circSamd4 and its use in preparing a drug for treating myocardial fibrosis

By screening circSamd4 as a key target, using small interfering RNA and adeno-associated viral vectors to reduce circSamd4 expression, solving the treatment problem of myocardial fibrosis, significantly reducing myocardial fibrosis and improving cardiac function, providing new therapeutic ideas.

CN119162184BActive Publication Date: 2025-08-29WEST CHINA HOSPITAL SICHUAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411591347.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-08
Publication Date
2025-08-29
Estimated Expiration
2044-11-08

AI Technical Summary

Technical Problem

The existing technology lacks specific interventions to inhibit myocardial fibrosis, and the clinical understanding of myocardial fibrosis is limited, and there is a lack of key targets, which leads to poor treatment effects of cardiovascular diseases.

Method used

circSamd4 was screened as a key target, and the expression of circSamd4 was knocked down in cardiac fibroblasts by designing small interfering RNA (si-circSamd4), and the Periostin promoter was delivered using adeno-associated viral vectors to target myocardial fibroblasts, reducing the expression of circSamd4, and a drug for treating myocardial fibrosis was prepared.

Benefits of technology

Significantly reducing myocardial fibrosis, improving cardiac contraction function, and inhibiting myocardial fibroblast activation, providing new drug strategies for treating myocardial fibrosis, especially for stress overload-induced myocardial fibrosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119162184B_ABST
    Figure CN119162184B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of biomedicine technology, and specifically relates to a circSamd4 and its use in the preparation of a drug for treating myocardial fibrosis. In order to screen and obtain circRNA that plays a key role in the process of myocardial fibrosis, so as to provide a drug for preparing myocardial fibrosis, the present invention provides a circSamd4, a vector for reducing the expression of circSamd4, a host cell containing the vector and its use in the preparation of a drug for treating myocardial fibrosis. The present invention discovered for the first time a circSamd4 that plays a key role in the process of myocardial fibrosis, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2, and verified that knocking down circSamd4 expression can improve the impaired cardiac contractile function caused by thoracic aortic arch stenosis for 4 weeks, reduce myocardial fibrosis, and inhibit the activation of myocardial fibroblasts. It can be used to prepare a drug for treating myocardial fibrosis, and has important practical significance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to circSamd4 and its use in preparing a drug for treating myocardial fibrosis. Background Art

[0002] Myocardial fibrosis refers to a pathological process characterized by excessive fibroblast proliferation and extracellular matrix deposition in the myocardial tissue structure, caused by harmful stimuli such as systemic diseases, cardiac ischemia, and drugs. It is an associated condition in a variety of cardiovascular diseases, including myocardial hypertrophy, myocardial infarction, chronic heart failure, and diabetic cardiomyopathy. Myocardial fibrosis is an inevitable common pathological feature in the end-stage stages of various cardiovascular diseases, a key manifestation of adverse cardiac remodeling, and a major cause of heart failure and sudden death. Fibrosis is initially an adaptive response, with extracellular matrix (ECM) deposition crucial for maintaining myocardial integrity, wound healing, and cardiac physiological function. When injury is mild, fibrosis only leads to a transient accumulation of ECM components, which rapidly ceases after promoting the restoration of normal myocardial tissue structure. However, as myocardial injury worsens, ECM deposition persists, potentially leading to increased scar tissue, pathological cardiac remodeling, impaired systolic and diastolic function, and ultimately heart failure. Inhibiting or reversing myocardial fibrosis has become a goal in clinical treatment of heart disease. However, specific interventions for myocardial fibrosis are still lacking in clinical practice. Current clinical treatment results have shown that RAAS inhibitors, such as angiotensin-converting enzyme inhibitors, angiotensin receptor antagonists, and the aldosterone receptor antagonists spironolactone and eplerenone, can alleviate myocardial fibrosis, but these are still under clinical investigation. This lack of specific interventions is primarily due to the limited understanding of myocardial fibrosis. Therefore, identifying key targets for regulating myocardial fibrosis and clarifying their role in myocardial fibrosis is crucial for the early intervention of heart failure.

