Escherichia coli gene modification method for improving plasmid superhelix monomer proportion, product and application thereof

Abstract

The invention provides an Escherichia coli gene modification method for improving the proportion of plasmid superhelix monomers and a product and application thereof, the method comprises the following steps: knocking out two DNA sequences in a genome of host Escherichia coli by adopting a CRISPR / Cas9 gene editing system, the DNA sequences comprising a recA + gene coding sequence and a recF + gene coding sequence; the nucleotide sequence from the 5'end to the 3 'end of the recA + gene coding sequence is as shown in SEQ ID NO.1, and the nucleotide sequence from the 5' end to the 3 'end of the recF + gene coding sequence is as shown in SEQ ID NO.2. When the escherichia coli engineering strain prepared by the method is used for producing plasmids, the generation of plasmid polymers can be remarkably reduced, and the superhelix monomer proportion of the plasmids can be increased.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and specifically relates to a method for genetically modifying Escherichia coli to increase the proportion of supercoiled monomers in a plasmid, and a product and application thereof. Background Art

[0002] When using E. coli for gene synthesis and plasmid fermentation production, plasmid products have multiple configurations: supercoiled, linear and open ring. The supercoiled configuration is the covalent closed ring structure of the double-stranded DNA molecule, the linear configuration is the form formed by the two chains of the plasmid DNA breaking at the same place, and the open ring plasmid DNA is the form in which one of the two chains breaks at one or more places. Under normal circumstances, the supercoiled plasmids account for the majority, and the linear and open ring configurations are the configurations that appear when the supercoiled plasmids are damaged during the production process.

[0003] There are also often some complex, larger molecular weight impurities in plasmid products, which are dimers or polymers of plasmids, which are produced by homologous recombination between supercoiled monomeric plasmids. When supercoiled polymeric plasmids are destroyed by external forces, they will also form linear or open-circular forms of polymers.

[0004] In general, supercoiled monomers are the main part that needs to be obtained in plasmid production. It is considered to be a plasmid form that can most effectively improve transfection efficiency and target gene expression, so the proportion of supercoiled monomer plasmids is an important indicator for measuring plasmid quality. In the study of gene therapy and DNA vaccines, regulatory agencies have made clear guidance and suggestions on the supercoiled content of pharmaceutical plasmids. When developing gene therapy products, some research institutions and companies will also make clear requirements for the proportion of supercoiled monomers in plasmids to ensure that they have good transformation and expression efficiency. However, the appearance of plasmid aggregates will greatly affect the proportion of plasmid supercoiled monomers, especially plasmids with multiple copies or containing repetitive sequences are more likely to form plasmid aggregates, thereby increasing the difficulty of plasmid production. When plasmid products are produced industrially, the proportion of supercoiled monomers is detected by agarose gel electrophoresis and high-performance liquid chromatography analysis to test the quality of the products.

[0005] How to reduce the generation of plasmid aggregates has always been a technical problem that needs to be solved in plasmid production. The current technology to solve the problem of plasmid aggregates is mainly focused on the modification of E. coli strains. The current mainstream view is that homologous recombination between identical sequences is the main cause of plasmid aggregates, so reducing the probability of homologous recombination can reduce the generation of plasmid aggregates. The existing commercial strains of E. coli are mainly modified to increase the proportion of supercoiled monomers by modifying the recA gene encoding the recombinase. +The gene undergoes point mutations to reduce its activity and reduce the formation of plasmid aggregates. E. coli strains commonly used in plasmid production, such as DH5a, Top10, JM108 and DH10B, contain the recA1 mutation, that is, the glycine at position 160 in the amino acid sequence is mutated to aspartic acid; the mutant form of strains such as HB101 and Stbl3 is called recA13, that is, the leucine at position 51 in the amino acid sequence is replaced by phenylalanine.

[0006] However, the recA1 and recA13 mutations, which can theoretically reduce homologous recombination and improve plasmid purity, have limited effectiveness in actual production. It is often the case that the use of commercial strains still results in poor plasmid morphology and the proportion of supercoiled monomers cannot meet delivery standards.

