Genetically engineered bacterium for efficiently synthesizing ectoine and construction method of genetically engineered bacterium
By constructing expression vectors in E. coli and optimizing glutamate metabolism pathways, and using CRISPRi technology to regulate glutamate metabolism, the problems of low yield and difficult separation in the existing technology were solved, and efficient synthesis and yield improvement were achieved .
Patent Information
- Application Number
- CN202411255855.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-09
- Publication Date
- 2024-12-20
AI Technical Summary
When the prior art constructs the E. coli tetrahydropyrimidine metabolic pathway, it usually affects other metabolic branches, resulting in a decrease in the yield of tetrahydropyrimidine, and is difficult to isolate and purify in biological fermentation method, and the chemical synthesis method is complex and the yield is low.
The expression vector contains aspartate dehydrogenase, glutamate dehydrogenase and glutamate synthase genes, and weakly express the glutamine ligase gene through CRISPRi technology, optimize the glutamate metabolism pathway, and improve the intracellular glutamate acid content, thereby increasing the synthesis yield of tetrahydropyrimidine.
The efficient synthesis of tetrahydropyrimidines is achieved without affecting other metabolic pathways, which improves yield and reduces the difficulty of isolation and purification, and meets the cells' demand for glutamate.
Smart Images
Figure CN119162214A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering and fermentation engineering, and in particular to a genetic engineering bacterium for efficiently synthesizing ectoine and a construction method thereof. Background Art
[0002] Ectohydropyrimidine is an amino acid derivative found in microorganisms, specifically a cyclic amino acid. Ectohydropyrimidine mainly exists in moderately halophilic bacteria, such as Halomonas Elongata, and non-halophilic bacteria such as Streptomyces and Escherichia coli. As a natural substance with multiple biological and medical effects, ectohydropyrimidine has broad application prospects in the fields of cosmetics, skin care products, and medicine.
[0003] At present, there are two main methods for the synthesis of ectoine: chemical synthesis and biosynthesis. There are many problems with chemical synthesis, including complex production process, low synthesis yield, many by-products with similar chemical properties to the target product, and high difficulty in downstream separation and purification. The biosynthesis method mainly uses enzyme catalysis and fermentation. In the biofermentation method, it is necessary to construct the biological metabolic pathway of ectoine in the bacteria. The synthesis process of ectoine can be completed in three steps. First, aspartate kinase (LysC) catalyzes aspartate to generate β-aspartyl phosphate; then aspartate semialdehyde dehydrogenase (AsD) catalyzes β-aspartyl phosphate to generate aspartate-β-semialdehyde; finally, aspartate-β-semialdehyde completes the synthesis of ectoine under the catalysis of three enzymes encoded by ectABC.
[0004] In recent years, there have been many reports on the research of genetically modifying Escherichia coli to produce ectoine through metabolic engineering. However, most of the research on the construction of the metabolic pathway of ectoine in Escherichia coli usually adopts the means of strengthening the strength of the target product path. However, such pathway construction often affects the metabolism of other branches, thereby affecting the growth of the target yield of the entire bacteria. For example, the metabolic pathway from oxaloacetate to aspartate and the metabolic pathway from aspartate-β-semialdehyde to 2,4-diaminobutyric acid both require the participation of glutamate. If the glutamate metabolic branch is reduced, it will inevitably affect the metabolism of 2,4-diaminobutyric acid, thereby affecting the yield of the target product ectoine. Summary of the invention
[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a genetically engineered bacterium that can efficiently synthesize ectoine without affecting the metabolic pathways of other necessary products and a construction method thereof.
[0006] To achieve the above object, the technical solution adopted by the present invention is:
[0007] In a first aspect, the present invention provides an expression vector comprising an aspartate dehydrogenase gene fragment, a glutamate dehydrogenase gene fragment and a glutamate synthase gene fragment.
[0008] The expression vector provided by the present invention can regulate the glutamate metabolic pathway in the host cell, increase the accumulation of glutamate in the host body, and further affect the production capacity of ectoine in the cell.
[0009] As a preferred embodiment of the expression vector of the present invention, the vector uses a dual-promoter plasmid as a backbone, and the aspartate dehydrogenase gene fragment, the glutamate dehydrogenase gene fragment and the glutamate synthase gene fragment are connected in series on the dual-promoter plasmid, wherein the aspartate dehydrogenase gene fragment is connected to the back of the first promoter of the plasmid dual promoter, the glutamate dehydrogenase gene is connected to the back of the second promoter of the plasmid dual promoter, and the glutamate synthase gene fragment is connected between NcoI and BamHI connected to the dual-promoter plasmid.
[0010] As a preferred embodiment of the expression vector of the present invention, the dual promoter plasmid is pETDuet-1.
[0011] As a preferred embodiment of the expression vector of the present invention, the aspartate dehydrogenase gene is the aspDH gene from Pseudomonas aeruginosa or the aspC gene from Escherichia coli, the glutamate dehydrogenase gene is the rocG gene from Bacillus subtilis or the gdhA gene from Escherichia coli, and the glutamate synthase gene is the gltB gene from Escherichia coli.
[0012] In order to improve the production capacity of ectoine in host cells, the aspartate dehydrogenase genes, glutamate dehydrogenase genes, and glutamate synthase genes of many species of the present invention are screened out, and the aspDH gene from Pseudomonas aeruginosa, the aspC gene from Escherichia coli, the rocG gene from Bacillus subtilis, the gdhA gene from Escherichia coli, and the gltB gene from Escherichia coli are used as key enzyme genes in regulating the glutamate metabolic pathway, which are conducive to the accumulation of glutamate in cells. Other aspartate dehydrogenase genes, glutamate dehydrogenase genes, and glutamate synthase genes of other species are not as good as the genes screened out by the present invention.