[0003] Circular RNA (circRNA) is a special type of non-coding RNA. Thanks to the development of high-throughput sequencing technologies and circRNA bioinformatics algorithms, abundant circRNAs have been discovered in eukaryotic organisms, and their functions have gradually been elucidated. The covalently closed circular structure of circRNAs makes them more stable than linear RNAs, less susceptible to exoribonucleases and degradation. Furthermore, circRNAs are tissue- and disease-specific and can be packaged into extracellular vesicles for intercellular transport. In particular, the advancement of circRNA preparation technologies and the promising application of RNA-mediated gene therapy have made circRNAs a research focus of considerable interest in disease treatment strategies. Studies have found that circRNAs play an important regulatory role in the development and progression of cardiovascular diseases by regulating key biological processes in the cardiovascular system, such as cell proliferation, apoptosis, mitochondrial damage, and oxidative stress. Previous studies have found that the loss of circNfix can promote cardiomyocyte proliferation and angiogenesis after myocardial infarction (MI), inhibit cardiomyocyte apoptosis after MI, alleviate cardiac dysfunction, and improve prognosis; circ-SIRT1 promotes autophagy and inhibits myocardial hypertrophy by upregulating the expression of its host gene SIRT1; and circFndc3b can inhibit stress-induced endothelial cell apoptosis, increase angiogenesis after MI, and alleviate left ventricular dysfunction after MI. Therefore, circRNAs are ideal targets for the diagnosis and treatment of cardiovascular diseases. However, our understanding of circRNAs in cardiac fibrosis is limited, and the functions of circRNAs in fibroblast activation and cardiac fibrosis remain to be determined. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to screen circRNAs that play a key role in the process of myocardial fibrosis and provide drugs for preparing myocardial fibrosis.

[0005] The technical solution of the present invention to solve the above technical problems is: providing a myocardial fibrosis-related circSamd4, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0006] SEQ ID NO:1 Nucleotide sequence of mouse circSamd4

[0007] GAATCATTAACCAATGGCAACAGGAATCCAAGGATAAAGTGATTTCCCTTCTGCTAACTC

[0008] ACCTGCCTTTGCTGAAGCCAGGAAACCTCGACGCGAAAGCAGAGTATATGAAACTGCT

[0009] GCCCAAGATCCTGGCACACTCTATCGAACACAACCAGCACATTGAGGAGAGCAGGCAG

[0010] CTGCTGTCCTATGCTTTGATCCACCCAGCCACTTCCTTGGAAGACCGCAGCGCACTAGCC

[0011] ATGTGGCTGAATCACTTGGAGGACCGCACATCCACCAGCTTTGGTAGCCAGAACCGAGG

[0012] CCGCTCGGACTCTGTGGATTATGGACAGACGCATTACTATCACCAAAGACAGAACTCTG

[0013] ACGATAAGCTCAATGGCTGGCAGAACTCTCGGGATTCTGGGATTTGCATCAGTGCCTCC

[0014] AACTGGCAGGACAAGAGCCTGGGCTGTGAGAATGGCCATGTGCCCCTCTACTCTTCCTCGTCTGTCCCTGCCACAATCAACACGATTGGAACCGGCGCAAGCACGA。

[0015] SEQ ID NO:2 Nucleotide sequence of human circSAMD4A

[0016] GAATCATTAACCAATGGCAACAGGAATCCAAGGATAAAGTGATTTCCCTCCTGTTAACTC

[0017] ATCTGCCTTTGCTGAAGCCAGGAAACCTCGACGCGAAAGTAGAATATATGAAACTGCTG

[0018] CCCAAAATCCTGGCTCACTCTATTGAACACAACCAGCACATTGAGGAGAGCAGGCAGCT

[0019] GCTGTCCTATGCTTTGATACATCCAGCCACTTCGTTAGAAGACCGTAGTGCTTTAGCCAT

[0020] GTGGCTGAATCACTTGGAGGACCGCACGTCGACCAGCTTTGGTGGCCAGAACCGAGGC

[0021] CGCTCAGACTCTGTGGATTATGGACAGACACACTACTATCACCAAAGACAGAACTCTGA

[0022] TGACAAGCTCAATGGGTGGCAGAACTCTCGGGATTCTGGGATTTGCATCAATGCCTCCA

[0023] ACTGGCAGGACAAAAGCATGGGGTGTGAGAATGGCCATGTGCCCCTCTACTCCTCCTCATCTGTCCCCACCACAATCAATACGATTGGAACCAGCACAAGTACAA.

[0024] The present invention also provides a use of the above-mentioned circSamd4 in preparing a drug for treating myocardial fibrosis.

