SgRNA for detecting sheep Fecb gene and kit thereof

Abstract

The invention provides sgRNA (small guide ribonucleic acid) for specific detection of a sheep Fecb gene, the number of nucleotide sequences of the sgRNA is two, specifically, FecbWT-sgRNA: 5-GAAUUU CUACUGUGUGUAGAUUCAACACCUCAUAUAUUUU-3, 5- And FecbMT-sgRNA: 5-GAAUUUCUACUGUUGUAGAUUCAACACCGUCCGAUA UAUU-3, and FecbMT-sgRNA: 5- The invention also provides a kit, the kit comprises the sgRNA, nuclease, a buffer solution and an ssDNA probe, the kit can perform rapid and accurate detection by observing a fluorescence signal, and the detection efficiency and accuracy are greatly improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and particularly relates to an sgRNA for detecting a sheep Fecb gene and a kit thereof. Background Art

[0002] As a key livestock in agricultural production and human daily life, sheep are irreplaceable. Fertility and reproductive efficiency are key factors affecting the economy of sheep farming, so sheep multiparity is the most important economic trait in sheep farming. Relevant studies have shown that the role of the main effect gene of multiparity can significantly increase mutton production. However, since most sheep breeds produce single lambs and a few twin lambs, this greatly affects the number of lambs born per ewe, which is the most important reproductive indicator of sheep production. The Fecb gene is the core gene regulating sheep multiparity. The mutation site is located at the 746th position of the coding region, where the A→G change occurs, causing the 249th amino acid to change from glutamine to arginine. Its research is of immeasurable importance for promoting sheep reproductive efficiency and optimizing population structure. However, the number of individuals with the main effect gene of multiparity is scarce and scattered, and no systematic directional breeding has been carried out. With the rapid development of biotechnology, gene detection technology is increasingly favored by researchers. In particular, in recent years, CRISPR-Cas12a detection technology has gradually matured, and the demand for accurate detection of specific genes has become increasingly prominent. In the field of animal husbandry, through the study of animal genes, we can achieve precise regulation of animal traits and thus improve production efficiency. Therefore, developing a technical means to quickly and accurately detect the Fecb gene in sheep is of great strategic significance for promoting the sustainable development of animal husbandry.

[0003] At present, the detection technology of sheep Fecb gene mainly includes PCR-based detection method and fluorescence quantitative PCR-based detection method. Although these methods have achieved the detection of Fecb gene to a certain extent, they still have many shortcomings. For example, the PCR method requires cumbersome subsequent electrophoresis analysis steps, which is not only complicated to operate, but also time-consuming; and although the fluorescence quantitative PCR method improves the detection sensitivity, the operation process is also complicated and costly. In recent years, although some new detection methods have emerged, they still lack specificity or stability. Summary of the invention

[0004] In view of this, the present invention provides a sgRNA for specific detection of sheep Fecb gene and a kit thereof. The CRISPR-Cas system of the kit contains a carefully designed sgRNA, which enables it to specifically bind to the Fecb gene sequence, thereby guiding the Cas protein to accurately cut the target sequence, and the cut DNA fragments can be quickly and accurately detected by observing the fluorescent signal, which greatly improves the detection efficiency and accuracy.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] One of the purposes of the present invention is to provide a sgRNA for specific detection of sheep Fecb gene, wherein the sgRNA has two nucleotide sequences, as follows:

[0007] FecbWT-sgRNA: 5-GAAUUUCUACUGUUGUAGAUUCAACACC GUCUGAUAUAUU-3;

[0008] FecbMT-sgRNA: 5-GAAUUUCUACUGUUGUAGAUUCAACACC GUCCGAUAUAUU-3.

[0009] Application of the above sgRNA in detecting the sheep Fecb gene.

[0010] Application of the above sgRNA in the preparation and detection of sheep Fecb gene products.

[0011] The second object of the present invention is to provide a kit for detecting the sheep Fecb gene, the kit comprising the above-mentioned sgRNA, nuclease, buffer and ssDNA probe.

[0012] Furthermore, the nuclease is any one of LbCas12a and SrCas12a-18.

[0013] Furthermore, the ssDNA probe is labeled with ROX at the 5' end and BHQ2 at the 3' end.

[0014] In some specific embodiments, preferably, the ssDNA probe is specifically 5'ROX / GTATCCAGTGCG / 3'BHQ2.

[0015] Furthermore, in the buffer solution, the concentration of ammonium sulfate is 10 mM, the concentration of magnesium sulfate is 2 mM, the concentration of Tris-HCl is 20 mM, the concentration of taurine is 50 mM, the concentration of Tween-20 is 1%, and the pH value of the buffer solution is 8.8.