[0013] As a preferred embodiment of the expression vector of the present invention, the sequence of the aspDH gene is shown in SEQ ID NO: 16; the Gene ID of the aspC gene is 945553; the Gene ID of the rocG gene is 937066; the Gene ID of the gdhA gene is 946802; and the Gene ID of the gltB gene is 947724.
[0014] As a preferred embodiment of the expression vector of the present invention, the aspartate dehydrogenase gene is the aspDH gene derived from Pseudomonas aeruginosa, and the glutamate dehydrogenase gene is the rocG gene derived from Bacillus subtilis.
[0015] The present invention optimizes the key enzyme genes of the glutamate metabolic pathway, compares enzyme genes from different sources, and finds that the aspDH gene from Pseudomonas aeruginosa and the rocG gene from Bacillus subtilis can better increase the production capacity of host cells than similar genes from other sources.
[0016] In a second aspect, the present invention provides a genetically engineered bacterium, which overexpresses the gene cluster ectABC, overexpresses the aspartate dehydrogenase gene, overexpresses the glutamate dehydrogenase gene, overexpresses the glutamate synthase gene, and weakly expresses the glutamine ligase gene.
[0017] The present invention increases the content of glutamate necessary for the synthesis of ectoine by strengthening the expression of aspartate dehydrogenase gene, glutamate dehydrogenase gene and glutamate synthase gene, and reduces the metabolic pathway of glutamate to glutamine by weakening the glutamine ligase gene, thereby ensuring the content of glutamate in cells, not only increasing the synthesis yield of ectoine, but also ensuring the glutamate required for the growth of the cells themselves.
[0018] As a preferred embodiment of the genetically engineered bacteria of the present invention, the gene cluster ectABC is expressed through the plasmid pRSFDuet-1; overexpression of the aspartate dehydrogenase gene, glutamate dehydrogenase gene and glutamate synthase gene is achieved through a plasmid or genome integration method, and the glutamine ligase gene is weakly expressed through the CRISPRi gene editing method.
[0019] As a preferred embodiment of the genetically engineered bacteria of the present invention, the CRISPRi gene editing method for weakly expressing the glutamine ligase gene is as follows:
[0020] S1. Designing sgRNAs-N20 sequence for glutamine ligase gene glnA, wherein the sgRNAs-N20 sequence is any one of SEQ ID NOs: 13 to 15;
[0021] S2. Use BsaI to cut the plasmid pli-dCas9-sgRNA to linearize it, and then connect it to the sgRNAs sequence fragment to obtain the plasmid pli-dCas9-sgRNA-glnAS.
[0022] Furthermore, the CRISPRi gene editing method weakly expresses the glutamine ligase gene method, and the specific steps are:
[0023] S1. sgRNAs-N20 sequences were designed for the three regions of -34 to -15 bp upstream of ATG, 58 to 77 bp downstream of ATG, and 403 to 422 bp downstream of ATG of the glutamine ligase gene glnA, respectively, to obtain three sgRNAs-N20 sequences, namely glnAS1, glnAS2, and glnAS3; the glnAS1 sequence is shown in SEQ ID NO: 13; the glnAS2 sequence is shown in SEQ ID NO: 14; the glnAS3 sequence is shown in SEQ ID NO: 15;
[0024] S2. Use BsaI to cut the plasmid pli-dCas9-sgRNA to linearize it, and then connect it to the glnAS1, glnAS2, and glnAS3 fragments respectively to obtain plasmids pli-dCas9-sgRNA-glnAS1, pli-dCas9-sgRNA-glnAS2, and pli-dCas9-sgRNA-glnAS3.
[0025] As a preferred embodiment of the genetically engineered bacteria of the present invention, the aspartate dehydrogenase gene is the aspDH gene from Pseudomonas aeruginosa or the aspC gene from Escherichia coli, the glutamate dehydrogenase gene is the rocG gene from Bacillus subtilis or the gdhA gene from Escherichia coli, and the glutamate synthase gene is the gltB gene from Escherichia coli.
[0026] As a preferred embodiment of the genetically engineered bacteria of the present invention, the aspartate dehydrogenase gene is the aspDH gene derived from Pseudomonas aeruginosa, and the glutamate dehydrogenase gene is the rocG gene derived from Bacillus subtilis.
[0027] The present invention optimizes the key enzyme genes of the glutamate metabolic pathway, compares enzyme genes from different sources, and finds that the aspDH gene from Pseudomonas aeruginosa and the rocG gene from Bacillus subtilis can better improve the production capacity of recombinant Escherichia coli than similar genes from other sources.