[0025] Furthermore, the present invention also provides a vector for reducing the expression of the above-mentioned circSamd4.

[0026] Preferably, among the above-mentioned vectors, the vector is a viral vector. More preferably, the viral vector is an adeno-associated viral vector. Further preferably, the vector is GV733.

[0027] Furthermore, the above vector also includes a Periostin promoter.

[0028] Preferably, the sequence of constructing the above vector is: Periostin-EGFP-MIR155(MCS)-SV40 PolyA.

[0029] Among them, the nucleotide sequence of the target gene of the above-mentioned vector is SEQ ID NO: 16, and the two oligonucleotide sequences designed for knocking down circSamd4 are SEQ ID NO: 17 and SEQ ID NO: 18, respectively.

[0030] The present invention also provides a host cell comprising the above vector.

[0031] Furthermore, the present invention also provides a use of the above-mentioned vector and host cell for reducing circSamd4 expression in the preparation of a drug for treating myocardial fibrosis.

[0032] Wherein, in the above use, the myocardial fibrosis is myocardial fibrosis induced by pressure overload.

[0033] Wherein, in the above use, the myocardial fibrosis includes impaired cardiac contractile function or inhibition of myocardial fibroblast activation.

[0034] The beneficial effects of the present invention are:

[0035] The present invention provides a use of circSamd4 in the preparation of a drug for treating myocardial fibrosis, and further provides a drug for treating myocardial fibrosis. Through experimental studies, the present invention found that knocking down circSamd4 can reduce myocardial fibrosis, especially has a good effect on myocardial fibrosis induced by pressure overload, can improve the impaired cardiac contractile function caused by thoracic aortic arch stenosis for 4 weeks, and reduce the effect of myocardial fibrosis. Knocking down circSamd4 on cells can also inhibit the activation of myocardial fibroblasts. Based on this, the present invention also provides a method for preparing a drug for treating myocardial fibrosis, providing a new approach for the treatment of heart failure-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Figure 3 shows the screening process for circSamd4. A shows the schematic diagram of differentially expressed circRNAs detected between normal and mouse fibrotic hearts using a circRNA microarray, along with the top 10 circRNAs significantly upregulated in TAC mouse hearts after screening. B shows the distribution of the top three upregulated circRNAs in cardiomyocytes and cardiac fibroblasts. C shows the expression of circSamd4 in cardiac fibroblasts from sham and TAC mice. n = 4-6, **, p < 0.01; ***p < 0.001. Sham: sham surgery; TAC: thoracic aortic arch constriction.

[0037] Figure 2Figure 3: Knockdown of circSamd4 reduces TGF-β1-induced cardiac fibroblast activation. A shows the knockdown efficiency of circSamd4 and the expression of its source gene, Samd4, detected by real-time quantitative PCR (RT-qPCR) after transfection of si-circSamd4 in cardiac fibroblasts. B shows the expression of fibroblast activation marker genes, Ccn2 and Postn, detected by RT-qPCR after knockdown of circSamd4 in cardiac fibroblasts. C shows representative immunofluorescence images and statistical results of α-SMA expression in cardiac fibroblasts after knockdown of circSamd4. n = 3, ns, not significant, *, p < 0.05, ***, p < 0.001.

[0038] Figure 3 This is a map of the adeno-associated virus vector used in the present invention.

[0039] Figure 4 Knockdown of circSamd4 alleviates myocardial fibrosis and improves cardiac function caused by thoracic aortic arch constriction for 4 weeks.

[0040] Among them, A is the knockdown efficiency of AAV9-sh-circSamd4 in mice and the mRNA expression results of the circSamd4 source gene; B is the representative echocardiogram of each treatment group; C is the ejection fraction (EF) and fraction shortening (FS) results of each treatment group; D is the result of RT-qPCR detection of the expression of cardiac fibrosis marker genes Ccn2 and Postn in each treatment group; E is the representative Masson staining image and fibrosis area statistics of each treatment group, the blue area is the area of ​​obvious collagen deposition, n=5-10, *, p<0.05, ***, p<0.001. DETAILED DESCRIPTION

[0041] The present invention screened and identified the key target circSamd4 related to myocardial fibrosis for the first time by analyzing the circRNA expression profile of myocardial tissue in mice with myocardial fibrosis. The nucleotide sequence is shown in SEQ ID NO: 1.

