Rice OsRH3 gene and application thereof in rice disease resistance

Abstract

The invention discloses a rice OsRH3 gene and application thereof in rice disease resistance, the nucleotide sequence of the rice OsRH3 gene is as shown in SEQ ID NO.1, and the nucleotide sequence of the rice OsRH3 gene is as shown in SEQ ID NO.2. The gene OsRH3 is knocked out through a CRISPR / Cas9 technology, and a knockout mutant osrh3 is obtained; it is found through rice blast resistance identification that compared with wild type rice, the mutant osrh3 is more resistant to diseases and small in disease spot area, the number of pyricularia grisea carried by diseased leaves is small, and it is indicated that the OsRH3 negatively regulates the resistance of rice to rice blast. The bacterial leaf blight resistance identification finds that compared with wild rice, the mutant osrh3 is more resistant to diseases and shorter in disease spots, which indicates that the OsRH3 negatively regulates the resistance of the rice to the bacterial leaf blight. The method is beneficial to cultivation of rice blast and bacterial leaf disease resistant rice varieties, and provides a basis for later screening of high-resistance and broad-spectrum-resistance rice varieties.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology agricultural technology, and specifically relates to the application of rice OsRH3 gene and encoded protein in improving rice disease resistance. Background Art

[0002] Rice (Oryza sativa L.) is one of the world's major food crops. However, during the entire growth process of rice, it is usually attacked by a variety of pathogenic microorganisms, which seriously reduces rice production and threatens global food security. Therefore, ensuring rice production is of great significance to ensuring national food security. Rice blast is more common during the growth of rice. It is one of the most serious fungal diseases and is destructive. It is caused by the rice blast fungus (Pyricularia oryzae); rice bacterial leaf blight is one of the most serious bacterial diseases caused by the bacterial leaf blight fungus (Xanthomonas oryzae pv. oryzae, Xoo); when rice is infected with rice blast or bacterial leaf blight, the normal growth and development of rice will be affected. There are many ways to prevent and control rice diseases. Among them, selecting disease-resistant varieties and disease-resistant genes is the most fundamental measure to prevent and control rice diseases. This is to prevent the harm caused by pathogens to rice itself from the source. Therefore, identifying genes related to rice resistance to rice blast and bacterial blight and analyzing their molecular mechanisms are of great significance for breeding new disease-resistant rice varieties and developing disease prevention and control strategies. Traditional disease-resistant breeding is mainly completed through field hybridization and backcrossing, combined with field resistance identification and comprehensive selection of agronomic traits. It takes many years and generations of screening to breed resistant varieties. CRISPR / Cas9 technology is a gene editing technology that has been widely used in recent years. It has the characteristics of high efficiency, simple operation and low cost. The principle of this technology is to use the specific recognition of gRNA and target sequence to guide the nuclease Cas9 to cut DNA at the target site to make double-strand breaks, thereby stimulating the intracellular DNA repair system and causing gene mutations, including base insertion, deletion and substitution. In recent years, this system has been used to genetically improve related traits of plants such as rice. In the breeding process, the use of CRISPR / Cas9 technology can quickly obtain safe and stable inherited homozygous mutants, which can be used to improve and breed disease-resistant rice varieties and promote the creation of excellent germplasm resources. Summary of the invention

[0003] The present invention solves the technical problems of traditional disease-resistant breeding and provides the application of OsRH3 gene and encoded protein in improving rice resistance.

[0004] The nucleotide sequence of the rice OsRH3 gene is shown in the sequence listing SEQ ID NO.1.

[0005] The rice OsRH3 gene is used in preparing rice blast and rice bacterial blight resistant varieties.

[0006] A rice disease resistance breeding method, knocking out the OsRH3 gene of a rice variety as shown in SEQ ID NO.1 in the sequence list;

[0007] The knockout is achieved by using CRISPR / Cas9 technology, and the nucleotide sequence of the knockout target is: CGTCACGATCATCTCCGCCGcgg.

[0008] A gene knockout vector is a vector that inserts the nucleotide sequence: CGTCACGATCATCTCCGCCGcgg into the vector pYLCRISPR / Cas9P ubi -H built.