[0028] In a third aspect, the present invention provides a method for constructing the genetically engineered bacteria of the second aspect, comprising the following steps:
[0029] S1. Integrate the gene cluster ectABC into the plasmid to obtain a plasmid expressing ectABC;
[0030] S2. Connecting the aspartate dehydrogenase gene fragment to the first T7 promoter of the dual promoter plasmid by homologous recombination technology to obtain plasmid A;
[0031] S3. Connect the glutamate dehydrogenase gene fragment to the second T7 promoter of plasmid A by homologous recombination technology to obtain plasmid B;
[0032] S4. Connecting the glutamate synthase gene fragment to plasmid B by homologous recombination technology to obtain plasmid C;
[0033] S5. constructing a plasmid for weakly expressing a glutamine ligase gene, wherein the plasmid comprises a sgRNAs-N20 sequence, and the sgRNAs-N20 sequence is shown in any one of SEQ ID NOs: 13 to 15;
[0034] S6. Transforming the plasmid of step S1, the plasmid of step S4 and the plasmid of step S5 into host cells, culturing the host cells in a liquid culture medium, and obtaining the genetically engineered bacteria.
[0035] In a fourth aspect, the present invention provides use of the expression vector or the genetically engineered bacteria in the preparation of ectoine.
[0036] Compared with the prior art, the present invention has the following beneficial effects: the present invention uses synthetic biology technology and genetic engineering means to take Escherichia coli E.coli BL21 (DE3) as a starting strain to express the ectABC gene cluster related to the ectoine synthesis pathway from Halomonas elongatus, thereby realizing heterologous synthesis of ectoine; and further improves the yield of ectoine by combining the expression of aspartate dehydrogenase gene aspC from Escherichia coli, glutamate dehydrogenase gene gdhA from Escherichia coli, aspartate dehydrogenase gene aspDH from Pseudomonas aeruginosa, glutamate dehydrogenase gene rocG from Bacillus subtilis, and glutamate synthase gene gltB from Escherichia coli. At the same time, CRISPRi technology is used to achieve weak expression of glutamine ligase gene glnA to meet the supply demand of glutamate, thereby improving the yield of ectoine. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 Schematic diagram of the construction of the plasmid pli-dCas9-sgRNA-glnAS of the present invention. DETAILED DESCRIPTION
[0038] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.
[0039] pRSFDuet-1 and pETDuet-1 were synthesized by General Biotechnology (Anhui) Co., Ltd.
[0040] The sequence of the ectABC gene cluster related to the ectoine biosynthesis pathway from Halomonas elongatus is shown in SEQ ID NO: 17;
[0041] The Gene ID of the aspartate dehydrogenase gene aspC from Escherichia coli is 945553;
[0042] The sequence of the aspartate dehydrogenase gene aspDH from Pseudomonas aeruginosa is shown in SEQ ID NO: 16;
[0043] The Gene ID of the glutamate dehydrogenase gene gdhA from Escherichia coli is 946802;
[0044] The Gene ID of the glutamate dehydrogenase gene rocG from Bacillus subtilis is 937066;
[0045] The Gene ID of the glutamate synthase gene gltB from Escherichia coli is 947724;
[0046] The Gene ID of the glutamine ligase gene glnA is 948370.
[0047] Example 1
[0048] This embodiment provides an expression vector, which includes an aspartate dehydrogenase gene fragment, a glutamate dehydrogenase gene fragment and a glutamate synthase gene fragment.
[0049] Preferably, the aspartate dehydrogenase gene can be the aspartate dehydrogenase gene aspC derived from Escherichia coli, or can be the aspartate dehydrogenase gene aspDH derived from Pseudomonas aeruginosa; more preferably, the aspartate dehydrogenase gene is the aspartate dehydrogenase gene aspDH derived from Pseudomonas aeruginosa.
[0050] Preferably, the glutamate dehydrogenase gene may be a glutamate dehydrogenase gene gdhA derived from Escherichia coli, or may be a glutamate dehydrogenase gene rocG derived from Bacillus subtilis; more preferably, the glutamate dehydrogenase gene is a glutamate dehydrogenase gene rocG derived from Bacillus subtilis.
[0051] Preferably, the glutamate synthase gene is the glutamate synthase gene gltB derived from Escherichia coli.
[0052] Example 2
[0053] This embodiment provides a genetically engineered bacterium, which overexpresses the gene cluster ectABC, overexpresses the aspartate dehydrogenase gene, overexpresses the glutamate dehydrogenase gene, overexpresses the glutamate synthase gene, and weakly expresses the glutamine ligase gene.
[0054] Preferably, the aspartate dehydrogenase gene can be the aspartate dehydrogenase gene aspC derived from Escherichia coli, or can be the aspartate dehydrogenase gene aspDH derived from Pseudomonas aeruginosa; more preferably, the aspartate dehydrogenase gene is the aspartate dehydrogenase gene aspDH derived from Pseudomonas aeruginosa.
[0055] Preferably, the glutamate dehydrogenase gene may be a glutamate dehydrogenase gene gdhA derived from Escherichia coli, or may be a glutamate dehydrogenase gene rocG derived from Bacillus subtilis; more preferably, the glutamate dehydrogenase gene is a glutamate dehydrogenase gene rocG derived from Bacillus subtilis.
[0056] Preferably, the glutamate synthase gene may be the glutamate synthase gene gltB derived from Escherichia coli;
[0057] Preferably, the glutamine ligase gene may be the glutamine ligase gene glnA.
[0058] Preferably, the genetically engineered bacteria may be derived from prokaryotic cells and / or eukaryotic cells; more preferably, the prokaryotic cells may be Escherichia coli or eukaryotic cells.