[0042] Subsequently, the researchers conducted cell-based experiments, synthesizing small interfering RNA (siRNA) and transfecting si-circSamd4 into cardiac fibroblasts to detect cardiac fibroblast activation. The results showed that knocking down circSamd4 reduced fibroblast activation in mice, suggesting that circSamd4 may be associated with myocardial fibrosis and could be a target for the development of drugs to treat myocardial fibrosis.

[0043] After that, the present invention conducted animal experiments, constructed an adeno-associated virus (AAV) carrying the Periostin promoter (targeting activated cardiac fibroblasts) to knock down circSamd4, and injected the virus one week after thoracic aortic arch constriction surgery. Four weeks after thoracic aortic arch constriction surgery, echocardiography, pathological staining, etc. were used to evaluate the effect of knocking down circSamd4 on myocardial fibrosis and cardiac function in mice. The applicant found that compared with mice in which circSamd4 was not knocked down, knocking down circSamd4 using adeno-associated virus significantly reduced myocardial fibrosis caused by pressure overload and improved cardiac contractile function. The above studies further confirmed that circSamd4 can be used as a target for the preparation of myocardial fibrosis drugs.

[0044] Based on this, the present application provides the use of the above-mentioned circSamd4, a vector for reducing circSamd4 expression, and a host cell containing the above-mentioned vector in the preparation of a drug for treating myocardial fibrosis.

[0045] The circBase ID of circSamd4 is mm9_circ_005305, and its nucleotide sequence is shown in SEQ ID NO: 1. The nucleotide sequence of human circSAMDd4A is shown in SEQ ID NO: 2.

[0046] According to BLAST comparison, the mouse and human circSamd4 sequences are 93% highly conserved. This study experimentally demonstrates that a drug developed from circSamd4 for treating myocardial fibrosis can alleviate myocardial fibrosis, primarily pressure-overload-induced myocardial fibrosis. Specifically, knocking down circSamd4 improves impaired cardiac contractile function caused by thoracic aortic arch constriction for four weeks, alleviating myocardial fibrosis. Furthermore, knocking down circSamd4 in cells inhibits the activation of cardiac fibroblasts.

[0047] The specific embodiments of the present invention will be further explained below through examples, but it is not intended to limit the scope of protection of the present invention to the scope described in the examples.

[0048] Example 1 Screening of key circRNAs in myocardial fibrosis

[0049] (1) A pressure overload-induced myocardial fibrosis mouse model was established using thoracic aorta constriction (TAC). The specific steps are as follows:

[0050] SPF-grade healthy C57BL / 6 mice (male, 6-8 weeks, 20-22 g) were enrolled and randomly divided into a sham operation (Sham) group and a TAC group. Before surgery, the mice were anesthetized with isoflurane inhalation. The anesthetized mice were fixed in a supine position on a heating pad. The chest hair of the mice was removed with depilatory cream to fully expose the thorax, and then disinfected with iodine tincture. The mice were intubated. After successful intubation, the anesthesia machine was connected to a small animal ventilator to keep the mice breathing. The chest skin was cut open, the sternum was cut open horizontally, the muscles were bluntly separated, and the chest cavity was opened with a chest expander. The thymus was then separated with forceps to expose the aortic arch and the first, second, and third branches. A 5-0 silk thread was passed through the blood vessels between the first and second branches, and a 27G needle was used to ligate the aortic arch with silk thread, and then the needle was removed. After the thorax of the Sham group mice was opened, only the blood vessels were exposed and the thread was threaded but not ligated. The chest cavity was closed and the muscle layer and skin were sutured, and the surgical wound was disinfected with iodine tincture. The vital signs of the mice were closely observed after surgery and they were kept in a conventional manner until the end of the experiment.

[0051] (2) Obtain fibrotic mouse hearts for Arraystar Mouse circRNA Array analysis to obtain the circRNA expression profile of mouse fibrotic hearts. The specific steps are as follows:

[0052] After 4 weeks of TAC, representative hearts from the sham group and the TAC group were taken for RNA extraction. The concentration and purity of the total RNA of the samples were determined using NanoDrop, and the integrity of the RNA was assessed by denaturing agarose gel electrophoresis. The total RNA of each sample was then treated with RNase R to enrich circular RNA. The enriched circular RNA was then amplified using random primers according to the Arraystar Super RNA Labeling protocol (Arraystar, Inc.). RNA was purified using the RNeasy MiniKit kit. This was followed by hybridization reaction, chip washing, machine scanning, data extraction, and analysis. The circRNA microarray analysis process involved in the present invention is to extract cardiac tissue RNA and then entrust Shanghai Shupu Biotechnology Co., Ltd. to perform subsequent analysis. The analysis results are shown in the figure. Figure 1 As shown in A, the results showed that after 4 weeks of TAC, circSlc8a1, circMyom2 and circSamd4 were the three most significantly upregulated circRNAs.

