summary of the invention

[0006] The inventors' previous studies found that the homology between the KMT3-1 protein of Phytophthora and the histone lysine methyltransferase KMT3 protein in fungi was less than 15%, indicating that the Phytophthora KMT3-1 protein may have functional characteristics different from the fungal MesA protein. Further bioinformatics analysis found that the homology between the soybean Phytophthora KMT3-1 protein and other Phytophthora KMT3-1 proteins was very high, all above 60%, and the homology with the Phytophthora cinnamomi KMT3-1 protein was 90.96%. In summary, the KMT3-1 protein has a high homology in Phytophthora fungi.

[0007] The present invention carries out relevant research work on the function of histone lysine methyltransferase protein PsKMT3-1 in Phytophthora, which will provide a deeper understanding of the role of histone lysine methylation modification of Phytophthora in regulating the growth and development of Phytophthora and its interaction with the host, and provide reference and reference for the design of new control oomycete targets. Through the research of the inventors, it was found that PsKMT3-1 in Phytophthora is closely related to the hyphal growth rate, sporangium production, zoospore release, oospore development and pathogenicity of Phytophthora. Combined with the high sequence similarity and genetic conservation of KMT3-1 in three common Phytophthora plant pathogenic oomycetes, such as soybean Phytophthora, pepper Phytophthora, and Phytophthora infestans, it is fully demonstrated from a biological level that this type of gene plays an important role in the Phytophthora plant pathogenic oomycetes. In order to test the potential of KMT3-1 protein as a target for fungicides against plant pathogenic oomycetes of the genus Phytophthora, the protein structures of three plant pathogenic oomycetes KKMT3-1 of the genus Phytophthora were predicted by homology modeling Alpha fold2. The virtual screening software Schrodinger Maestro 12.8 was used to conduct virtual screening of small molecule active compounds. The small molecule compound ligands were derived from the PubChem small molecule library (https: / / pubchem.ncbi.nlm.nih.gov / ). Three compounds were selected based on the binding ability of KMT3-1 protein with small molecule compounds and the structure of small molecule compounds. By measuring their inhibitory activity on the mycelial growth of three Phytophthora fungi, a small molecule inhibitor lead compound was finally screened out. The molecular docking of this small molecule inhibitor lead compound with the KMT3-1 proteins of Phytophthora capsici, Phytophthora sojae, and Phytophthora infestans showed that it had good binding ability with the KMT3-1 proteins of these three Phytophthora genus. The above results fully demonstrate that KMT3-1 protein has the potential to serve as a molecular drug target for plant pathogenic oomycetes of the genus Phytophthora, and has important application prospects.

[0008] Therefore, the present invention provides a histone lysine methyltransferase KMT3-1 protein in Phytophthora pathogenic fungi, and names it based on the initials of the Latin names of different Phytophthora plant pathogenic oomycetes + KMT3-1. For example, Phytophthora sojae Histone lysine methyltransferase 3-1 (Phytophthora sojae Histone lysine methyltransferase, PsKMT3-1) is the following protein A1) or A2) A3) or A4):

[0009] A1) The amino acid sequence is the protein shown in SEQ ID NO: 2;

[0010] A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 2;

[0011] A3) a protein derived from the protein shown in SEQ ID NO: 2 having the same function as that of the protein shown in SEQ ID NO: 2 obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2;

[0012] A4) An amino acid sequence that has a similarity of more than 60%, preferably more than 75%, and more preferably more than 90% with the amino acid sequence shown in SEQ ID NO: 2 and has the same function as the amino acid sequence shown in SEQ ID NO: 2.

[0013] In order to facilitate the purification of the protein in A1), tags such as Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL) can be connected to the amino terminus or carboxyl terminus of the protein composed of the amino acid sequence shown in sequence 2 in the sequence table.

[0014] The proteins in A1)-A4) above can be synthesized artificially, or their coding genes can be synthesized first and then expressed biologically. The coding genes of the proteins in A2)-A4) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in sequence 1 in the sequence table, and / or performing missense mutations of one or several nucleotide pairs, and / or connecting the coding sequence of the above tag at its 5' end and / or 3' end.

[0015] Among them, in A1), sequence 2 (PsKMT3-1) in the sequence list consists of 1540 amino acid residues.

[0016] The second object of the present invention is to provide a nucleic acid molecule encoding the desired PsKMT3-1 protein. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA, hnRNA or tRNA.

[0017] Wherein, the coding gene of the above-mentioned KMT3-1 protein is as follows B1) or B2) or B3):

[0018] B1) a DNA molecule represented by the nucleotide sequence described in Sequence 1 in the sequence listing;

[0019] B2) a cDNA molecule or a DNA molecule having 75% or more, 85% or more, or 95% or more identity with the nucleotide sequence shown in B1) and encoding the above-mentioned PsKMT3-1 protein;

[0020] B3) A cDNA molecule or a DNA molecule which hybridizes with the nucleotide sequence defined in B1) or B2) under stringent conditions and encodes the above-mentioned PsKMT3-1 protein.

[0021] The above coding gene, sequence 1 in the sequence list consists of 4623 nucleotides; from the 1st to the 4623rd position at the 5' end of sequence 1, encodes the protein PsKMT3-1 shown in sequence 4 in the sequence list.

[0022] The RNA molecule is an RNA molecule transcribed from the coding gene;

[0023] Preferably, the sequence of the RNA molecule is as follows C1) or C2):

[0024] C1) an RNA sequence transcribed from the DNA sequence as shown in SEQ ID NO: 1, which has a similarity of 60% or more, preferably 75% or more, and more preferably 90% or more, and has the same function as the RNA sequence transcribed from the DNA sequence as shown in SEQ ID NO: 1;

[0025] C2) RNA sequence transcribed from the DNA sequence shown in SEQ ID NO: 1.

[0026] For example, the DNA sequence of the present invention can be hybridized with the DNA sequence shown in Sequence 1 under stringent conditions and encodes a DNA sequence of the protein shown in Sequence 2. The stringent conditions may be hybridization at 65°C using a solution of 6×SSC, 0.5% SDS, followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.