[0016] The third object of the present invention is to provide a detection method for the above-mentioned kit, comprising the following steps:

[0017] Use PCR to amplify the double-stranded DNA of the Fecb target gene and the in vitro transcription template of sgRNA, and transcribe the sgRNA in vitro; add the PCR amplified target product to the kit for reaction; inactivate after the reaction, and determine the genotyping by observing the fluorescence intensity under blue light.

[0018] In some specific embodiments, preferably, the primer pairs used in the PCR amplification are as follows:

[0019] F:ATTGGAAAAGGTCGCTATGG;

[0020] R:CCAAGATGTTTTCATGCCTC.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention provides a sgRNA and a kit for specifically detecting the Fecb gene of sheep. The kit has good specificity and accuracy and can be used to distinguish the homozygous wild type, homozygous mutant type and heterozygous type of Fecb. When using the sheep Fecb gene CRISPR detection kit of the present invention, it is only necessary to extract the genomic DNA of the sheep for ordinary PCR amplification, take a trace amount of amplification product and mix it with the sgRNA, nuclease, probe and buffer in the kit; by observing the change of the fluorescent signal, it can be judged whether the Fecb gene mutation exists in the sheep. Compared with the existing qPCR detection and Sanger sequencing methods, the cost is lower, the operation is simpler, and the detection results are easier to interpret. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a graph showing the activity results of the Fecb gene detected by specific sgRNA in Example 1 of the present invention; wherein, “+” represents the positive control and “-” represents the negative control.

[0024] Figure 2 This is a diagram showing the specific results of sgRNA distinguishing the Fecb gene in Example 2 of the present invention.

[0025] Figure 3 This is a diagram showing the detection effects of different types of Cas proteins on the Fecb gene in Example 3 of the present invention.

[0026] Figure 4 This is a graph showing the accuracy of CRISPR detection of Fecb gene mutations in 13 samples in Example 4 of the present invention.

[0027] Figures 5 to 17 The result of the Fecb gene mutation amplification curve of 13 samples detected by qPCR in Example 4 of the present invention is shown; wherein, Figures 5 to 17 They correspond to samples 1-177, 1-178, 1-349, 1-446, 4-175, 4-178, 5-845, 1-118, 5-833, 5-834, 5-835, 4-614, and 2-683 respectively. DETAILED DESCRIPTION

[0028] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0029] Example 1

[0030] Evaluate the activity of the specific sgRNA detecting the Fecb gene.

[0031] This example tests the activity of sgRNA detection of Fecb gene through in vitro cleavage experiment. Guide RNA that can pair with target nucleic acid is used to guide the endonuclease LbCas12a to recognize and bind to the target nucleic acid, and then stimulate its "trans-cleavage" activity on any single-stranded nucleic acid, thereby cutting the single-stranded DNA fluorescence-quenching reporter gene (ssDNA-FQ) in the reaction system; further, the trans-cleavage activity of the candidate sgRNA can be judged by the excited fluorescence intensity, background noise and naked eye color change.

[0032] In this example, the homozygous mutant and homozygous wild-type target double-stranded DNA (dsDNA) were selected as the Fecb gene, and three pairs of six sgRNAs were designed to target the dsDNA fragments containing the homozygous mutant and wild-type Fecb, respectively, and the sequences thereof were: ATTGGAAAAGGTCGCTATG GGGAAGTTTGGATGGGAAAGTGGCGTGGCGAAAAGGTAGCTGTGAAAGTGTTCTTCACTACAGAGGAGGCCAGCTGGTTCCGAGAGACAGAAATATATCAGACGGTGTTGATGAGGCATGAAAACATCTTGG.

[0033] The single-stranded DNA fluorescence-quenching reporter gene sequence is ROX-random-BHQ2 (5'ROX / GTATCCAGTGCG / 3'BHQ2).

[0034] The three pairs of sgRNA sequences are as follows:

[0035] WT-sgRNA1:GAAUUUCUACUGUUGUAGAU CGAGAGACAGAAAU AUAUCA ;

[0036] MT-sgRNA1:GAAUUUCUACUGUUGUAGAU CGAGAGACAGAAAU AUAUCG .

[0037] WT-sgRNA2:GAAUUUCUACUGUUGUAGAU CUGAUAUAUUUCUG UCUCUC ;

[0038] MT-sgRNA2:GAAUUUCUACUGUUGUAGAU CCGAUAUAUUUCUG UCUCUC .

[0039] WT-sgRNA3:GAAUUUCUACUGUUGUAGAU UCAACACCGUCUGA UAUAUU ;

[0040] MT-sgRNA3:sgGAAUUUCUACUGUUGUAGAU UCAACACCGUCCG AUAUAUU .