[0009] The present invention provides an application of a rice OsRH3 gene and a coding protein in improving rice disease resistance, which is achieved by knocking out the rice OsRH3 gene; the OsRH3 gene, its nucleotide sequence is shown in SEQ ID NO.1; the knockout is knocked out by using CRISPR / Cas9 gene editing technology; the target nucleotide sequence of the OsRH3 gene is: CGTCACGATCATCTCCGCCGcgg. The present invention knocks out the gene OsRH3 by CRISPR / Cas9 technology to obtain a knockout mutant osrh3. Through the identification of rice blast resistance, it is found that compared with wild-type rice, the knockout mutant osrh3 rice is more disease-resistant, has a smaller lesion area, and carries less rice blast fungi on diseased leaves, indicating that OsRH3 negatively regulates rice resistance to rice blast. The knockout mutant osrh3 lacks the OsRH3 gene and exhibits enhanced resistance to rice blast. Through the identification of rice bacterial blight resistance, it was found that compared with wild-type rice, the knockout mutant OsRH3 rice was more resistant to the disease, and the lesion length was significantly smaller than that of the wild type, indicating that OsRH3 negatively regulates the resistance of rice to rice bacterial blight. The knockout mutant osrh3 lacks the OsRH3 gene and shows enhanced resistance to rice bacterial blight, which can be promoted for practical application. The present invention is conducive to the cultivation of rice varieties resistant to rice blast and bacterial blight, and provides a basis for the later screening of rice varieties with high resistance and broad-spectrum resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 Schematic diagram of knocking out the gene OsRH3 in the rice Nipponbare (NIP) background using CRISPR / Cas9 gene editing technology;

[0011] Figure 2Analysis of the resistance of OsRH3 mutant to rice blast; A represents the phenotype of wild-type Nipponbare (NIP) and osrh3 mutant after inoculation with rice blast fungus; B represents the statistical results of the lesion area on the leaves of wild-type Nipponbare (NIP) and osrh3 mutant after inoculation with rice blast fungus; C represents the detection results of the amount of rice blast fungus in the leaves of wild-type Nipponbare (NIP) and osrh3 mutant after inoculation with rice blast fungus.

[0012] Figure 3 Resistance analysis of OsRH3 mutant to bacterial blight; A represents the phenotype of wild-type Nipponbare (NIP) and osrh3 mutant after inoculation with bacterial blight pathogen; B represents the statistical results of leaf spot length of wild-type Nipponbare (NIP) and osrh3 mutant after inoculation with bacterial blight pathogen. DETAILED DESCRIPTION

[0013] Example 1 Cloning of OsRH3 gene

[0014] The primer design software Primer Premier 5.0 was used to design cloning primers for the target gene OsRH3 (base sequence as shown in the sequence table SEQ ID NO.1), and the specific sequence is as follows. RNA of the rice variety Oryza sativa L. var. Nipponbare was extracted and reverse transcribed into cDNA. Using this cDNA as a template, PCR amplification was performed with cloning primers to obtain a PCR product with a length of 489 bp, which has nucleotides 1 to 489 of the sequence shown in SEQ ID NO:1.

[0015] OsRH3-F: ATGGATCCCACGATGCCCA;

[0016] OsRH3-R: TCAATTGACAAGCTAAGATC.

[0017] The PCR amplification system was prepared according to the instruction manual of Phusion DNA Polymerase, specifically: 2×PhantaMax Buffer 10 μL, dNTP Mix 0.4 μL, upstream primer (10 μM) 0.8 μL, downstream primer (10 μM) 0.8 μL, cDNA template 400 ng, Phusion DNA Polymerase 0.4 μL, and ddH2O to 20 μL.

[0018] The PCR reaction system was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 30 s, 32 cycles; and full extension at 72°C for 5 min.