[0059] Example 3
[0060] This embodiment provides a method for constructing a recombinant Escherichia coli, comprising the following steps:
[0061] S1. Integrate the gene cluster ectABC into the pRSFDuet-1 plasmid to obtain the plasmid pRSF-ectABC;
[0062] S2. Connect the aspartate dehydrogenase gene fragment to the first T7 promoter of plasmid pETDuet-1 by homologous recombination technology to obtain plasmid A;
[0063] S3. Connect the glutamate dehydrogenase gene fragment to the second T7 promoter of plasmid A by homologous recombination technology to obtain plasmid B;
[0064] S4. Connecting the glutamate synthase gene fragment to plasmid B by homologous recombination technology to obtain plasmid C;
[0065] S5. constructing a plasmid for weakly expressing a glutamine ligase gene, wherein the plasmid comprises a sgRNAs-N20 sequence, and the sgRNAs-N20 sequence is shown in any one of SEQ ID NOs: 13 to 15;
[0066] S6. The plasmid of step S1, the plasmid of step S4 and the plasmid of step S5 are transformed into Escherichia coli, and the Escherichia coli is cultured in a liquid culture medium to obtain the recombinant Escherichia coli.
[0067] Among them, the specific steps of step S5 to construct a plasmid for weakly expressing glutamine ligase gene are as follows:
[0068] 1) Designing sgRNAs sequences for the three regions of -34 to -15 bp upstream of ATG, 58 to 77 bp downstream of ATG, and 403 to 422 bp downstream of ATG of the glutamine ligase gene glnA, respectively, to obtain three sgRNAs-N20 sequences, namely glnAS1, glnAS2, and glnAS3; the sgRNAs-N20 sequence is shown in any one of SEQ ID NOs: 13 to 15; the glnAS1 sequence is shown in SEQ ID NO: 13; the glnAS2 sequence is shown in SEQ ID NO: 14; the glnAS3 sequence is shown in SEQ ID NO: 15;
[0069] 2) The plasmid pli-dCas9-sgRNA was cut with BsaI to linearize it, and then the glnAS1, glnAS2, and glnAS3 fragments were connected respectively to obtain plasmids pli-dCas9-sgRNA-glnAS1, pli-dCas9-sgRNA-glnAS2, and pli-dCas9-sgRNA-glnAS3.
[0070] Example 4 Effect of Glutamate Metabolic Pathway on Ectohydropyrimidine Production
[0071] Using E. coli BL21 (DE3) as the expression strain, the expression plasmids pET-aspDH-gdhA, pET-aspDH-rocG, pET-aspDH-gltB, pET-aspDH-gdhA-gltB, pET-aspDH-rocG-gltB, pET-aspC-gdhA, pET-aspC-rocG, pET-aspC-gltB, pET-aspC-gdhA-gltB, pET-aspC-rocG-gltB required in this example were constructed. The specific steps are as follows:
[0072] S1, the gene cluster ectABC from Halomonas elongatus was integrated into the pRSFDuet-1 plasmid, which was constructed by General Biotechnology (Anhui) Co., Ltd., and the constructed plasmid was pRSF-ectABC;
[0073] S2. Design primer pair aspDH-F / aspDH-R to clone the aspartate dehydrogenase gene aspDH from Pseudomonas aeruginosa, and connect the cloned aspDH fragment to the first T7 promoter of plasmid pETDuet-1 by homologous recombination technology to construct the plasmid pET-aspDH;
[0074] S3. Design a primer pair gdhA-F / gdhA-R to clone the glutamate dehydrogenase gene gdhA from Escherichia coli, and connect the cloned gdhA fragment to the second T7 promoter of the plasmid pET-aspDH by homologous recombination technology to construct the plasmid pET-aspDH-gdhA;
[0075] S4. Design primer pair rocG-F / rocG-R to clone the glutamate dehydrogenase gene rocG from Bacillus subtilis, and connect the cloned rocG fragment to the second T7 promoter of plasmid pET-aspDH by homologous recombination technology to construct plasmid pET-aspDH-rocG;
[0076] S5. Design primer pair pET-F / pET-R, and use plasmids pET-aspDH, pET-aspDH-gdhA, and pET-aspDH-rocG as templates to perform PCR amplification to obtain linearized vectors. Simultaneously design primer pair gltB-F / gltB-R to clone the glutamate synthase gene gltB from Escherichia coli, and connect the cloned gltB fragment with the linearized plasmid vector by homologous recombination technology, and insert the fragment between NcoI and BamHI of pET-aspDH, pET-aspDH-gdhA, and pET-aspDH-rocG plasmids, respectively, to obtain pET-aspDH-gltB, pET-aspDH-gdhA-gltB, and pET-aspDH-rocG-gltB plasmids, respectively;
[0077] S6. Design a primer pair aspC-F / aspC-R to clone the aspartate dehydrogenase gene aspC from Escherichia coli, and connect the cloned aspC fragment to the plasmids pET-aspDH-gdhA, pET-aspDH-rocG, pET-aspDH-gltB, pET-aspDH-gdhA-gltB, and pET-aspDH-rocG-gltB by homologous recombination technology, that is, replace the aspDH fragment to obtain plasmids pET-aspC-gdhA, pET-aspC-rocG, pET-aspC-gltB, pET-aspC-gdhA-gltB, and pET-aspC-rocG-gltB;
[0078] S7. Three sgRNAs targeting the N20 sequence region of the glutamine ligase gene glnA (glnAS1: -34 to -15 bp; glnAS2: 58 to 77 bp; glnAS3: 403 to 422 bp) were constructed as follows: plasmids pli-dCas9-sgRNA-glnAS1, pli-dCas9-sgRNA-glnAS2, and pli-dCas9-sgRNA-glnAS3. Figure 1 As shown (for simplicity, the plasmids pli-dCas9-sgRNA-glnAS1, pli-dCas9-sgRNA-glnAS2, and pli-dCas9-sgRNA-glnAS3 are named plasmids pli-glnAS1, pli-glnAS2, and pli-glnAS3, respectively) the gene was weakly expressed using CRISPRi technology;
[0079] The three plasmids were mixed with the competent cells of the corresponding strains, and after mixing, they were placed on ice for 30 minutes, and then quickly heat-shocked (42°C, 90s) and then quickly placed on ice, allowed to stand for 2 minutes, and then 1mL of LB liquid culture medium was aseptically added, and the culture was resumed at 37°C, 220rpm for 1 hour to obtain a strain in which the three plasmids can exert an inhibitory effect under normal culture conditions.