[0027] The third object of the present invention is to provide biological materials related to the above-mentioned nucleic acid molecules, including recombinant vectors, expression cassettes, recombinant microorganisms or transgenic plant cell lines. The recombinant vector can be a recombinant expression vector or a recombinant cloning vector. In the above-mentioned biological materials, the vector can be a plasmid, a cosmid, a phage or a viral vector; the microorganism can be a yeast, a bacterium, an algae or a fungus, such as Agrobacterium; the transgenic plant cell line does not include a propagation material. Specifically, it can be any one of the following D1) to D10):

[0028] D1) an expression cassette containing the coding gene according to claim 2;

[0029] D2) a recombinant vector containing the coding gene according to claim 2, or a recombinant vector containing the expression cassette according to D1);

[0030] D3) a recombinant microorganism containing the coding gene according to claim 2, or a recombinant microorganism containing the expression cassette according to D1), or a recombinant microorganism containing the recombinant vector according to D2);

[0031] D4) a transgenic plant cell line containing the coding gene of claim 2, or a transgenic plant cell line containing the expression cassette of D1);

[0032] D5) transgenic plant tissue containing the coding gene of claim 2, or transgenic plant tissue containing the expression cassette of D2);

[0033] D6) A transgenic plant organ containing the coding gene according to claim 2, or a transgenic plant organ containing the expression cassette according to D2);

[0034] D7) a nucleic acid molecule that inhibits the expression of the gene encoding the gene according to claim 2;

[0035] D8) An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in D7); The recombinant vector may include a CRISPR / Cas9-based gene knockout method, which is a Donor vector of the target gene and an sgRNA and Cas9 protein expression plasmid; The Donor vector is a recombinant vector containing a sequence of 800-1500bp upstream of the target gene to be knocked out, a Donor DNA sequence (which may be a gene sequence such as NPTII or GFP or RFP), and a sequence of 800-1500bp downstream of the target gene to be knocked out. The sgRNA and Cas9 protein co-expression plasmid is a vector encoding an sgRNA fragment targeting the target gene to be knocked out and a DNA sequence expressing the Cas9 protein, wherein the target gene to be knocked out is the PsKMT3-1 gene, and the sgRNA sequence (coding sequence) targeting the PsKMT3-1 gene is GAACGCAAAGAGCACTGCTA. Preferably, the sgRNA and Cas9 co-expression plasmid is based on the pYF515 vector as the starting vector, and the double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the PcMesA gene is inserted between the Nhe I and Bsa I enzyme recognition sites of the pYF515 vector to obtain the sgRNA and Cas9 co-expression plasmid;

[0036] D9) a nucleic acid molecule that inhibits the translation of the above RNA molecule;

[0037] D10) An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line producing the nucleic acid molecule described in D9).

[0038] The fifth object of the present invention is to provide the application of PsKMT3-1 protein of Phytophthora sojae and nucleic acid molecules encoding PsKMT3-1 protein or biological materials containing nucleic acid molecules encoding PsKMT3-1 protein.

[0039] The application is any one or more of the following 1)-7):

[0040] 1) Application in reducing the production of zoospores of oomycetes;

[0041] 2) Application in reducing the growth rate of oomycete hyphae;

[0042] 3) Application in reducing the sporangium production of oomycetes;

[0043] 4) Application in reducing the ability of oomycetes to infect hosts;

[0044] 5) Application in reducing oomycete oospore production;

[0045] 6) Application in reducing the pathogenicity of oomycetes to hosts;

[0046] 7) Application in inhibiting and / or killing oomycete pathogens.

[0047] Preferably, the oomycete is preferably Phytophthora, preferably Phytophthora sojae.

[0048] Among them, the applications include achieving the applications described in 1)-7) by inhibiting the transcription of the coding gene described in sequence 1 or making it inactive, or inhibiting the translation of the RNA molecule, or inhibiting the activity of the PsKMT3-1 protein described in sequence 2 or making it inactive.

[0049] In the application, by inhibiting the transcription of the above-mentioned coding gene, or inhibiting the translation of the above-mentioned RNA sequence, or inhibiting and / or making the above-mentioned PsKMT3-1 protein inactive, the growth rate of hyphae is interfered with, the yield of sporangium is affected, the yield of zoospores is affected, the yield of oospores is interfered with, and the ability to infect the host is regulated, thereby inhibiting and / or killing the growth of soybean phytophthora.

[0050] The sixth object of the present invention is to provide the use of the PsKMT3-1 protein shown in sequence 2 in the sequence table and the encoding gene shown in sequence 1 in the above sequence table as antibacterial or bactericidal agent targets in screening oomycete antibacterial or bactericidal agents.

[0051] The seventh object of the present invention is to provide a method for screening or assisting in screening antibacterial and / or bactericidal agents for oomycetes (such as Phytophthora, especially Phytophthora sojae), the method comprising applying a substance to be detected to the Phytophthora sojae pathogen. When the substance to be detected can inhibit the transcription of the above DNA sequence, or inhibit the translation of the above RNA sequence, or inhibit and / or inactivate the PsKMT3-1 protein as shown above, the substance to be detected is a candidate antibacterial and / or bactericidal agent for the plant oomycetes.

[0052] The eighth object of the present invention is to provide a method for reducing the activity of oomycete pathogens, comprising the following steps: inhibiting the transcription of the above-mentioned coding gene or making it deleted, or inhibiting the translation of the RNA molecule, or inhibiting the activity of the above-mentioned KMT3-1 protein or making it inactive;

[0053] Wherein, the reducing the activity of oomycete pathogens is to reduce the infection ability of the oomycetes to the host and / or the pathogenicity to the host, and / or reduce the growth rate of the oomycetes, and / or inhibit the production of oomycete sporangia, and / or inhibit the production of oomycete zoospores, and / or inhibit the production of oomycete oospores.

[0054] In the above method, the activity of the protein is inhibited or inactivated by inhibiting or reducing the expression of the gene encoding the KMT3-1 protein of the plant pathogenic oomycete of the genus Phytophthora. Specifically, this can be achieved by gene knockout or gene silencing.