[0041] The underlined area is the targeted area.

[0042] The PCR amplification primers for the Fecb gene were designed as follows: F: ATTGGAAAAGGT CGCTATGG; R: CCAAGATGTTTTCATGCCTC.

[0043] The in vitro transcription template of the double-stranded DNA of the Fecb target gene and sgRNA was amplified by PCR, and the sgRNA was transcribed in vitro. Then the following reaction system was used: 1 μM LbCas12a protein (Shangrui Bio SRB-CAS-001), 300 ng sgRNA, 2 μL 10× buffer, 30 μM ssDNA fluorescence-quenching reporter gene and 2 μL corresponding PCR amplification target product. Among them, the negative control was DEPC water, WT-sgRNA detected the corresponding homozygous wild-type Fecb gene (AA), and MT-sgRNA detected the corresponding homozygous mutant Fecb (GG) gene. Reaction conditions: 37°C for 20 minutes, 98°C for 2 minutes for inactivation. The activity of specific sgRNA in detecting the Fecb gene was evaluated by observing the fluorescence intensity and background noise under blue light.

[0044] Result determination method: If the colorless liquid turns orange, the corresponding target DNA is present. Figure 1 ,From the fluorescence changes of the reaction solution after cutting, WT-sgRNA1, MT-sgRNA1, WT-sgRNA2, MT-sgRNA2, WT-sgRNA3, and MT-sgRNA3 all have trans-cutting activity and can be used for CRISPR nucleic acid detection of the Fecb gene.

[0045] Example 2

[0046] Evaluation of the specificity of sgRNA in distinguishing Fecb gene mutations.

[0047] In order to evaluate the specificity of sgRNA in distinguishing Fecb gene mutations, this example uses WT-sgRNA1, MT-sgRNA1, WT-sgRNA2, MT-sgRNA2, WT-sgRNA3, and MT-sgRNA3 to target Fecb homozygous wild type, homozygous mutant type, and heterozygous type, respectively. Then the following reaction system was used: 1 μM LbCas12a protein, 300 ng sgRNA, 2 μL 10× buffer, 30 μM ssDNA fluorescence-quenching reporter gene, and 2 μL of the corresponding PCR amplification target product. Among them, the negative control is DEPC water, and the heterozygous target is a 1:1 mixture of homozygous mutant type and homozygous wild type. Reaction conditions: 37°C for 20 minutes, 98°C for 2 minutes for inactivation. The specificity of sgRNA in detecting the Fecb gene was evaluated by observing the fluorescence intensity and background noise under blue light.

[0048] Test results such as Figure 2 ,From the fluorescence changes of the reaction solution after cutting, only WT-sgRNA3 and MT-sgRNA3 can be used to distinguish the homozygous wild type, homozygous mutant type and heterozygous type (AG) of Fecb, so WT-sgRNA3 has stronger specificity, and MT-sgRNA3 was selected for subsequent experiments.

[0049] Example 3

[0050] Evaluate the detection effect of different types of Cas proteins on the Fecb gene.

[0051] In order to test the cleavage effect of different types of nucleases on the Fecb gene, this example tested the effects of srCas12a-18 (Shangrui Bio SRB-CAS-001) and LbCas12a proteins using sgRNA3 to distinguish Fecb homozygous wild type, homozygous mutant type and heterozygous type. The following reaction system was used: 1 μM LbCas12a or SrCas12a-18 protein, 300 ng sgRNA, 2 μL 10× buffer, 30 μM ssDNA fluorescence-quenching reporter gene and 2 μL of the corresponding PCR amplification target product. Reaction conditions: 37 ° C reaction for 20 min, 98 ° C reaction for 2 min inactivation. The cleavage effect of different types of nucleases on the Fecb gene was evaluated by observing the fluorescence intensity and background noise under blue light.

[0052] Test results such as Figure 3 As shown, both srCas12a-18 and LbCas12a proteins can distinguish Fecb homozygous wild type, homozygous mutant type and heterozygous type using sgRNA3, and can be used in the sheep Fecb gene CRISPR detection kit.

[0053] Example 4

[0054] To evaluate the accuracy of CRISPR in detecting Fecb gene mutations.

[0055] In order to evaluate the accuracy of CRISPR detection of Fecb gene mutations, blood samples of 13 sheep (sample numbers are: 1-177, 1-178, 1-349, 1-446, 4-175, 4-178, 5-845, 1-118, 5-833, 5-834, 5-835, 4-614, and 2-683) were randomly selected, and their genomes were extracted using blood nucleic acid lysate, and sgRNA3 was used to distinguish the homozygous wild type, homozygous mutant type, and heterozygous type of the Fecb gene.