[0007] The disadvantage of the prior art is that the inhibitory effect on polymer formation is limited during the production of some plasmids. In actual production, when using recA1 or recA13 mutant strains to produce polyadenosine (polyA), antibodies, lentiviruses, antibody variable regions, and even common pUC plasmids, there will still be too many plasmid polymers. Therefore, improving the existing strains, optimizing the existing problem of too many polymers, and providing a method for genetic modification of Escherichia coli have important application value in plasmid production. Summary of the invention

[0008] In view of the shortcomings of the prior art, the purpose of the present invention is to provide a method for genetic modification of Escherichia coli for increasing the ratio of supercoiled monomers in plasmids, and its products and applications. The present invention improves the existing strains, optimizes the existing problem of excessive polymers, and provides a method for genetic modification of Escherichia coli, which can significantly reduce the generation of plasmid polymers and increase the ratio of supercoiled monomers in plasmids.

[0009] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0010] In a first aspect, the present invention provides a method for genetically modifying Escherichia coli to increase the ratio of supercoiled monomers in a plasmid, the method comprising:

[0011] The CRISPR / Cas9 gene editing system was used to knock out two DNA sequences in the genome of the host Escherichia coli, including recA + Gene coding sequence and recF + Gene coding sequence;

[0012] The recA + The nucleotide sequence from the 5' end to the 3' end of the gene coding sequence is shown in SEQ ID NO.1;

[0013] The recF +The nucleotide sequence from the 5' end to the 3' end of the gene coding sequence is shown in SEQ ID NO.2.

[0014] In the present invention, the host Escherichia coli includes commonly used Escherichia coli such as engineered strains DH5a, Stable3 or Top10.

[0015] In the present invention, two DNA sequences in the genome of the recombinant Escherichia coli engineering strain are simultaneously knocked out at the genome level. After the two genes are simultaneously knocked out, the generation of plasmid aggregates can be reduced and the proportion of plasmid supercoil monomers can be increased.

[0016] In the present invention, recA + The gene encodes the key recombinase RecA involved in the process of homologous recombination of DNA. When homologous recombination occurs between DNA, double-stranded DNA breaks first, and then the exonuclease digests one of the DNA single strands from the 5' end to the 3' end, forming a single-stranded DNA section at a time. The recombinase RecA binds to single-stranded DNA to form a protein-DNA filamentous complex and looks for homologous double-stranded DNA as a template for break repair.

[0017] In the present invention, recF + The gene encodes the recombinase RecF, which can not only catalyze the assembly of RecA protein on single-stranded DNA, but also interact with other Rec proteins to help initiate the homologous recombination process. Depending on the different DNA substrates in homologous recombination, the pathways that cause double-stranded DNA breaks are different. When homologous recombination occurs in plasmids as DNA substrates, the RecF pathway is mainly followed.

[0018] In the present invention, recA is used + and recF + The plasmid production of E. coli strains with simultaneous knockout of gene coding sequences can effectively reduce the generation of plasmid aggregates and increase the proportion of supercoiled monomeric plasmids, which is better than knocking out only recA + Various commercial E. coli strains engineered with point mutations.

[0019] Preferably, the CRISPR / Cas9 gene editing system comprises: sgRNA, homologous recombination sequence and Cas9.

[0020] Preferably, the homologous recombination sequence comprises recA + Gene coding sequence or recF + Upstream and downstream homology arms required for knockout of gene coding sequence.

[0021] Preferably, the length of the upstream and downstream homology arms is independently 400-600 bp, preferably 450-550 bp, for example, 400 bp, 420 bp, 440 bp, 450 bp, 460 bp, 480 bp, 500 bp, 520 bp, 540 bp, 550 bp, 560 bp, 580 bp or 600 bp, etc.

[0022] Preferably, the Cas9 is expressed from a pEcCas9 plasmid.

[0023] Preferably, the sgRNA includes sgRNA1 or sgRNA2; the target DNA sequence of the sgRNA1 is shown as SEQ ID NO.25, and the target DNA sequence of the sgRNA2 is shown as SEQ ID NO.26.

[0024] In the present invention, the homology arms are sequences located upstream and downstream of the knocked-out part on the genome, and are designed based on the sequence of the knocked-out part.

[0025] In the present invention, the recA + The upstream homology arms required for knocking out the gene coding sequence include those shown in SEQ ID NO.3.

[0026] In the present invention, the recA + The downstream homology arms required for knocking out the gene coding sequence include those shown in SEQ ID NO.6.

[0027] In the present invention, the recF + The upstream homology arms required for knocking out the gene coding sequence include those shown in SEQ ID NO.15.

[0028] In the present invention, the recF + The downstream homology arms required for knocking out the gene coding sequence include those shown in SEQ ID NO.18.

[0029] Preferably, the homologous recombination sequence, the targeting sgRNA sequence and the linearized pTarget-Blue plasmid vector are connected to obtain a homologous recombination plasmid.