[0055] The gene knockout refers to the phenomenon that a specific target gene loses its activity through homologous recombination. Gene knockout is the phenomenon that a specific target gene loses its activity through changes in its DNA sequence.

[0056] Gene silencing refers to the phenomenon of making a gene non-expressed or low-expressed without damaging the original DNA. Gene silencing can occur at two levels, one is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization and position effect, and the other is post-transcriptional gene silencing, that is, at the level after gene transcription, the gene is inactivated by specific inhibition of the target RNA, including antisense RNA, co-suppression, gene quelling, RNA interference (RNAi) and microRNA (miRNA)-mediated translation inhibition.

[0057] Preferably, the gene shown in sequence 1 in the sequence list of Phytophthora sojae is knocked out to inactivate the protein shown in sequence 2 in the sequence list.

[0058] In one embodiment of the present invention, the method for knocking out the above-mentioned gene is a gene knockout method based on CRISPR / Cas9.

[0059] Specifically, the gene knockout method based on CRISPR / Cas9 is to transfect the Donor vector and sgRNA expression vector of the target gene and the Cas9 expression plasmid into soybean phytophthora to screen for recombinant bacteria in which the target knockout protein loses its activity.

[0060] The Donor vector pBS-PsKMT3-1-NPTII is a recombinant vector containing a sequence of 800-1500bp upstream of the target gene to be knocked out, a Donor DNA sequence (which can be a gene sequence such as NPTII or GFP or RFP) and a sequence of 800-1500bp downstream of the target gene to be knocked out, which are sequentially connected. The sgRNA expression vector pYF2.3G-PsKMT3-1 is a sgRNA fragment vector that expresses the target gene to be knocked out, wherein the target gene to be knocked out is sequence 1 in the sequence list, and the sgRNA sequence targeting the PsKMT3-1 gene is sgPsKMT3-1: GAACGCAAAGAGCACTGCTA (targeting the 3688-3707th position of SEQ ID No. 1 of the PsKMT3-1 gene). Preferably, the sgRNA expression plasmid is a pYF2.3G-Ribo-sgRNA vector as a starting vector, and the double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the PsKMT3-1 gene is inserted between the Nhe I and Bsa I enzyme recognition sites of the pYF2.3G-Ribo-sgRNA vector to obtain the sgRNA expression plasmid. The Donor vector pBS-PsKMT3-1-NPTII, the sgRNA expression vector pYF2.3G-PsKMT3-1, and the Cas9 expression plasmid pYF2-Cas9 are used to knock out the full-length sequence of the PsKMT3-1 gene.

[0061] The use of substances that inhibit the expression and / or activity of PsKMT3-1 protein in the preparation of fungicides against plant oomycetes (such as Phytophthora, especially Phytophthora sojae) also falls within the protection scope of the present invention.

[0062] In the above application, the substance that inhibits the expression and / or activity of PsKMT3-1 protein is a substance that inhibits the expression of PsKMT3-1 protein and / or inhibits the transcription of the gene encoding the PsKMT3-1 protein and / or inhibits the translation of the RNA molecule transcribed from the gene encoding the PsKMT3-1 protein.

[0063] Experiments have shown that the KMT3-1 protein provided by the present invention plays an important role in the growth and development of Phytophthora itself. The gene knockout homozygous transformants were obtained using CRISPR / Cas9 gene editing technology. Compared with the wild-type parent strain, there are obvious changes, mainly including: the mycelial growth rate is significantly reduced after the loss of KMT3-1 protein, the number of sporangia is reduced, the release of zoospores stops, the oospore production is reduced, and the ability to infect host plants is weakened. Therefore, the Phytophthora KMT3-1 protein can play an important role in multiple processes such as Phytophthora vegetative growth, asexual reproduction, sexual reproduction and infection of hosts. The present invention provides technical support for the study of the pathogenic mechanism of Phytophthora pathogens, and provides potential molecular action targets for the development of new fungicides in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 (A) Schematic diagram of the structural domains of KMT3 of Phytophthora sojae, Phytophthora capsici, Phytophthora infestans and human. (B) Phylogenetic analysis results of the co-construction tree of arginine methyltransferase protein sequences of PRMT5 proteins of Phytophthora plant pathogenic oomycetes and various model research species based on MEGA11.0 (Note: the numbers on the branch lines represent the length of evolutionary branches. The shorter the branch length, the smaller the difference and the closer the evolutionary distance). (C) Structural model diagram of KMT3-1 of Phytophthora sojae (PsKMT3-1), Phytophthora capsici (PcKMT3-1), Phytophthora infestans (PiKMT3-1) and human KMT3 (Hm protein).

[0065] Figure 2 The hyphal growth, sporangium production, zoospore release, oospore production of soybean Phytophthora strain P6497 (WT), control transformant EV, PsKMT3-1 gene knockout homozygous transformants (Δ-PsKMT3-1-1, Δ-PsKMT3-1-2) and complemented transformants (Δ-PsKMT3-1 / PsKMT3-1) and the pathogenicity of each strain on the hypocotyls of soybean etiolated seedlings (A) and the corresponding data statistical bar graphs.

[0066] Figure 3 The soybean Phytophthora strain P6497 (WT), the control transformant EV, the PsKMT3-1 gene knockout homozygous transformants (Δ-PsKMT3-1-1, Δ-PsKMT3-1-2) and the complemented transformants (Δ-PsKMT3-1 / PsKMT3-1) were incubated with 10 μg / mL of the lead compound EZM0414 (C 22 H 29 Growth rate determination results under FN4O2).

[0067] Figure 4These are the molecular docking results of soybean Phytophthora KMT3-1 (PsKMT3-1), pepper Phytophthora KMT3-1 (PcKMT3-1), and Phytophthora infestans KMT3-1 (PiKMT3-1) proteins with the lead compound EZM0414. DETAILED DESCRIPTION

[0068] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0069] Soybean Phytophthora strain P6497: a standard strain donated by Professor Brett M. Tyler of Oregon State University (Tyler BM, Tripathy S, Zhang X, Dehal P, Jiang RH, Aerts A, Arredondo FD, Baxter L, Bensasson D, Beynon JL, et al. 2006. Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science 313: 1261-1266), stored in the Seed Pathology and Fungicide Pharmacology Laboratory, College of Plant Protection, China Agricultural University, and available to the public from China Agricultural University.