[0019] Example 2 Construction of OsRH3 gene mutants

[0020] 1. Construction of OsRH3 gene mutants using CRISPR / Cas9 gene editing technology

[0021] Using the website http: / / skl.scau.edu.cn / , the editing target site of the target gene OsRH3 (the base sequence is shown in the sequence table SEQID NO.1) was designed. The target site location is as follows: Figure 1 As shown in the figure, the target nucleotide sequence is: CGTCACGATCATCTCCGCCGcgg (the last three bases are PAM sites). The candidate target nucleotide sequence was inserted into the intermediate vector pYLsgRNA-OsU6a, and then the OsU6a-target-sgRNA fragment was inserted into the final vector pYLCRISPR / Cas9P using the BsaI restriction site through Golden Gate cloning. ubi -H (for specific construction steps, please refer to: MaXingliang, Zhang Qunyu, Zhu Qinlong, Liu Wei, Chen Yan, Qiu Rong, Wang Bin, Yang Zhongfang, et al. (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Molecular Plant, 8(8), 1274-1284.). The successfully constructed CRISPR / Cas9 vector was transformed into callus induced by immature embryos of wild-type Nipponbare by Agrobacterium-mediated method, and positive transgenic plants were obtained by hygromycin screening.

[0022] 2. Molecular identification of editing forms in positive transgenic plants

[0023] Using the genomic DNA of rice leaves as a template, PCR amplification was performed with the following identification primers, and the amplified products were sequenced by Sanger sequencing to analyze the editing form of the mutant.

[0024] The primers for identifying OsRH3 gene mutants are:

[0025] OsRH3-CRISPR-F:CGCCTCGCTCTCAACTCAA;

[0026] OsRH3-CRISPR-R:CGCTGTCCACCTTCTTCTCC.

[0027] The PCR amplification system was prepared according to the instruction manual of 2×Es Taq MasterMix (Dye), specifically: 10 μL of 2×Es Taq MasterMix (Dye), 0.8 μL of upstream primer (10 μM), 0.8 μL of downstream primer (10 μM), 1 μg of DNA template, and ddH2O to 20 μL.

[0028] The PCR reaction system was as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, for 35 cycles; and extension at 72°C for 2 min.

[0029] The results are as follows Figure 1 As shown, two homozygous knockout mutant lines, osrh3-20-1 and osrh3-20-6, were obtained. In the osrh3-20-1 mutant, two base A were inserted 73 bp downstream of the start codon ATG of the OsRH3 gene, resulting in a frameshift mutation, which led to the premature formation of a stop codon at 82-84 bp. In the osrh3-20-6 mutant, one base T was inserted 73 bp downstream of the start codon ATG of the OsRH3 gene, and the base C at 75 bp was mutated to base T, resulting in a frameshift mutation, which led to the premature formation of a stop codon at 127-129 bp.

[0030] Example 3 Identification of Rice Blast Resistance by Spray Inoculation

[0031] The wild-type Nipponbare (NIP) and knockout mutant lines osrh3-20-1 and osrh3-20-6 were planted in seedling trays and inoculated with rice blast fungus when they grew to the five-leaf stage.

[0032] The TCB strain of rice blast fungus stored on filter paper was inoculated on a tomato oatmeal solid medium plate for activation. The mycelium was scraped and transferred to a new tomato oatmeal medium plate for expansion. The mycelium was cut and placed in a 26°C black light incubator to induce spore production. The plate was washed with 0.1% Tween and filtered to obtain the rice blast fungus spore eluate. The spore concentration was adjusted to 1.0×10 5 / mL, set aside.

[0033] During inoculation, 0.1% Tween was evenly sprayed on the rice leaves, and then the rice blast spore eluate was evenly sprayed on the rice leaves. After inoculation, the leaves were cultured in the dark for 24 hours. After the shade cloth was removed, the normal light culture was continued. After 7 days of inoculation, the disease was recorded by taking photos. The area of ​​lesions on the inoculated leaves was counted using Photoshop software. At the same time, real-time fluorescence quantitative PCR was used to detect the amount of bacteria on the diseased leaves. Equal amounts of leaves of wild-type Nipponbare (NIP) and knockout mutant osrh3 were taken, genomic DNA was extracted, and fluorescence quantitative PCR was performed using the following primers to compare the amount of rice blast carried by the leaves of wild-type NIP and knockout mutant osrh3, thereby completing the evaluation of the resistance of the knockout mutant to rice blast.