[0080] Table 1: Primers and sgRNAs sequences used
[0081]
[0082]
[0083] aspDH gene sequence:
[0084] atgctgaatatcgtcatgatcggctgcggcgccatcggcgccggcgtcctggaactgttggagaacgatccgcaactgag
[0085] ggtcgatgcggtgatcgttcctcgcgactccgagacccaggtccgccatcgcctggccagcctgcgccggccgccgcg
[0086] ggtactcagcgcgctgccggccggagagcgccccgatcttctggtggagtgcgccgggcaccgcgccatcgagcagc
[0087] acgtgctgccggcgctggcccaaggcattccctgcctggtggtctcggtgggcgcgctgtccgagccgggcctggtgga
[0088] gcgcctggaagccgcggcgcaggccggaggcagccgcatcgagctgctgcccggcgccatcggcgccatcgatgcg
[0089] ctgtcggcggccagggtcggtggcctcgaatcggtgcgctacaccgggcgcaagccggcgagcgcctggctgggcac
[0090] gccaggcgagacggtctgcgacctgcagcgcctggagaaggcgcgggtgatcttcgacggcagcgcccgcgaggcg
[0091] gcgcggctctatccgaagaacgccaatgtcgccgccaccctgtcgctcgccggcctcggcctggaccgcacccaggtg
[0092] cgcctgatcgccgaccccgaaagctgcgagaacgtgcaccaggtggaagccagcggcgccttcggcggcttcgaact
[0093] gaccttgcgcggcaaaccgctggcggccaacccgaagacatcggcgctgaccgtgtacagcgtggtccgagcgttgggcaaccacgcccacgcgatttcgatctag(SEQ ID NO:16)
[0094] ectABC gene sequence:
[0095] atgaacgcaaccacagagccctttacaccctccgccgacctggccaagcccagcgtggccgatgccgtggtcggccatg
[0096] aggcctcaccgctcttcatccgcaagccaagccccgatgacggctggggcatctacgagctggtcaagtcctgtccgcct
[0097] ctcgacgtcaattccgcctacgcctatctgttgctggccacccagttccgcgatagctgcgccgtggcgaccaacgaaga
[0098] gggcgagatcgtcggcttcgtttccggctacgtgaagagcaacgcccccgatacctatttcctctggcaggttgccgtggg
[0099] cgagaaggcacgtggcaccggcctggcccgtcgtctggtggaagccgtgatgacacgcccggaaatggccgaggtcc
[0100] accatctcgagaccactatcacgcccgacaaccaggcgtcctggggcttgttccgccgtctcgccgatcgctggcaggc
[0101] gccgttgaacagccgcgaatacttctccaccgatcaactcggcggtgagcatgacccggaaaacctcgttcgcatcggcc
[0102] cgttccagaccgaccagatctgagccgggacgccgcctggccggcccggtacgggccggcaacccgtcttttcgttttat
[0103] cactttccccccacaggaggtcgcaatgcagacccagattctcgaacgcatggagtccgacgttcggacctactcccgct
[0104] ccttcccggtcgtcttcaccaaggcgcgcaatgcccgcctgaccgacgaggaagggcgcgagtacatcgacttcctggc
[0105] cggtgccggcaccctgaactacggccacaacaacccgcacctcaagcaggcgctgctcgactatatcgacagcgacgg
[0106] catcgtccacggcctggacttctggactgcggccaagcgcgactatctggaaaccctggaagaggtgatcctcaagccg
[0107] cgcggtctcgactacaaggtgcatctgcccggaccgactggcaccaacgccgtcgaggcggccattcgcctggcccgg
[0108] gtcgccaaggggcgccacaatatcgtctccttcaccaacggctttcatggcgtcaccatgggcgcgctggcgaccaccg
[0109] gtaaccgcaagttccgcgaggccaccggtggcgtgccgacccaggctgcttccttcatgccgttcgatggctacctcggc
[0110] agcagcaccgacaccctcgactacttcgagaagctgctcggcgacaagtccggcggcctggacgtgcccgcggcggt
[0111] gatcgtcgagacagtgcagggcgagggcggtatcaatgtcgccggcctggagtggctcaagcgcctcgagagcatctg
[0112] ccgcgccaatgacatcctgctgatcatcgacgacatccaggcgggctgcggccggaccggcaagttcttcagcttcgag
[0113] catgccggcatcacgccggatatcgtgaccaactccaagtcgctgtccggttacggcctgccgttcgctcacgtcctgatg
[0114] cgccccgagctcgacaagtggaagcccggtcagtacaacggcaccttccgcggcttcaacctggctttcgccactgctgc
[0115] tgccgccatgcgcaagtactggagcgacgacaccttcgagcgtgacgtgcagcgcaaggctcgcatcgtcgaggaacg
[0116] cttcggcaagatcgccgcctggctgagcgagaacggcatcgaggcctccgagcgcggccgcgggctgatgcggggc
[0117] atcgacgtgggttccggcgatatcgccgacaagatcacccaccaagccttcgagaacgggttgatcatcgaaaccagcg
[0118] gtcaggacggcgaagtggtcaagtgcctgtgcccgctgaccattcccgacgaagacctggtcgagggactcgacatcct
[0119] cgagaccagcaccaagcaggcctttagctgatcgcctgaggtgcgccatcgggcctgtccatggcatcctgtatcggtcg
[0120] gccgtgcgcggccggccagtcattgattcactggagaatcgacatgatcgttcgcaatctcgaagaagcgcgccagacc
[0121] gaccgtctggtcaccgccgaaaacggcaactgggacagcacccgcctgtcgctggccgaagatggtggcaactgctcc
[0122] ttccacatcacccgcatcttcgagggtaccgagacccacatccactataagcatcacttcgaggctgtttattgcatcgaagg
[0123] cgagggcgaagtggaaaccctggccgatggcaagatctggcccatcaagccgggtgacatctacatcctcgaccagca
[0124] cgacgagcacctgctgcgcgccagcaagaccatgcacctggcctgcgtgttcacgccgggcctgaccggcaacgaagtgcaccgcgaagacggttcctacgcacctgccgacgaagccgacgaccagaagccgctgtaa (SEQ ID NO: 17).