[0070] Culture medium or reagent formula:

[0071] 10% V8 solid medium: 100 mL V8 vegetable juice, 1.4 g CaCO3, stir to mix, dilute 10 times with deionized water, i.e. add 900 mL deionized water, add 15 g Agar, and sterilize at 121°C for 20 min.

[0072] 10% V8 liquid culture medium: 100 mL V8 vegetable juice, 1.4 g CaCO3, stir and mix, centrifuge at 12000 rpm for 5 min, take the supernatant, dilute 10 times with deionized water, and sterilize at 121°C for 20 min.

[0073] Nutrient pea broth (NPB): 125g peas were added to 1L deionized water, sterilized at 121℃ high pressure and heat for 20min, and filtered through gauze to obtain pea nutrient solution; 2.0g yeast extract, 5.0g glucose, 5.0g mannitol, 5.0g sorbitol, 2.0g CaCO3, 0.1g CaCl2, 0.5g MgSO4, 3.0g KNO3, 1.0g K2HPO4, 1.0g KH2PO4, stirred and mixed, centrifuged at 3000rpm for 10min or allowed to stand for 30min, supernatant was taken, and the volume was adjusted to 1L with pea nutrient solution, and 15g agar powder was added to the solid culture medium (NPBA), and sterilized by heat and heat for 20min. Before use, 2mL vitamin stock solution (Biotin 6.7×10 -7 g / mL; Folic acid 6.7×10 -7 g / mL; L-inositol 4.0×10 -5 g / mL; Nicotinic acid 4.0×10 -5 g / mL; Pyridoxine-HCl 6.0×10 -4 g / mL; Riboflavin 5.0×10 - 5 g / mL; Thiamine-HCl 1.3×10 -3 g / mL) and 2 ml of trace element stock solution (FeC6H5O7·3H2O 5.4×10 -4 g / mL; ZnSO4·7H2O 3.8×10 -4 g / mL; CuSO4·5H2O 7.5×10 -4 g / mL; MgSO4·H2O 3.8×10 -5 g / mL; H3BO32.5×10 -5 g / mL; Na2MoO4·H2O 3.0×10 -5 g / mL).

[0074] Pea Mannitol Medium (PM): 91.1 g mannitol, 1 g CaCl2, 2 g CaCO3, add about 900 mL pea nutrient solution, stir and mix for about 30 minutes, centrifuge at 3000 rpm for 10 minutes or let stand for 30 minutes, take the supernatant, make up to 1 L with pea nutrient solution, add 15 g agar powder to the solid culture medium (PMA), and sterilize with wet heat for 20 minutes.

[0075] Mycelial hydrolysate (20 mL): 10 mL 0.8 M mannitol, 0.8 mL 0.5 M KCl, 0.8 mL 0.5 M 4-morpholineethanesulfonic acid, 0.4 mL 0.5 M CaCl2, 0.12 g cellulase (Calbiochem, cat. No. 219466), 0.12 g lyase (Sigma, cat. No. L1412), dilute to 20 mL with sterile ultrapure water, mix well to dissolve, filter and sterilize with 0.22 μm filter membrane, and prepare before use.

[0076] MMG solution (250 mL): 18.22 g mannitol, 0.76 g MgCl2·6H2O, 2.0 mL 0.5 M 4-morpholineethanesulfonic acid (pH = 5.7), dilute to 250 mL with ultrapure water, and sterilize by filtration with a 0.22 μm filter membrane.

[0077] W5 solution: 0.1 g KCl, 4.6 g CaCl2·2H2O, 2.25 g NaCl, 7.8 g glucose, dissolved in ultrapure water to 250 mL, and sterilized by filtration with a 0.22 μm filter membrane.

[0078] PEG-CaCl2 solution (40% w / v): 12 g PEG 4000, 3.75 mL 0.5 M CaCl2, 3 mL sterile ultrapure water, sterilized by filtration with a 0.22 μm filter membrane.

[0079] The pBluescript II SK+ homology arm vector plasmid (Donor vector), sgRNA expression vector pYF2.3G-Ribo-sgRNA and Cas9 expression plasmid pYF2-Cas9 used in this example were all donated by Professor Brett M. Tyler of Oregon State University, USA.

[0080] Example 1. Obtaining the PsKMT3-1 protein of Phytophthora sojae and its encoding gene

[0081] In this embodiment, the soybean phytophthora KMT3-1 protein PsKMT3-1 and its coding gene (or cDNA) can be obtained by amplification of the primers listed in Table 1 using the DNA (or cDNA) of soybean phytophthora strain P6497 as a template. Among them, the material for DNA or RNA extraction is the mycelium of soybean phytophthora strain P6497. Among them, the coding gene of PsKMT3-1 is shown in Sequence 1 in the sequence table, and Sequence 1 in the sequence table consists of 4623 nucleotides; the nucleotides 1-4623 from the 5' end of Sequence 1 are the coding sequence, encoding the protein PsKMT3-1 shown in Sequence 2 in the sequence table. The above-mentioned protein or gene can also be artificially synthesized.

[0082] Table 1. Primers for amplification of the full-length coding gene of PsKMT3-1

[0083]

[0084]

[0085] Sequence 1 in the sequence listing is as follows:

[0086]

[0087]

[0088] Sequence 2 in the sequence table is as follows:

[0089]

[0090]

[0091] Example 2: Construction of a vector for knockout and complementation test of PsKMT3-1 gene in Phytophthora sojae

[0092] The method for constructing a gene knockout vector based on CRISPR / Cas9 and the sequences of the related vectors in this embodiment are disclosed in the literature “Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of aneffector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17 (1), 127-139.” and “Fang, Y., Cui, L., Gu, B., Arredondo, F., and Tyler, BM (2017). Efficient genome editing in the oomycete Phytophthora sojae using CRISPR / Cas9. Curr. Protoc. Microbiol. 44, 21A.1.1-21A.1.26.” The pBluescript II SK+ homology arm vector plasmid (Donor vector), sgRNA expression vector pYF2.3G-Ribo-sgRNA and Cas9 expression plasmid pYF2-Cas9 used in this example were all donated by Professor Brett M. Tyler of Oregon State University, USA.