[0030] Preferably, knocking out recA + The homologous recombination plasmid of the gene coding sequence is composed of homologous recombination sequences A, recA + The targeting sgRNA sequence was connected to the linearized pTarget-Blue plasmid vector.

[0031] Preferably, the homologous recombination sequence A is obtained by connecting SEQ ID NO.3 and SEQ ID NO.6 in sequence according to the upstream and downstream positions.

[0032] Preferably, the recA + The targeting sgRNA sequence is obtained by sequentially connecting a promoter for initiating sgRNA transcription, a target DNA sequence SEQ ID NO.25 of sgRNA1, and a gRNA backbone sequence.

[0033] Preferably, the recA + The targeting sgRNA sequence includes that shown in SEQ ID NO.9.

[0034] Preferably, knocking out recF + The homologous recombination plasmid of the gene coding sequence is composed of homologous recombination sequence B, recF + The targeting sgRNA sequence was connected to the linearized pTarget-Blue plasmid vector.

[0035] Preferably, the homologous recombination sequence B is obtained by connecting SEQ ID NO.15 and SEQ ID NO.18 in sequence according to the upstream and downstream positions.

[0036] Preferably, the recF + The targeting sgRNA sequence is obtained by sequentially connecting the promoter that initiates sgRNA transcription, the target DNA sequence SEQ ID NO.26 of sgRNA2, and the gRNA backbone sequence.

[0037] Preferably, the recF + The targeting sgRNA sequence includes that shown in SEQ ID NO.21.

[0038] Preferably, the linearized pTarget-Blue plasmid vector comprises SEQ ID NO.14.

[0039] Preferably, the Escherichia coli gene modification method for increasing the proportion of supercoiled monomers in a plasmid comprises:

[0040] Knockout of recA + The homologous recombination plasmid of the gene coding sequence was transfected into competent cells containing the pEcCas9 plasmid, and recA was verified by colony PCR after culture. + Whether the gene coding sequence is knocked out; cultivate the correct strain and eliminate the knocked-out recA + Homologous recombination plasmid of gene coding sequence was obtained + Gene coding sequence knockout cells;

[0041] Knockout of recF + Homologous recombination plasmids containing gene coding sequences were transfected into recA + In competent cells of gene coding sequence knockout cells, recF was verified by colony PCR after culture.+ Whether the gene coding sequence is knocked out; cultivate the correct strain and eliminate the knocked-out recF + Homologous recombination plasmid of gene coding sequence, and then elimination of pEcCas9 plasmid to obtain recA + and recF + Gene coding sequence double knockout cells.

[0042] In a second aspect, the present invention provides a recombinant Escherichia coli, which is prepared by the Escherichia coli gene modification method for increasing the ratio of supercoiled monomers of a plasmid as described in the first aspect.

[0043] In a third aspect, the present invention provides an sgRNA, wherein the sgRNA includes sgRNA1 or sgRNA2; the target DNA sequence of the sgRNA1 is shown as SEQ ID NO.25, and the target DNA sequence of the sgRNA2 is shown as SEQ ID NO.26.

[0044] In a fourth aspect, the present invention provides a recombinant plasmid, wherein the recombinant plasmid is obtained by connecting a homologous recombination sequence, a targeting sgRNA sequence and a linearized pTarget-Blue plasmid vector; the targeting sgRNA sequence is obtained by connecting a promoter that initiates sgRNA transcription, the target DNA sequence of the sgRNA described in the third aspect, and a gRNA backbone sequence in sequence.

[0045] Preferably, the recombinant plasmid comprises: knocking out recA + Homologous recombination plasmids or knockout recF + Homologous recombination plasmids containing gene coding sequences.

[0046] Preferably, the knockout of recA + The homologous recombination plasmid of the gene coding sequence is composed of homologous recombination sequences A, recA + The targeting sgRNA sequence was connected to the linearized pTarget-Blue plasmid vector.

[0047] Preferably, the homologous recombination sequence A is obtained by connecting SEQ ID NO.3 and SEQ ID NO.6 in sequence according to the upstream and downstream positions.

[0048] Preferably, the recA + The targeting sgRNA sequence is obtained by sequentially connecting a promoter for initiating sgRNA transcription, a target DNA sequence SEQ ID NO.25 of sgRNA1, and a gRNA backbone sequence.

[0049] Preferably, the recA + The targeting sgRNA sequence includes that shown in SEQ ID NO.9.