[0053] (3) Cellular distribution of circSamd4: The two main cell types in myocardial tissue (primary cardiomyocytes and cardiac fibroblasts) were isolated, and then its expression in the two cells was detected using RT-qPCR.

[0054] Isolation and culture of cardiac fibroblasts: The present invention uses C57BL / 6 suckling mice (0-1d) to isolate cardiac fibroblasts, and uses the differential adhesion method to separate them. Use 75% alcohol to quickly soak the suckling mouse, hold the skin on the back of the suckling mouse's neck with your left hand to fully expose the chest, use straight scissors in your right hand to cut the sternum horizontally, remove the heart, put it in a culture dish with PBS, and place it on ice. Gently squeeze out the remaining blood in the heart, wash it twice with PBS, add 0.25% trypsin, and cut the heart into 1mm pieces. 3 Place the tissue fragments in a 50mL centrifuge tube, add 0.25% trypsin, and digest at 30 rpm / min on a shaker for 3 hours at 4°C. After 3 hours, remove the centrifuge tube, terminate the digestion with complete culture medium containing 10% fetal bovine serum, and transfer the remaining tissue fragments to a fresh 50mL centrifuge tube. Add type II collagenase digestion solution (1.5 mg / mL) prepared in L15 culture medium, and incubate at 37°C with rotation for 30 minutes. Mix thoroughly with a Pasteur pipette, let stand, and collect the supernatant containing the cell digestion solution to terminate the digestion. Continue digesting the remaining precipitated tissue fragments with type II collagenase digestion solution for 30 minutes until no tissue fragments are visible. Filter the entire cell suspension through a 70μm filter and centrifuge at 400g for 5 minutes. Discard the supernatant and collect the cells. Resuspend the cells in complete culture medium and seed them into a T25 cell culture flask in a 37°C, 5% CO2 incubator. After 30-45 minutes, most of the adherent cells are cardiac fibroblasts, and those that are temporarily not adherent are cardiomyocytes. At this time, the two types of cells are cultured using the differential adhesion method.

[0055] (4) RNA was extracted according to the kit instructions (Accurate Biotechnology, AG21024) and reverse transcription and RT-qPCR were performed to detect the expression of relevant genes. The specific steps are as follows:

[0056] The reverse transcription reaction system is as follows: 5×Reverse Transcripition buffer (4 μL), Primer Mix (1 μL), RT Enzyme Mix (1 μL), RNA and RNAase-free Water (14 μL). The sequence of the upstream primer for PCR of circSamd4 is as follows: CTGGGATTTGCATCAGTGCC (SEQ ID NO: 3), and the downstream primer sequence is as follows: TACTCTGCTTTCGCGTCGAG (SEQ ID NO: 4); the sequence of the upstream primer of circSlc8a1 is as follows: TCTGGAGCTCGAGGAAATGT (SEQ ID NO: 5), and the downstream primer is as follows: TTGGGTGGGAGACTTAATCG (SEQ ID NO: 6); the sequence of the upstream primer of circMyom2 is as follows: GACCCTGTTGACCTCAGAAGA (SEQ ID NO: 7): and the downstream primer is as follows: CGACCAGGGACATCTTGAGT (SEQ ID NO: 8). The PCR amplification reaction system consisted of the following components: SYBR Green Real-time PCR Master Mix (10 μL), upstream primer (10 μM, 1 μL); downstream primer (10 μM, 1 μL), cDNA and RNAase-free water (8 μL); the PCR reaction procedure was: pre-denaturation (95°C, 2 min); amplification reaction (95°C, 10 s; 59°C, 10 s; 72°C, 15 s), 40 cycles; melting curve analysis (65-95°C). The results showed that circSamd4 was mainly located in cardiac fibroblasts, while the other two circRNAs were mainly located in cardiomyocytes ( Figure 1 B), fibroblast activation is a major event in myocardial fibrosis, so we focused on circSamd4.