[0093] Experiments have shown that the PsKMT3-1 protein provided by the present invention plays an important role in the growth and development of soybean phytophthora itself. PsKMT3-1 gene knockout homozygous transformants were obtained using CRISPR / Cas9 gene editing technology. Compared with the wild-type parent strain, there are obvious changes, mainly including: the mycelial growth rate of the PsKMT3-1 gene homozygous transformants is significantly slowed down, the number of sporangia is reduced, the release of zoospores stops, the oospore production decreases, and the ability to infect host plants is weakened. Therefore, the soybean phytophthora PsKMT3-1 protein can play an important role in multiple processes such as soybean phytophthora vegetative growth, asexual reproduction, sexual reproduction and infection of hosts.

[0094] Among them, the Donor vector pBS-PsKMT3-1-NPTII, the sgRNA expression plasmid pYF2.3G-PsKMT3-1 and the Cas9 expression plasmid pYF2-Cas9 knock out the full-length sequence of the PsKMT3-1 gene. The above knockout method is as follows.

[0095] The Donor vector pBS-PsKMT3-1-NPTII and the sgRNA expression plasmid pYF2.3G-PsKMT3-1 used in this embodiment are as follows:

[0096] 1) Construction of homology arm vector and complementation vector of pBS-PsKMT3-1-NPTII: Using the DNA of soybean Phytophthora strain P6497 as a template, primers were designed using the TaKaRa-In-Fusion_Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools) to amplify the upstream 1000 bp of the target gene PsKMT3-1 (shown in sequence 3 in the sequence table, and p was cloned as shown in Table 2). The NPTII gene (NPTII gene was amplified using the primers shown in pBS-PsKMT3-1-NPTII-F1 and pBS-PsKMT3-1-NPTII-R1) and the downstream 1000 bp sequence of the PsKMT3-1 gene (shown in sequence 4 in the sequence table, amplified using the primers shown in pBS-PsKMT3-1-NPTII-F3 and pBS-PsKMT3-1-NPTII-R3 as shown in Table 2) were obtained using the pYF2-Cas9 backbone plasmid as a template. The three amplified fragments of the above genes were fused and connected into the cloning vector pBluescript II SK+ (EcoR V digested) in sequence using the HD Cloning Kit. The ligation products were transferred into Escherichia coli DH5α competent cells and cultured overnight at 37°C. The universal primers M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') / M13R (sequence: 5'-CAGGAAACAGCTATGACC-3') were used for amplification and sequencing to verify the clones. The correctly verified recombinant expression vectors containing the upstream 1000 bp of the PsKMT3-1 gene, the NPTII gene and the downstream 1000 bp of the PsKMT3-1 gene connected in sequence were named pBS-PsKMT3-1-NPTII. The complementation vector used the cDNA of soybean Phytophthora strain P6497 as a template, and used the TaKaRa-In-Fusion_Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools) to design primers to amplify the CDS sequence of the target gene PsKMT3-1 (shown in sequence 1 in the sequence table, obtained by amplification with primers PTOR-PsKMT3-1-F and PTOR-PsKMT3-1-R shown in Table 2). The amplified fragments of the above genes were fused and connected into the cloning vector PTOR (PMEI digested) in sequence using HD Cloning Kit. The ligation products were transferred into Escherichia coli DH5α competent cells and cultured at 37°C overnight. The universal primers PTOR-F1 (sequence: 5'-CCAAGTCCCAACCGACTCTT-3') / PTOR-R1 (sequence: 5'-GTTCTACAAACGGCCTTCTT-3') were used for amplification and sequencing to verify the clones. The recombinant expression vector was named PTOR-PsKMT3-1.

[0097] Table 2. Primers for constructing the full-length knockout Donor vector of PsKMT3-1 gene

[0098]

[0099]

[0100] 2) Construction of pYF2.3G-PsKMT3-1: Using the sgRNA design website EuPaGDT (http: / / grna.ctegd.uga.edu / ) and the RNA structure online analysis tool (http: / / rna.urmc.rochester.edu / RNAstructureWeb / Servers / Predict1 / Predict1.html), sgRNA sequences that specifically target the PsKMT3-1 gene sequence and have a weak secondary structure (sgPsKMT3-1: CTTCGAGTCTCTGCTGTGAG (targeting the 3688-3707 positions of SEQ ID No.1 of the PsKMT3-1 gene) were selected and sent to the company to synthesize sgRNA sequence primers with NheI and BsaI restriction sites and HHribozyme (as shown in Table 3). Dissolved in sterile water to a 100 μM solution. Annealing reaction synthesized double-stranded sgRNA sequence, reaction system: 3 μL forward chain solution, 3 μL reverse chain solution, 3 μL 10×T4 DNA Ligase Buffer (NEB), 4μL 0.5M NaCl, 21μL ultrapure sterile water, pipette and mix, react at 100℃ for 2min, let it cool naturally at room temperature for 4h, then dilute the reaction solution 500 times. Then take 2μL 10×T4 DNA Ligase Buffer (NEB), 50ng pYF2.3G-Ribo-sgRNA vector (Nhe I / Bsa I double enzyme digestion), 4μL diluted double-stranded sgRNA solution, 1μL T4 DNA Ligase, make up to 20 μL with sterile ultrapure water, react at room temperature for 30 min, use 5 μL of the ligation product to transform Escherichia coli DH5α competent cells, culture at 37°C overnight, use primers RPL41_Pseq_F (sequence: 5'-CAAGCCTCACTTTCTGCTGACTG-3') / M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') for colony PCR verification, and sequence to verify the positive clones, and the recombinant vectors that were verified to be able to express the above sgRNA were named pYF2.3G-PsKMT3-1.