[0125] S8, the obtained plasmid pRSF-ectABC was mixed with E. coli BL21 (DE3) competent cells and placed on ice for 30 min, then quickly heat-shocked (42°C, 90 s) and then quickly placed on ice, allowed to stand for 2 min, and then 1 mL of LB liquid culture medium was aseptically added, and cultured at 37°C, 220 rpm for 1 h to obtain strain ect01;
[0126] S9. According to the method of step S8, the following plasmids are transformed into the strain ect01 obtained in step S8: pET-aspDH-gdhA, pET-aspDH-rocG, pET-aspDH-gltB, pET-aspDH-gdhA-gltB, pET-aspDH-rocG-gltB, pET-aspC-gdhA, pET-aspC-rocG, pET-aspC-gltB, pET-aspC-gdhA-gltB, pET-aspC-rocG-gltB, to obtain strains ect02, ect03, ect04, ect05, ect06, ect07, ect08, ect09, ect10, ect11, respectively;
[0127] S10, respectively transferring the plasmids pli-glnAS1, pli-glnAS2 and pli-glnAS3 from step S7 into the ect05 strain to obtain ect0501, ect0502 and ect0503 strains;
[0128] S11, respectively transferring the plasmids pli-glnAS1, pli-glnAS2 and pli-glnAS3 from step S7 into the ect06 strain to obtain ect0601, ect0602 and ect0603 strains;
[0129] S12, respectively transferring the plasmids pli-glnAS1, pli-glnAS2 and pli-glnAS3 from step S7 into the ect10 strain to obtain ect1001, ect1002 and ect1003 strains;
[0130] S13. The plasmids pli-glnAS1, pli-glnAS2 and pli-glnAS3 in step S7 are respectively transformed into the ect11 strain to obtain ect1101, ect1102 and ect1103 strains.
[0131] Table 2: Strains and plasmids they contain
[0132]
[0133]
[0134] S14. Fermentation verification of the above strains:
[0135] Shake flask fermentation medium: yeast extract 2g / L, KH2PO4 3g / L, Na2HPO4·12H2O 25g / L, (NH4)2SO4 16g / L, MgSO4·7H2O 1g / L, D-glucose 20g / L, trace element solution 1 ml, biotin 0.1mg;
[0136] Fermentation culture: Inoculate the seed culture into batch fermentation medium at a 20% inoculation rate, add 1 mL of trace elements, culture at 35-39°C for 5-7 h, rotate at 220 rpm, add 150 uL of 0.2 mmol / L IPTG and induce culture at 35-39°C.
[0137] 5L tank fermentation medium: yeast extract 10g / L, peptone 5g / L, Na2HPO4·12H2O 25g / L, KH2PO42g / L, citric acid 2g / L, NaCl 1g / L, MgSO4·7H2O 1g / L, biotin 0.1mg, D-glucose 25g / L, trace element solution 1 ml;
[0138] Trace elements: ammonium ferric citrate 5.6g / L, zinc sulfate heptahydrate 0.9g / L, CoCl2·6H2O 0.2g / L, manganese chloride tetrahydrate 1.0g / L, CuCl2·2H2O 0.10g / L, boric acid 0.2g / L, Na2MoO4·2H2O 0.2g / L;
[0139] Fermentation tank culture: Inoculate the seed culture into a batch-fed fermentation tank at a 20% inoculation rate, culture at 37°C for 5-7 hours, add 3ml of 0.2mmol / L IPTG to induce culture at 37°C, control the pH value to 7.0, control the dissolved oxygen content to 20-40%, and the rotation speed is related to the dissolved oxygen. The fermentation results are shown in the following table:
[0140] Table 3: Ectohydropyrimidine (ECT) production of different strains
[0141]
[0142]
[0143] As shown in Table 3, the yield of strain ect01 is lower than that of bacteria ect02~ect01103. This is because there is only a plasmid expressing ECT in bacteria ect01, and the aspartate metabolic pathway is not enhanced. Among strains ect02~ect04, strain ect03 has the highest yield, which shows that on the basis of also enhancing the aspartate metabolic pathway, the glutamate metabolic pathway also has a significant effect on the yield of ECT, and different enzymes in the metabolic pathway also affect the yield of ECT. Although the glutamate dehydrogenase gene gdhA and the glutamate dehydrogenase gene rocG both catalyze the conversion of α-ketoglutarate into glutamate, and the glutamate synthase gene gltB catalyzes the conversion of glutamine into glutamate, these three enzyme genes all regulate the metabolic pathway of glutamate, but after comparison, it was found that the glutamate dehydrogenase gene rocG from Bacillus subtilis has a better metabolic effect on glutamate (comparing strain ect03 with ect02 and ect04), which further affects the yield of ECT.