[0057] Function in fibroblast activation and myocardial fibrosis. We also further isolated cardiac fibroblasts from mice after TAC and further confirmed that circSamd4 was significantly upregulated in cardiac fibroblasts after 4 weeks of TAC compared with the Sham group ( Figure 1 C).

[0058] Example 2 In vitro experiments to verify the function of circSamd4

[0059] The present invention designed and synthesized small interfering RNA (siRNA) and transfected si-circSamd4 into cardiac fibroblasts to study the effect of circSamd4 on fibroblast activation. The sequence of si-circSamd4 is as follows: GCACGAGAATCATTAACCA (SEQ ID NO: 9).

[0060] (1) siRNA transfection of cardiac fibroblasts: When the cell density needs to reach about 60%, use the transfection reagent RNAiMAX to transfect si-NC and si-circSamd4 into cardiac fibroblasts. The siRNA transfection concentration used is 50nM. Before transfecting siRNA and performing functional experiments on cells, RT-qPCR is used to detect the knockdown efficiency of si-circSamd4. The specific groups are ① negative control (si-NC) group: transfection with negative control siRNA; ② specific knockdown circSamd4 (si-circSamd4) group: transfection with si-circSamd4 target sequence. Lipofectamine transfection method is used for transfection, using RNAiMAX is used as a transfection reagent for transfection. Before transfection, replace the culture medium in the cell culture plate with fresh culture medium. The volume is the regular volume minus the volume of transfection medium. The specific steps for adding transfection medium are as follows: Dilute RNAiMAX and siRNA in culture medium. Mix the RNAiMAX dilution with the siRNA / miRNA mimics at a 1:1 ratio and incubate at room temperature for 5 minutes. Add the mixture dropwise to the cell culture medium and gently shake to mix. Continue culturing the cells for 24 hours before testing knockdown efficiency or proceeding to the next treatment.

[0061] The results showed that the siRNA sequence of SEQ ID NO: 9 was highly efficient in knocking down circSamd4 without changing the expression of its source gene ( Figure 2 A).

[0062] After confirming the knockdown efficiency of the target sequence, the cell function experiment of si-circSamd4 was carried out and the groups were divided into: ① negative control (si-NC) group: transfection with negative control siRNA; ② si-NC+TGF-β1 stimulation (si-NC+T) group: transfection with negative control siRNA for 24 hours and then stimulation with TGF-β1 for 24 hours; ③ specific knockdown of circSamd4 (si-circSamd4) group: transfection with si-circSamd4 target sequence to illustrate whether the transfected target sequence affects the physiological condition of the cells; ④ si-circSamd4+TGF-β1 stimulation (si-circSamd4+T) group: transfection with si-circSamd4 target sequence for 24 hours and then stimulation with TGF-β1 for 24 hours to illustrate the effect of the target gene on the pathological process of the cells.

[0063] (2) Detection of fibroblast activation marker expression. After the cells were transfected with siRNA and stimulated with TGF-β1, the cells were collected to extract total RNA, and reverse transcription reaction and RT-qPCR were performed to detect the gene expression of fibroblast activation markers. The primers for fibroblast activation marker genes used in the present invention are as follows: Ccn2 upstream primer sequence: GGACACCTAAAATCGCCAAGC (SEQ ID NO: 10), Ccn2 downstream primer sequence: ACTTAGCCCTGTATGTCTTCACA (SEQ ID NO: 11), Postn upstream primer sequence: TGGTATCAAGGTGCTATCTGCG (SEQ ID NO: 12), Postn downstream primer sequence: AATGCCCCAGCGTGCCATAA (SEQ ID NO: 13); internal reference gene Gapdh upstream primer sequence: CCTCGTCCCGTAGACAAAATG (SEQ ID NO: 14), Gapdh downstream primer sequence: TGAGGTCAATGAAGGGGTCGT (SEQ ID NO: 15).

[0064] The results are as follows Figure 2 As shown in Figure B, knockdown of circSamd4 significantly reduced the expression of Ccn2 and Postn genes increased by TGF-β1 stimulation, indicating that knockdown of circSamd4 can reduce the expression of cardiac fibroblast activation marker genes to a certain extent.