[0101] Table 3. sgRNA nucleotide sequences for synthetic knockout of PsKMT3-1 gene

[0102]

[0103] Example 3: Obtaining transformants of PsKMT3-1 gene knockout and complementation in Phytophthora sojae

[0104] The PsNCR1 gene knockout transformants were prepared by a CaCl2-PEG-mediated protoplast transformation method. The method of oomycete genetic transformation was disclosed in the document “Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17 (1), 127-139.”

[0105] The knockout transformants were obtained by co-transforming the knockout vectors of the full-length PsKMT3-1 gene in Example 2 (Donor vector pBS-PsKMT3-1-NPTII, sgRNA vector pYF2.3G-PsKMT3-1 and Cas9 expression plasmid pYF-Cas9) into the protoplasts of Phytophthora sojae P6497, and the grown transformants were cultured and screened on G418-resistant V8 solid culture medium plates at 25°C, and the mycelium of the suspected transformants was collected, and DNA was extracted for PCR sequencing verification, and RNA was extracted from the positive transformants for Q-PCR verification. PsKMT3-1 single knockout transformants (Δ-PsKMT3-1-1, Δ-PsKMT3-1-2, Δ-PsKMT3-1-3) were obtained, and the transformants that were transferred to the same vector plasmid and underwent the same transformation steps but without homologous replacement were used as control transformants, i.e., EV.

[0106] The PsKMT3-1 gene complementation transformant was obtained by transferring the complementation test vector PTOR-PsKMT3-1 obtained in Example 1 into the protoplasts of the soybean Phytophthora PsKMT3-1 knockout mutant strain Δ-PsKMT3-1-1, culturing and screening the grown transformants on a G418-resistant V8 solid culture medium plate at 25°C, collecting the mycelium of the suspected transformants, extracting DNA for PCR sequencing verification, and extracting RNA from the positive transformants for qPCR verification. The PsKMT3-1 complementation transformant (Δ-PsKMT3-1-1 / PsKMT3-1) was obtained.

[0107] Example 4. Analysis of biological characteristics of knockout transformants of PsKMT3-1 gene sequence of Phytophthora sojae 1. Detection of hyphae growth rate

[0108] The wild-type soybean Phytophthora strain P6497, the control transformant (EV), the full-length knockout transformants of the PsKMT3-1 gene obtained in Example 3 (Δ-PsKMT3-1-1, Δ-PsKMT3-1-2), and the PsKMT3-1 complemented transformant (Δ-PsKMT3-1-1 / PsKMT3-1) were inoculated in the center of a sterile culture dish (9 cm in diameter) containing 15 mL of V8 solid culture medium, and cultured at 25°C in the dark for 3 days. The colony diameter of each strain was measured by the cross method, and each strain was repeated 3 times.

[0109] The results showed that the mycelial growth rate of the full-length knockout transformants of PsKMT3-1 gene (Δ-PsKMT3-1-1, Δ-PsKMT3-1-2) was significantly decreased compared with the wild-type soybean Phytophthora strain P6497, the control transformant (EV) and the PsKMT3-1 complementation transformant (Δ-PsKMT3-1-1 / PsKMT3-1). Figure 2 ). The experimental results show that the PsKMT3-1 protein regulates the hyphal growth of soybean phytophthora.

[0110] 2. Detection of the number of sporangia and zoospores

[0111] Prepare 10% V8 solid medium, inoculate wild-type soybean Phytophthora strain P6497, control transformant (EV), PsKMT3-1 gene full-length knockout transformants (Δ-PsKMT3-1-1, Δ-PsKMT3-1-2) obtained in Example 3, and KMT3-1 complementation transformant (Δ-PsKMT3-1-1 / PsKMT3-1) on V8 solid medium (diameter 9 cm), culture in the dark at 25°C for 5-7 days, punch 10 bacterial cakes for each strain with a 5 mm puncher, put them into 20 ml After culturing in a sterile culture dish (9 cm in diameter) containing V8 juice liquid culture medium at 25°C in the dark for 3 days, the culture dishes were rinsed with 20 ml of sterile deionized water, rinsed once every 30 minutes for a total of 5 times, and then 10 ml of deionized water was added to the volume. After being placed in the dark at 25°C for 4-6 hours, the number and morphology of sporangia produced on the bacterial cake were observed under a microscope; after 8-10 hours, the number and morphology of zoospores produced in sterile water were observed under a microscope, and this process was repeated 3 times.

[0112] The results showed that compared with the wild-type soybean Phytophthora strain P6497 (WT), the control transformant (EV) and the PsKMT3-1 complemented transformant (Δ-PsKMT3-1-1 / PsKMT3-1), the number of sporangia of the full-length knockout transformants (Δ-PsKMT3-1-1, Δ-PsKMT3-1-2) obtained in Example 3 was significantly reduced, and the zoospore production was zero. This indicates that PsKMT3-1 affects the development of soybean Phytophthora sporangia and the release of zoospores ( Figure 2 ).

[0113] 4. Oospore quantity and morphology detection

[0114] The wild-type soybean Phytophthora strain P6497 (WT), the control transformant (EV), the full-length knockout transformants of the PsKMT3-1 gene obtained in Example 3 (Δ-PsKMT3-1-1, Δ-PsKMT3-1-2), and the PsKMT3-1 complemented transformant (Δ-PsKMT3-1-1 / PsKMT3-1) were inoculated in the center of a sterile culture dish (9 cm in diameter) containing 15 ml of V8 solid culture medium, cultured at 25°C in the dark for 7-14 days, and the number and morphology of oospores produced were observed under a microscope for 3 times.

[0115] The results showed that compared with the wild-type soybean Phytophthora strain P6497 (WT), the control transformant (EV) and the PsKMT3-1 complemented transformant (Δ-PsKMT3-1-1 / PsKMT3-1), the knockout transformants (Δ-PsKMT3-1-1, Δ-PsKMT3-1-2) obtained in Example 3 had a significantly decreased number of oospores ( Figure 2 ). This indicates that PsKMT3-1 protein is involved in regulating the development of soybean Phytophthora oospores.