[0144] In strains ect07-ect09, the aspartate dehydrogenase gene aspDH from Pseudomonas aeruginosa was replaced with the aspartate dehydrogenase gene aspC from Escherichia coli. Although both are intermediate enzymes in the metabolic pathway that regulate aspartate, it was found that the aspDH gene from Pseudomonas aeruginosa was more conducive to increasing the yield of ECT than the aspC gene from Escherichia coli (comparing strains ect02-ect04 with ect07-ect09). Therefore, the aspDH gene from Pseudomonas aeruginosa was selected as the gene that regulates aspartate, and the rocG gene from Bacillus subtilis was selected as the gene that regulates glutamate metabolism, thereby forming the plasmid pET-aspDH-rocG.
[0145] The strains ect05, ect06, ect10, and ect11 were compared with ect02, ect03, ect07, and ect08, respectively, and it was found that the former had a higher ability to produce ECT than the latter. This is because the former has added the glutamate synthase gene gltB on the basis of the latter, which can convert the glutamine produced in the bacteria into glutamate, increase the glutamate production, and thus further help to increase the production of ECT. Therefore, the plasmid pET-aspDH-rocG-gltB was formed on the basis of the aforementioned plasmid pET-aspDH-rocG.
[0146] Comparing strains ect05 with ect0501-ect0503, ect06 with ect0601-ect0603, ect10 with ect1001-ect1003, and ect11 with ect1101-ect1103, it was found that ectX01-ectX03 had a stronger ability to produce ECT than ectX. This was because pli-glnAS1-pli-glnAS3 plasmids were also transformed into ectX01-ectX03 bacteria, respectively, in order to reduce the expression of the glutamine ligase gene glnA, weaken the metabolic pathway of glutamate conversion to glutamine, prevent glutamate from being converted to glutamine, and increase glutamate production, which is beneficial to increasing the production of ECT. Therefore, the simultaneous presence of plasmids pET-aspDH-rocG-gltB and pli-glnASX in bacteria can improve the ability of bacteria to produce ECT.
[0147] Among the strains ect0501-ect0503, ect0601-ect0603, ect1001-ect1003, and ect1101-ect1103, ect0503 was better than ect0501 and ect0502, ect0603 was better than ect0601 and ect0602, ect1003 was better than ect1001 and ect1002, and ect1103 was better than ect1101 and ect1102. It was found that ectX03 had a stronger ability to produce ECT than ectX01 and ectX02. This indicates that the silencing site designed for the aminoamide ligase gene glnA has the most obvious effect of silencing glnAS3:403-422bp.
[0148] The present invention strengthens the regulation of the metabolic pathway of α-ketoglutarate to glutamate by glutamate dehydrogenase gene, strengthens the regulation of the metabolic pathway of glutamine to glutamate by glutamate synthase gene, reduces the regulation of the metabolic pathway of glutamate to glutamine by glutamine ligase gene, increases the content of glutamate in cells, provides a continuous supply of glutamate for the metabolic pathway of oxaloacetate to aspartate and the metabolic pathway of aspartate-β-semialdehyde to 2,4-diaminobutyrate, and then increases the ECT yield by strengthening the regulation of the metabolic pathway of oxaloacetate to aspartate by aspartate dehydrogenase gene. The present invention achieves not only the increase of the yield of cell ECT by regulating the metabolic pathway of glutamate in cells, but also does not affect the demand of cells for glutamate for their own growth.
[0149] Example 5 Fermentation Verification
[0150] The strain ect0603 obtained in Example 1 (containing plasmids pRSF-ectABC, pET-aspDH-rocG-gltB and pli-glnAS3) was fermented in a 5L fermenter:
[0151] Fermentation medium: yeast extract 10g / L, peptone 5g / L, Na2HPO4·12H2O 25g / L, KH2PO4 2g / L, citric acid 2g / L, NaCl 1g / L, MgSO4·7H2O 1g / L, biotin 0.1mg, D-glucose 25g / L, trace element solution 1ml;
[0152] Trace elements: ammonium ferric citrate 5.6g / L, zinc sulfate heptahydrate 0.9g / L, CoCl2·6H2O 0.2g / L, manganese chloride tetrahydrate 1.0g / L, CuCl2·2H2O 0.10g / L, boric acid 0.2g / L, Na2MoO4·2H2O 0.2g / L;
[0153] Fermentation tank culture: Inoculate the seed culture into a batch-fed fermentation tank at a 20% inoculation rate, culture at 37°C for 5-7 hours, add 3ml of 0.2mmol / L IPTG to induce culture at 37°C, control pH 7.0, control dissolved oxygen content at 20-40%, and correlate the rotation speed with dissolved oxygen. The fermentation results are as follows:
[0154] Table 4: Fermentation results of strain ect0603
[0155] Strain number ECT yield (g / L) ect0603 68.7
[0156] As shown in Table 4, the strain ect0603 was verified for its relatively high-yield ectoine production in a 5 L tank fermentation, and its ectoine production reached 68.7 g / L after 60 h of fermentation.