[0034] Real-time fluorescence quantitative PCR primers are:

[0035] MoPot2-F: ACGACCCGTCTTTACTTATTTGG;

[0036] MoPot2-R:AAGTAGCGTTGGTTTTGTTGGAT;

[0037] OsUbi-F:GCCCAAGAAGAAGATCAAGAAC;

[0038] OsUbi-R: AGATAACAACGGAAGCATAAAAGTC.

[0039] The fluorescence quantitative PCR amplification system was prepared according to the instruction manual of 2×SYBR qPCR Mixture, specifically: 5 μL of 2×SYBR qPCR Mixture, 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), 0.6 μL of DNA template, and ddH2O to 10 μL. Each sample was repeated 3 times.

[0040] The fluorescence quantitative PCR reaction system was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 30 s, annealing at 60°C for 1 min, 40 cycles; and extension at 72°C for 2 min.

[0041] The results are as follows Figure 2 As shown, compared with the wild type, the lesion area and the amount of rice blast fungi in the leaves of the homozygous knockout mutant lines osrh3-20-1 and osrh3-20-6 were significantly lower than those of the wild type, indicating that after the knockout of the gene OsRH3, the resistance of the wild type to rice blast was significantly enhanced.

[0042] Example 4 Identification of resistance to bacterial blight using the leaf clipping inoculation method

[0043] The wild-type Nipponbare (NIP) and knockout mutant lines osrh3-20-1 and osrh3-20-6 were planted in a greenhouse, and the rice grown for 6 weeks was inoculated with bacterial blight pathogen.

[0044] First, streak the PXO99A strain of Xanthomonas spp. frozen at -80℃ onto a beef extract peptone solid medium plate containing cephalexin antibiotics and culture at 28℃ for one day. Pick a single colony to beef extract peptone liquid medium containing cephalexin antibiotics, shake at 28℃ for 48 hours, and collect the bacteria by centrifugation at 9000 rpm for 3 min. Resuspend the bacteria with 0.1 M MgCl2 solution, centrifuge at 9000 rpm for 3 min, discard the supernatant, repeat once, and finally resuspend the bacteria with 0.1 M MgCl2 solution. Use a spectrophotometer to adjust the OD value of the bacterial suspension to 0.8 for standby use.

[0045] During inoculation, the rice grown for 6 weeks was moved to a place with suitable light and no rain. The bacterial suspension was dipped into sterilized scissors and cut about 10 cm below the tip of the penultimate leaf of each rice plant. The leaves were placed for 2 weeks, and the leaves were sprayed with distilled water regularly to keep them moist. The length of the diseased spots was measured after two weeks, and the length of the lesions on the leaves of the wild-type NIP and the knockout mutant lines osrh3-20-1 and osrh3-20-6 was compared to complete the evaluation of the knockout mutant's resistance to bacterial blight.

[0046] The results are as follows Figure 3 As shown, compared with the wild type, the length of lesions on the leaves of the knockout mutant lines osrh3-20-1 and osrh3-20-6 was significantly shorter than that of the wild type, indicating that the resistance of the knockout mutant lines osrh3-20-1 and osrh3-20-6 to bacterial blight was significantly enhanced.

Claims

1. Rice OsRH3 gene, the nucleotide sequence of which is shown in the sequence listing SEQ ID NO.

1.

2. Application of the rice OsRH3 gene as shown in SEQ ID NO.1 in the preparation of rice blast and rice bacterial blight resistant varieties.

3. A method for breeding rice for disease resistance, characterized in that: The OsRH3 gene of the knockout rice variety is shown in SEQ ID NO.1 in the sequence list.

4. A rice disease resistance breeding method according to claim 3, characterized in that: The knockout is achieved by using CRISPR / Cas9 technology, and the nucleotide sequence of the knockout target is: CGTCACGATCATCTCCGCCGcgg.

5. A gene knockout vector, which inserts the nucleotide sequence: CGTCACGATCATCTCCGCCGcgg into the vector pYLCRISPR / Cas9P ubi -H built.

Images