[0050] Preferably, the knockout of recF + The homologous recombination plasmid of the gene coding sequence is composed of homologous recombination sequence B, recF + The targeting sgRNA sequence was connected to the linearized pTarget-Blue plasmid vector.

[0051] Preferably, the homologous recombination sequence B is obtained by connecting SEQ ID NO.15 and SEQ ID NO.18 in sequence according to the upstream and downstream positions.

[0052] Preferably, the recF + The targeting sgRNA sequence is obtained by sequentially connecting the promoter that initiates sgRNA transcription, the target DNA sequence SEQ ID NO.26 of sgRNA2, and the gRNA scaffold.

[0053] Preferably, the recF + The targeting sgRNA sequence includes that shown in SEQ ID NO.21.

[0054] Preferably, the linearized pTarget-Blue plasmid vector comprises SEQ ID NO.14.

[0055] In a fifth aspect, the present invention provides a CRISPR / Cas9 gene editing system, which comprises the sgRNA described in the third aspect, the recombinant plasmid described in the fourth aspect, and Cas9.

[0056] In a sixth aspect, the present invention provides the use of any one or a combination of at least two of the Escherichia coli genetic modification method for increasing the proportion of supercoiled monomers of the plasmid described in the first aspect, the sgRNA described in the third aspect, the recombinant plasmid described in the fourth aspect, or the CRISPR / Cas9 gene editing system described in the fifth aspect in Escherichia coli genetic modification.

[0057] The numerical range described in the present invention not only includes the point values ​​listed above, but also includes any point values ​​between the above numerical ranges that are not listed. Due to space limitations and for the sake of simplicity, the present invention no longer exhaustively lists the specific point values ​​included in the range.

[0058] Compared with the prior art, the present invention has the following beneficial effects:

[0059] In the present invention, recA in the genome is simultaneously knocked out. + Gene coding sequence and recF + When the engineered strain of Escherichia coli with the gene coding sequence is used for plasmid production, the generation of plasmid aggregates can be effectively reduced and the proportion of supercoiled monomeric plasmids can be increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 is recA + Schematic diagram of the pTarget-Blue-recA plasmid with gene coding sequence knockout.

[0061] Figure 2 This is a diagram showing the relationship between the composition of the homology arms and the primers (taking recA as an example).

[0062] Figure 3 This is the composition of the sgRNA part and the relationship between primers (taking recA as an example).

[0063] Figure 4 is recF + Schematic diagram of the pTarget-Blue-recF plasmid with gene coding sequence knockout.

[0064] Figure 5 These are the test results of pUC57-HB4329 plasmid in different strains.

[0065] Figure 6 These are the test results of BB29301-15 plasmid in different strains.

[0066] Figure 7 These are the test results of different lentiviral plasmids fermented by the Stable3 strain and the Stable3(recAΔrecFΔ) strain.

[0067] Figure 8 These are the test results of the pUC series plasmids fermented by Top10 strain and Top10(recAΔrecFΔ) strain.

[0068] Fig. 9 These are the test results of antibody variable region plasmids fermented with Top10 strain and Top10(recAΔrecFΔ) strain. DETAILED DESCRIPTION

[0069] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only used to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0070] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0071] The sources of the experimental materials in the following examples are as follows:

[0072] Escherichia coli DH5a strain: Tiangen Biotech CB101.

[0073] Escherichia coli Stable3 strain: Weidi Biotechnology DL1046.

[0074] Example 1

[0075] This embodiment provides a method for genetic modification of Escherichia coli for increasing the proportion of supercoiled monomers in a plasmid, comprising the following steps:

[0076] 1. Construction of pTarget-Blue-recA plasmid

[0077] Construct containing recA + The plasmid pTarget-Blue-recA contains the upstream and downstream homology arms and sgRNA required for knocking out the gene coding sequence.

[0078] 1.1recA + Construction of homology arm sequence fragments required for gene coding sequence knockout

[0079] Amplify recA using the genome of Escherichia coli DH5a as a template + The upstream homology arm gene sequence fragment recA HR-L (500 base pairs) and the downstream homology arm gene sequence fragment recA HR-R (536 base pairs) required for gene coding sequence knockout. On the plasmid, the upstream homology arm gene sequence fragment recA HR-L, the downstream homology arm gene sequence fragment recAHR-R and recA + The targeting sgRNA sequence fragments are arranged in order of upstream and downstream positions, such as Figure 1 shown.

[0080] The sequence of the upstream homology arm gene sequence fragment recA HR-L is shown in SEQ ID NO.3.