[0157] Microorganisms with Escherichia coli as hosts can synthesize ectoine with glucose as substrate under low salt conditions. Two key metabolic nodes are involved in this path, namely the metabolic pathway from oxaloacetate to aspartate and the metabolic pathway from aspartate-β-semialdehyde to 2,4-diaminobutyric acid, which are catalyzed by aspartate dehydrogenase AspC or / and AspDH, and 2,4-diaminobutyrate transaminase EctB, respectively, and both catalytic processes require the participation of glutamate. The metabolism of glutamate is often ignored when regulating the metabolic pathway of ectoine, and glutamate, as a reaction substrate at the key metabolic node of ectoine, is of great significance to the construction of metabolic pathways. Therefore, the present invention improves the glutamate metabolic flux by regulating the metabolism of tricarboxylic acid (TCA) cycle, which not only satisfies the consumption of glutamate in the metabolic process of ectoine, but also increases the yield of ectoine, and also achieves that the glutamate required for the self-supply of the thalline is satisfied while not affecting the metabolic flux of ectoine, and can further improve the growth of the thalline.
Claims
1. An expression vector, characterized in that: The expression vector comprises an aspartate dehydrogenase gene fragment, a glutamate dehydrogenase gene fragment and a glutamate synthase gene fragment.
2. The expression vector according to claim 1, characterized in that The vector uses a dual-promoter plasmid as a backbone, and the aspartate dehydrogenase gene fragment, the glutamate dehydrogenase gene fragment and the glutamate synthase gene fragment are connected in series on the dual-promoter plasmid, wherein the aspartate dehydrogenase gene fragment is connected to the back of the first promoter of the plasmid dual promoter, the glutamate dehydrogenase gene is connected to the back of the second promoter of the plasmid dual promoter, and the glutamate synthase gene fragment is connected between the NcoI and BamHI sites of the dual-promoter plasmid.
3. The expression vector according to claim 2, characterized in that The aspartate dehydrogenase gene is the aspDH gene from Pseudomonas aeruginosa or the aspC gene from Escherichia coli, the glutamate dehydrogenase gene is the rocG gene from Bacillus subtilis or the gdhA gene from Escherichia coli, and the glutamate synthase gene is the gltB gene from Escherichia coli.
4. The expression vector according to claim 3, characterized in that The sequence of the aspDH gene is shown in SEQ ID NO: 16; the Gene ID of the aspC gene is 945553; the Gene ID of the rocG gene is 937066; the Gene ID of the gdhA gene is 946802; and the Gene ID of the gltB gene is 947724.
5. The expression vector according to claim 4, characterized in that The aspartate dehydrogenase gene is the aspDH gene derived from Pseudomonas aeruginosa, and the glutamate dehydrogenase gene is the rocG gene derived from Bacillus subtilis.
6. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria overexpresses the gene cluster ectABC, overexpresses the aspartate dehydrogenase gene, overexpresses the glutamate dehydrogenase gene and overexpresses the glutamate synthase gene, and weakly expresses the glutamine ligase gene.
7. The genetically engineered bacterium according to claim 6, characterized in that The gene cluster ectABC is overexpressed by a plasmid; the aspartate dehydrogenase gene, glutamate dehydrogenase gene and glutamate synthase gene are overexpressed by a plasmid or genome integration method, and the glutamine ligase gene is weakly expressed by a CRISPRi gene editing method.
8. The genetically engineered bacterium according to claim 7, characterized in that: The CRISPRi gene editing method weakly expresses the glutamine ligase gene as follows: S1. Designing sgRNAs sequences for the glutamine ligase gene glnA, wherein the sgRNAs sequences are any of those shown in SEQ ID NOs: 13 to 15; S2. Use BsaI to cut the plasmid pli-dCas9-sgRNA to linearize it, and then connect it to the sgRNAs sequence fragment to obtain the plasmid pli-dCas9-sgRNA-glnAS.
9. A method for constructing a genetically engineered bacterium according to any one of claims 6 to 8, characterized in that: The steps include: S1. Integrate the gene cluster ectABC into the plasmid to obtain a plasmid expressing ectABC; S2. Connecting the aspartate dehydrogenase gene fragment to the first T7 promoter of the dual promoter plasmid by homologous recombination technology to obtain plasmid A; S3. Connect the glutamate dehydrogenase gene fragment to the second T7 promoter of plasmid A by homologous recombination technology to obtain plasmid B; S4. Connecting the glutamate synthase gene fragment to plasmid B by homologous recombination technology to obtain plasmid C; S5. constructing a plasmid for weakly expressing a glutamine ligase gene, wherein the plasmid comprises a sgRNAs sequence, and the sgRNAs sequence is shown in any one of SEQ ID NOs: 13 to 15; S6. Transforming the plasmid of step S1, the plasmid of step S4 and the plasmid of step S5 into host cells, culturing the host cells in a liquid culture medium, and obtaining the genetically engineered bacteria.
10. Use of the expression vector according to any one of claims 1 to 5 or the genetically engineered bacteria according to any one of claims 6 to 8 in the preparation of ectoine.