[0056] Specific steps: First, use 100μL of blood direct amplification lysis solution (Shangrui Bio SRB-RRE-001) to mix with 10μL of blood sample, vortex to mix, incubate at 65℃ for 2-5min, 98℃ for 2min, and centrifuge at 7000-10000rpm for 3-5min. Then take the supernatant of the nucleic acid lysate as a template for PCR amplification. Then use the amplification reaction solution as a template and use the CRISPR detection system to distinguish its genotype. The reaction system is: 1μM LbCas12a protein, 300ng sgRNA, 2μL10×Buffer, 30μM ssDNA fluorescence-quenching reporter gene and 2μL of the corresponding PCR amplification target product. Reaction conditions: 37℃ for 20min, 98℃ for 2min inactivation. The test results were analyzed by observing the fluorescence intensity and background noise under blue light. For specific results, see Figure 4 .

[0057] In order to verify the reliability of CRISPR detection data, the genotypes of these samples were detected using a qPCR detection kit (Shangrui Biotech SRB-K-005). Take 2 μl of the nucleic acid lysate supernatant, add 18 μl Fecb Buffer A (Wuhan Shangrui Biotech SRB-K-005) and 18 μl Fecb Buffer B (Wuhan Shangrui Biotech SRB-K-005), and react according to the reaction procedure in Table 1.

[0058] Table 1 qPCR reaction procedure

[0059]

[0060] Judgment criteria: When Ct-A-Ct-B≤-5, the genotype is determined to be wild type (AA type); when -1.5≤Ct-A-Ct-B≤1.5, the genotype is determined to be heterozygous (AG type); when Ct-A-Ct-B≥5, the genotype is determined to be homozygous (GG type). If the Ct-A and Ct-B values ​​of the sample to be tested are both greater than 28, or one of them does not appear, it will be impossible to make an accurate genotype judgment, and the sample needs to be reprocessed for repeated genotyping testing.

[0061] Table 2 qPCR test results

[0062]

[0063]

[0064] The results of the two detection methods, qPCR and CRISPR, were analyzed and compared. Figure 5-17 (In the amplification curve, liquid A is blue and liquid B is green) As shown in Table 2, the detection results of the sheep Fecb gene CRISPR detection kit established in this case are exactly the same as the qPCR detection results. Therefore, the kit provided by the present invention can accurately and quickly detect the mutation of the sheep Fecb gene, can screen out individuals with excellent traits, provide a scientific basis for sheep breeding, and is of great significance to sheep breeding and genetic improvement.

[0065] The specific raw materials not described in the present invention are all existing materials and can be directly purchased from the market.

[0066] The above are only preferred embodiments of the present invention and are not intended to limit the protection scope of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A sgRNA for specific detection of sheep Fecb gene, characterized in that: The sgRNA has two nucleotide sequences, as follows: FecbWT-sgRNA: 5-GAAUUUCUACUGUUGUAGAUUCAACACC GUCUGAUAUAUU-3; FecbMT-sgRNA: 5-GAAUUUCUACUGUUGUAGAUUCAACACC GUCCGAUAUAUU-3.

2. Use of the sgRNA according to claim 1 in detecting the sheep Fecb gene.

3. Use of the sgRNA according to claim 1 in the preparation and detection of sheep Fecb gene products.

4. A kit for detecting sheep Fecb gene, characterized in that: The kit comprises the sgRNA, nuclease, buffer and ssDNA probe according to claim 1.

5. The kit according to claim 4, characterized in that The nuclease is any one of LbCas12a and SrCas12a-18.

6. The kit according to claim 4, characterized in that The ssDNA probe is labeled with ROX at the 5' end and BHQ2 at the 3' end.

7. The kit according to claim 6, characterized in that The ssDNA probe is specifically 5'ROX / GTATCCAGTGCG / 3'BHQ2.

8. The kit according to claim 4, characterized in that The concentration of ammonium sulfate in the buffer is 10 mM, the concentration of magnesium sulfate is 2 mM, the concentration of Tris-HCl is 20 mM, the concentration of taurine is 50 mM, the concentration of Tween-20 is 1%, and the pH of the buffer is 8.

8.

9. A detection method based on the kit according to any one of claims 4 to 8, characterized in that: The following steps are involved: Use PCR to amplify the double-stranded DNA of the Fecb target gene and the in vitro transcription template of sgRNA, and transcribe the sgRNA in vitro; The PCR amplified target product is added to the kit for reaction; after the reaction is completed, it is inactivated and the genotype is determined by observing the fluorescence intensity under blue light.

10. The detection method according to claim 9, characterized in that: The primer pairs used in the PCR amplification are as follows: F:ATTGGAAAAGGTCGCTATGG; R:CCAAGATGTTTTCATGCCTC.

Images