[0081] The nucleotide sequence of the upstream primer recA HR-LF used to construct the upstream homology arm gene sequence fragment recA HR-L is shown in SEQ ID NO.4, wherein the bold portion is the sequence contained in the vector pTarget-Blue; the nucleotide sequence of the downstream primer recA HR-LR is shown in SEQ ID NO.5.

[0082] SEQ ID NO. 4: gctggccttttgctcacgattgccgagtcttgtaccggtg.

[0083] The downstream homology arm gene sequence fragment recA HR-R is shown as SEQ ID NO.6.

[0084] The nucleotide sequence of the upstream primer recA HR-RF used to construct the downstream homology arm gene sequence fragment recA HR-R is shown in SEQ ID NO.7; the nucleotide sequence of the downstream primer recA HR-RR is shown in SEQ ID NO.8. The relationship between the composition of the homology arm and the primer is shown in Figure 2 shown.

[0085] 1.2recA + Preparation of targeting sgRNA sequence fragments

[0086] recA + The nucleotide sequence of the targeting sgRNA is shown in SEQ ID NO.9.

[0087] SEQ ID NO.9:

[0088] gacttgacaatggacgacatcgagcgtactgtgcacggtcgtctcgacatccgtcgtatgttttagagctagaa atagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc.

[0089] SEQ ID NO. 25: cgtctcgacatccgtcgtat.

[0090] In recA + In the targeting sgRNA sequence, the bold part is recA + The specific N20 sequence required for knocking out the gene coding sequence. The upstream part of the N20 sequence is the promoter that initiates sgRNA transcription, and the downstream part is the gRNA scaffold. These two parts of the sequence are fixed.

[0091] recA + The targeting sgRNA sequence fragment was prepared by a two-step PCR method, and the primer recA sgRNA.1F used was shown in SEQ ID NO.10; the primer recA sgRNA.2R was shown in SEQ ID NO.11; the primer recA sgRNA.3F was shown in SEQ ID NO.12; and the primer recA sgRNA.4R was shown in SEQ ID NO.13.

[0092] SEQ ID NO.13:

[0093] gggtgggcctttctgcggatgccaaaaaaagcaccgactcggtgccactttttcaagttgataacgg.

[0094] The first step of the two-step PCR method is to construct the fragment recA sgRNA.A using primers recA sgRNA.1F and primer recA sgRNA.2R; and construct the fragment recA sgRNA.B using primers recA sgRNA.3F and primer recA sgRNA.4R. The second step of PCR is to use the fragments recA sgRNA.A and recA sgRNA.B as DNA templates, and use primers recA sgRNA.1F and primer recA sgRNA.4R to prepare the fragment recA + Targeting sgRNA sequence fragment. The composition of the sgRNA part and the relationship between the primers are as follows Figure 3 shown.

[0095] 1.3 Linearization of vector plasmid pTarget-Blue

[0096] The pTarget-Blue vector plasmid was linearized using EcoRV restriction endonuclease. The nucleotide sequence of the pTarget-Blue plasmid is shown in SEQ ID NO.14.

[0097] 1.4 Homologous recombination fragment assembly

[0098] The upstream homology arm gene sequence fragment recA HR-L, the downstream homology arm gene sequence fragment recA HR-R and recA + The targeted sgRNA sequence fragment was assembled into the linearized pTarget-Blue plasmid vector to construct the pTarget-Blue-recA plasmid. The inserted sequence was confirmed by PCR and Sanger sequencing.

[0099] 2. Construction of pTarget-Blue-recF plasmid

[0100] According to the above method in 1, construct a + The plasmid pTarget-Blue-recF contains the upstream and downstream homology arms and sgRNA required for gene knockout.

[0101] 2.1recF + Construction of homology arm sequence fragments required for gene coding sequence knockout

[0102] Using the genome of E. coli DH5a as a template to amplify recF +The upstream homology arm gene sequence fragment recF HR-L (545 base pairs) and the downstream homology arm gene sequence fragment recF HR-R (561 base pairs) required for gene coding sequence knockout. As with the pTarget-Blue recA plasmid mentioned above, the upstream homology arm gene sequence fragment recF HR-L, the downstream homology arm gene sequence fragment recF HR-R and the recF + The targeting sgRNA sequence fragments are arranged in order of upstream and downstream positions, such as Figure 4 shown.

[0103] The sequence of the upstream homology arm gene sequence fragment recF HR-L is shown in SEQ ID NO.15.