[0065] (3) Immunofluorescence staining: After the cells were transfected with siRNA and stimulated with TGF-β1, immunofluorescence staining of fibroblasts was performed according to the following steps to observe the activation of the cells: discard the cell culture medium, gently rinse the cells twice with room temperature PBS buffer, add 4% paraformaldehyde to fix the cells, and fix them at room temperature for 15 minutes. After fixation, add PBS buffer and rinse them three times at low speed on a shaker, each time for 5 minutes. Prepare 0.5% Triton X-100 cell permeabilization solution and permeabilize the cells at room temperature for 10 minutes. Add PBS buffer and rinse them three times at low speed on a shaker, each time for 5 minutes. Add 0.1% BSA blocking solution and block at room temperature for 30 minutes. After blocking, start incubation with primary antibody, add primary antibody diluted with antibody diluent (α-SMA ratio is 1:200), and incubate at 4°C overnight. The next day, the primary antibody was recovered and rinsed three times with PBS buffer solution. The secondary antibody was then incubated with the secondary antibody at a ratio of 1:400. 488 or 594 fluorescent secondary antibodies were selected according to the purpose of the experiment and incubated at room temperature for 2 hours. Rinse three times with PBS buffer solution, 5 minutes each time. Add DAPI staining solution to counterstain the cell nucleus. DAPI was prepared with PBS (1:200) and incubated at room temperature for 5-10 minutes. Rinse three times with PBS buffer solution, 5 minutes each time, and finally add PBS for storage. Image acquisition: Observe and capture images using a fluorescence microscope or confocal microscope, and then analyze the images using Image J. The results are shown in the figure below. Figure 2 As shown in C, knockdown of circSamd4 significantly reduced the increase in α-SMA fluorescence intensity induced by TGF-β1 stimulation, indicating that knockdown of circSamd4 can reduce the expression of marker proteins of cardiac fibroblast activation to a certain extent.

[0066] Example 3 In vivo experiments in mice to verify the function of circSamd4

[0067] An adeno-associated virus carrying the Periostin promoter to target fibroblasts and knock down circSamd4 was constructed, and Shanghai Jikai Gene Chemistry Technology Co., Ltd. was commissioned to construct and package it. Among them, the target sequence for knockdown is GCACGAGAATCATTAACCA (SEQ ID NO: 16), and the two designed oligos are ACCGCTAGCTAACTGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 17) and AGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCCTCGAGGGT (SEQ ID NO: 18) to form a double strand and be connected to the viral vector. The viral vector is named GV733, the element sequence is: Periostin-EGFP-MIR155 (MCS) -SV40 PolyA, and the negative control virus insertion sequence is TTCTCCGAACGTGTCACGT (SEQ ID NO: 19). The vector map of AAV is shown in the figure. Figure 3 As shown. A pressure overload-induced myocardial fibrosis model was established in mice according to the method in Example 1. One week after TAC surgery, the TAC group mice were randomly divided into two groups and injected with negative control adeno-associated virus and adeno-associated virus that specifically knocked down circSamd4 via tail vein injection. The Sham group was injected with negative control adeno-associated virus. The virus injection titer for each mouse was 5×10 11 The mice were then raised as usual until the fourth week, at which time they underwent ultrasound examinations and samples were collected.

[0068] (1) Observation of cardiac structure and evaluation of cardiac function after TAC surgery in mice: Adeno-associated virus treatment was given to mice 1 week after surgery, and echocardiography was performed on the mice in the 4th week to observe their cardiac structure and obtain their cardiac function indicators. The specific operation is as follows: Before the ultrasound examination, the mice were anesthetized with isoflurane inhalation (2.5% concentration for induction and 1% concentration for maintenance). The anesthetized mice were fixed in a supine position on the monitoring table, and the chest hair of the mice was removed with depilatory cream to fully expose the chest. The heart rate of the mice was maintained at 400-500 beats / min during the ultrasound examination. 3100 small animal high-frequency ultrasound imaging system, select MX400 probe (30MHz), after continuous observation of several cardiac cycles in the long axis section and short axis section, use grayscale mode (B mode) and motion mode (M mode) to acquire echocardiographic images. Note that the left ventricular outflow tract must be unobstructed in the long axis section and at the same level as the apex of the heart. When turning to the short axis section, the papillary muscle must be clearly observed and the maximum cavity surface must be obtained. After obtaining the echocardiogram, Vevo LAB 5.5.1 software was used to analyze the image and calculate EF and FS to evaluate the cardiac function of the mouse. The results are shown in Figure 2. Figure 4As shown in BC, the results showed that knockdown of circSamd4 in animals significantly increased EF and FS values, indicating that knockdown of circSamd4 significantly improved the deterioration of cardiac function caused by TAC.