[0116] 5. Statistics and observation of pathogenicity results

[0117] The soybean plant variety for the test was Japanese Green, which was planted in seedling trays (540 mm × 280 mm, 80 plants per hole). The culture medium was peat soil and vermiculite in a 2:1 ratio. An appropriate amount of deionized water was added and the plants were cultured in a greenhouse (27 ± 2 °C; 24 h dark treatment) for 7 days.

[0118] According to the above method, a 5 mm bacterial cake was made on the soybean Phytophthora V8 solid medium that had been cultured for 5-7 days. A bacterial cake was inoculated about 1 cm from the hypocotyl of soybean yellow flower seedlings. Each strain of bacteria was inoculated into 10-20 yellow flower seedlings. After culturing at 25°C in the dark and moisturizing for 3 days, the length of the lesions (mm) of the hypocotyls of soybean yellow flower seedlings infected by soybean Phytophthora was investigated.

[0119] The results showed that compared with the wild-type soybean Phytophthora strain P6497 (WT), the control transformant (EV) and the PsKMT3-1 complemented transformant (Δ-PsKMT3-1-1 / PsKMT3-1), the pathogenicity of the full-length knockout transformants (Δ-PsKMT3-1-1, Δ-PsKMT3-1-2) obtained in Example 3 was significantly reduced ( Figure 2 ). This indicates that PsKMT3-1 protein has the ability to participate in regulating the infection of soybean phytophthora to host plants.

[0120] VI. Protein structure of Phytophthora KMT3-1 and inhibitory effect of lead compound EZM0414 on Phytophthora

[0121] 1. Alpha fold2 was used to predict the structure of KMT3-1 proteins of various representative phytophthora fungi, including soybean phytophthora, pepper phytophthora, and infestation phytophthora ( Figure 1 ). Based on the crystal structures of the three Phytophthora PRMT5 proteins, virtual screening of small molecule active compounds was performed using the virtual screening software Schrodinger Maestro 12.8. The ligand small molecule compounds were derived from the PubChem small molecule library (https: / / pubchem.ncbi.nlm.nih.gov / ). In this study, three small molecule lead compounds were selected based on the binding ability of KMT3-1 protein with small molecule compounds and the structure of small molecule compounds.

[0122] Wild-type soybean Phytophthora strain P6497 and wild-type pepper Phytophthora strain LT1534 were inoculated in the center of 90 mm V8 solid plates containing different concentrations (1 μg / mL, 10 μg / mL) of the lead compound EZM0414, and wild-type infestation Phytophthora strain DH50 was inoculated in the center of 90 mm tomato rye solid plates containing different concentrations (1 μg / mL, 10 μg / mL) of the lead compound EZM0414. Wild-type pepper Phytophthora strain LT1534 and wild-type soybean Phytophthora strain P6497 were cultured at 25℃ in the dark for 5 days, and wild-type infestation Phytophthora strain DH50 was cultured at 18℃ in the dark for 7 days. The colony diameter of each strain was measured by the cross method, and three technical replicates were recorded for each treatment, and three biological replicates were performed. By measuring its inhibitory activity against the mycelial growth of the three Phytophthora fungi, a small molecule inhibitor lead compound EZM0414 was finally screened out.

[0123] Lead compound EZM0414 (C 22 H 29 FN4O2), the result is shown in formula I.

[0124]

[0125] The inhibitory effect of the lead compound EZM0414 on a variety of representative Phytophthora fungi at a concentration of 10 ppm was determined. Figure 3 ), compared with the control DMSO, the colony diameters of P6497LT1534 and DH50 under 10μg / mL EZM0414 treatment decreased significantly. By calculation, the mycelial growth inhibition rate of P6497 by 10μg / mL EZM0414 was 54.3%, the mycelial growth inhibition rate of LT1534 by 10μg / mL EZM0414 was 52.3%, and the mycelial growth inhibition rate of DH50 by 10μg / mL EZM0414 was 44.24%, indicating that some lead compounds targeting PRMT5 can have certain antibacterial activity against fungi such as pepper phytophthora, soybean phytophthora, and infestation phytophthora. The above test results prove that the KMT3-1 protein of the plant pathogenic oomycete of the genus Phytophthora has the potential to be developed as a new type of fungicide target.

[0126] VII. Molecular docking of Phytophthora sojae KMT3-1 (PsKMT3-1), Phytophthora capsici KMT3-1 (PcKMT3-1), and Phytophthora infestans KMT3-1 (PiKMT3-1) proteins with compound EZM0414

[0127] Auto Dock Vina software was used for molecular docking analysis. The ligands were derived from the PubChem small molecule library (https: / / pubchem.ncbi.nlm.nih.gov / ), and the receptors were protein structures predicted by AlphaFold 2. First, the ligand molecules obtained from PubChem were preprocessed, including removing water molecules, adding hydrogen atoms, and converting to PDBQT format; similarly, the receptor structure generated by AlphaFold 2 was preprocessed accordingly. The processed ligand and receptor molecules were imported into Auto Dock Vina, and a grid box was set to cover the active site of the receptor. Then, the simulation was run and the binding free energy (binding affinity) of each ligand binding to the receptor was recorded. Molecular docking results ( Figure 4 ) showed that the binding free energies of the lead compound EZM0414 to the KMT3-1 protein receptors of soybean phytophthora, pepper phytophthora, and infestation phytophthora were -4.2Kcal / mol, -8.2Kcal / mol, and -4.4Kcal / mol, respectively, indicating that it has a certain binding affinity with the KMT3-1 proteins of these three genus Phytophthora. In addition, the results of molecular docking are consistent with the results of biological activity experiments, indicating the effectiveness of molecular docking predictions. These results provide important structural information support for further optimization and improvement of the lead compound EZM0414, and also provide a theoretical basis for the design of more specific and efficient agricultural inhibitors.

Claims

1. A histone lysine methyltransferase KMT3-1 from Phytophthora spp., which is a protein as follows A1) or A2) or A3) or A4): A1) The amino acid sequence is the protein shown in SEQ ID NO: 2; A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 2; A3) a protein derived from the protein shown in SEQ ID NO: 2, which has the same function as the protein shown in SEQ ID NO: 2, obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2; A4) An amino acid sequence that has a similarity of more than 60%, preferably more than 75%, and more preferably more than 90% with the amino acid sequence shown in SEQ ID NO: 2 and has the same function as the amino acid sequence shown in SEQ ID NO:

2.

2. A gene encoding the histone lysine methyltransferase KMT3-1 of Phytophthora sojae shown in claim 1; preferably, the encoding gene is as follows B1) or B2) or B3): B1) a DNA molecule represented by the nucleotide sequence described in Sequence 1 in the sequence listing; B2) a cDNA molecule or a DNA molecule having 60% or more, 75% or more, or 90% or more identity with the nucleotide sequence shown in B1), and encoding the KMT3-1 protein of claim 1; B3) A cDNA molecule or a DNA molecule that hybridizes with the nucleotide sequence defined in B1) or B2) under stringent conditions and encodes the KMT3-1 protein of claim 1.

3. The RNA molecule obtained by transcription of the coding gene according to claim 2; preferably, the sequence of the RNA molecule is as follows C1) or C2): C1) an RNA sequence having a similarity of 60% or more, more preferably 75% or more, and more preferably 90% or more to an RNA sequence transcribed from the DNA sequence as shown in SEQ ID NO: 1 and having the same function as the RNA sequence transcribed from the DNA sequence as shown in SEQ ID NO: 1; C2) RNA sequence transcribed from the DNA sequence shown in SEQ ID NO:

1.

4. A biological material containing a nucleic acid molecule related to the coding gene as described in claim 2 or the RNA molecule as described in claim 3, which is any one of the following D1) to D10): D1) an expression cassette containing the coding gene according to claim 2; D2) a recombinant vector containing the coding gene according to claim 2, or a recombinant vector containing the expression cassette according to D1); D3) a recombinant microorganism containing the coding gene according to claim 2, or a recombinant microorganism containing the expression cassette according to D1), or a recombinant microorganism containing the recombinant vector according to D2); D4) a transgenic plant cell line containing the coding gene of claim 2, or a transgenic plant cell line containing the expression cassette of D1); D5) transgenic plant tissue containing the coding gene of claim 2, or transgenic plant tissue containing the expression cassette of D2); D6) A transgenic plant organ containing the coding gene according to claim 2, or a transgenic plant organ containing the expression cassette according to D2); D7) a nucleic acid molecule that inhibits the expression of the gene encoding the gene according to claim 2; D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in D7); D9) a nucleic acid molecule that inhibits the translation of the RNA molecule according to claim 3; D10) An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line producing the nucleic acid molecule described in D9).

5. Use of the PsKMT3-1 protein according to claim 1, the coding gene according to claim 2, the RNA molecule according to claim 3, or the biomaterial according to claim 4, characterized in that: The application is any one or more of the following 1)-7): 1) Application in reducing the production of zoospores of oomycetes; 2) Application in reducing the growth rate of oomycete hyphae; 3) Application in reducing the sporangium production of oomycetes; 4) Application in reducing the ability of oomycetes to infect hosts; 5) Application in reducing oomycete oospore production; 6) Application in reducing the pathogenicity of oomycetes to hosts; 7) Application in inhibiting and / or killing oomycete pathogens. Preferably, the oomycete is preferably Phytophthora, preferably Phytophthora sojae.

6. The use according to claim 5, wherein: The use described in 1)-7) is achieved by inhibiting the transcription of the coding gene as described in claim 2 or making it inactive, or inhibiting the translation of the RNA molecule as described in claim 3, or inhibiting the activity of the PsKMT3-1 protein as described in claim 1 or making it inactive.

7. Use of the PsKMT3-1 protein according to claim 1, the coding gene shown in claim 2, the RNA molecule according to claim 3, the biological material according to claim 4, or the protein combination or DNA combination according to claim 5 as an antibacterial or bactericidal agent target for screening oomycete antibacterial or bactericidal agents.

8. A method for screening or assisting in screening an antibacterial and / or bactericidal agent for oomycetes, the method comprising applying a substance to be detected to the oomycete. When the substance to be detected can inhibit the transcription of the encoding gene as described in claim 2, or inhibit the translation of the RNA molecule as described in claim 3, or inhibit the activity of the PsKMT3-1 protein as described in claim 1 or cause it to lose its activity, then the substance to be detected is an antibacterial and / or bactericidal agent for the oomycete.

9. A method for reducing the ability of oomycetes to infect a host, comprising the following steps: inhibiting the transcription of the coding gene as claimed in claim 2 or making it deleted, or inhibiting the translation in the RNA molecule as claimed in claim 3, or inhibiting the activity of the PsKMT3-1 protein as claimed in claim 1 or making it inactive; in, The reducing activity of the oomycete is to reduce the infection ability of the oomycete to the host and / or the pathogenicity to the host, and / or reduce the hyphae growth rate of the oomycete, and / or reduce the production of sporangia, and / or reduce the production of zoospores, and / or reduce the production of oospores; the host is pepper, tobacco, and leguminous or cucurbitaceous crops. Preferably, the activity of the protein shown in Sequence 2 in the sequence listing is lost by knocking out the gene shown in Sequence 1.

10. Use of a substance that inhibits the expression and / or activity of the PsKMT3-1 protein according to claim 1 in the preparation of a plant oomycete fungicide; preferably, the substance that inhibits the expression and / or activity of the PsKMT3-1 protein is a substance that inhibits the expression of the PsKMT3-1 protein and / or inhibits the transcription of the gene encoding the PsKMT3-1 protein and / or inhibits the translation of the RNA molecule obtained by transcription of the gene encoding the PsKMT3-1 protein; The substance that inhibits the expression and / or activity of the Phytophthora plant pathogenic oomycete histone lysine methyltransferase KMT3-1 protein is preferably a compound as shown in Formula I;

Images