[0069] (2) Knockdown efficiency detection: RNA was extracted from mouse hearts, and reverse transcription reaction and RT-qPCR were performed to detect the expression of circSamd4 in the hearts of mice in each group. The upstream and downstream primer sequences are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively. The test results are shown in Figure 4 As shown in A, the results show that the efficiency of AAV-sh-circSamd4 for circSamd4 in mice is about 50%, and AAV-sh-circSamd4 does not change the expression of its source gene Samd4.

[0070] (3) Detection of gene expression of cardiac fibrosis markers: RNA was extracted from mouse hearts, and the expression of Ccn2 and Postn in the hearts of each group of mice was detected by reverse transcription reaction and RT-qPCR. The upstream and downstream primer sequences of Ccn2 are shown in SEQ ID NO: 10 and SEQ ID NO: 11, respectively; the upstream and downstream primer sequences of Postn are shown in SEQ ID NO: 12 and SEQ ID NO: 13, respectively. The detection results are shown in Figure 4 As shown in D, the results showed that the expression of Ccn2 and Postn in the TAC+AAV-sh-circSamd4 group was significantly lower than that in the TAC+AAV-sh-Ctrl group, indicating that knockdown of circSamd4 in vivo significantly reduced the increase in gene expression of fibrosis markers caused by TAC.

[0071] (4) Masson staining of cardiac tissue to assess the degree of cardiac fibrosis. After the ultrasound examination, the mice were euthanized, the chest cavity was opened and the heart was removed. The heart was placed on ice and washed with PBS buffer. After the heart tissue was fixed for 24 hours, it was routinely dehydrated, transparent, paraffin-embedded, and sliced. The slices were routinely dewaxed to water, stained with prepared Weigert iron hematoxylin staining solution, differentiated with acidic ethanol differentiation solution, blued with Masson blueing solution, and stained with Ponceau fuchsin staining solution. Water washing was required between each staining. After Ponceau fuchsin staining, the slices were washed with weak acid working solution (the ratio of weak acid working solution was distilled water: weak acid solution = 2:1), then washed with phosphomolybdic acid solution, and then directly placed in aniline blue staining solution for staining. After washing with prepared weak acid working solution, the slices were quickly dehydrated with 95% ethanol, dehydrated with anhydrous ethanol three times, and finally transparentized with xylene three times and sealed with neutral gum. After staining, the slices were scanned. After obtaining the scanned images, Image J software was used to analyze the myocardial collagen deposition.

[0072] The results are as follows Figure 4As shown in E, the results showed that knocking down circSamd4 in animals significantly reduced the area of ​​cardiac fibrosis, indicating that knocking down circSamd4 significantly reduced TAC-induced cardiac fibrosis.

Claims

1. Use of a vector for reducing the expression of circSamd4 associated with myocardial fibrosis in the preparation of a drug for treating pressure overload-induced myocardial fibrosis, characterized in that: The target gene nucleotide sequence of the vector is SEQ ID NO: 16; the vector contains two oligonucleotide sequences designed for knocking down circSamd4, namely SEQ ID NO: 17 and SEQ ID NO: 18, and the two oligonucleotide sequences form a double strand and are connected to the vector.

2. The use according to claim 1, characterized in that: The vector is a viral vector.

3. The use according to claim 2, characterized in that: The viral vector is an adeno-associated viral vector.

4. The use according to claim 3, characterized in that: The adeno-associated virus vector is GV733.

5. Use of a host cell containing a vector for reducing the expression of circSamd4 associated with myocardial fibrosis in the preparation of a medicament for treating pressure overload-induced myocardial fibrosis, characterized in that: The target gene nucleotide sequence of the vector is SEQ ID NO: 16; the vector contains two oligonucleotide sequences designed for knocking down circSamd4, namely SEQ ID NO: 17 and SEQ ID NO: 18, and the two oligonucleotide sequences form a double strand and are connected into the vector.

Citation Information

Patent Citations

  • KR20210057545A