[0104] The nucleotide sequence of the upstream primer recF HR-LF used to construct the upstream homology arm gene sequence fragment is shown in SEQ ID NO.16, wherein the bold portion is the sequence contained in the vector pTarget-Blue; the nucleotide sequence of the downstream primer recF HR-LR is shown in SEQ ID NO.17.

[0105] SEQ ID NO. 16: gctggccttttgctcacgataatctttgccaagccattcg.

[0106] The downstream homology arm gene sequence fragment recF HR-R is shown as SEQ ID NO.18.

[0107] The nucleotide sequence of the upstream primer recF HR-RF used to construct the downstream homology arm gene sequence fragment is shown in SEQ ID NO.19; the nucleotide sequence of the downstream primer recF HR-RR is shown in SEQ ID NO.20, wherein the bold part is recF + Targeting sequence contained in sgRNA sequence.

[0108] SEQ ID NO. 20: atgtcgtccattgtcaagtcttggtgaaggtttcgaggct.

[0109] 2.2recF + Preparation of targeting sgRNA sequence fragments

[0110] recF + The nucleotide sequence of the targeting sgRNA portion is shown in SEQ ID NO.21.

[0111] SEQ ID NO.21:

[0112] gacttgacaatggacgacatcgagcgtactgtgcacggtttacgaacagctacgcccgtgttttagagctaga aatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc.

[0113] SEQ ID NO. 26: ttacgaacagctacgcccgt.

[0114] In recF + In the targeting sgRNA sequence, the bold part is recF + The specific N20 sequence required for knocking out the gene coding sequence. The upstream part of the N20 sequence is the promoter that initiates sgRNA transcription, and the downstream part is the gRNA backbone sequence. These two parts of the sequence are fixed.

[0115] recF + The targeting sgRNA sequence fragment was prepared by a two-step PCR method. The primer recF sgRNA.1F used was shown in SEQ ID NO.22, wherein the bold portion was the sequence contained in the recF HR-R homology arm; the primer recF sgRNA.2R was shown in SEQ ID NO.23; the primer recF sgRNA.3F was shown in SEQ ID NO.24; the primer recF sgRNA.4R was shown in SEQ ID NO.13, wherein the bold portion was the sequence contained in the vector pTarget-Blue.

[0116] SEQ ID NO.22:

[0117] agcctcgaaaccttcaccaagacttgacaatggacgacatcgagcgtactgtgcacacgg.

[0118] SEQ ID No.13:

[0119] gggtgggcctttctgcggatgccaaaaaaagcaccgactcggtgccactttttcaagttgataacgg.

[0120] The first step of the two-step PCR method is to use primers recF sgRNA.1F and primers recF sgRNA.2R to construct fragment recF sgRNA.A; primers recF sgRNA.3F and primers recF sgRNA.4R are used to construct fragment recF sgRNA.B. The second step of PCR is to use fragments recF sgRNA.A and recF sgRNA.B as DNA templates, and use primers recF sgRNA.1F and primers recF sgRNA.4R to prepare recF + Targeting sgRNA sequence fragment.

[0121] 2.3 Homologous recombination fragment assembly

[0122] The upstream homology arm gene sequence fragment recF HR-L, the downstream homology arm gene sequence fragment recF HR-R and recF + The targeted sgRNA sequence fragments were assembled into the linearized pTarget-Blue plasmid vector to construct the pTarget-Blue-recF plasmid. The inserted sequence was confirmed by PCR and sequencing.

[0123] 3. Preparation of pEcCas electroporated competent cells

[0124] The pEcCas plasmid expressing Cas9 protein was introduced into the host E. coli DH5a cells by transfection. A single colony was selected and inoculated into LB medium supplemented with kanamycin resistance. After overnight culture at 37°C for about 18 hours, it was transferred to LB medium supplemented with kanamycin at a volume of 1% and arabinose was added at a final concentration of 10 mM to induce the expression of the recombinase. The cells were cultured at 37°C until OD 600 When the absorbance at 600 nm (absorbance at a wavelength of 600 nm) is about 0.6, the bacterial solution is treated with an ice bath for 40 minutes, and the bacterial cells are collected by centrifugation at 4000 rpm for 15 minutes at 4°C. The bacterial cells are washed once with sterile water that has been treated with an ice bath, and then washed twice with a sterile 10% glycerol aqueous solution that has been treated with an ice bath. The solution is concentrated 100 times and then dispensed into sterile EP tubes to obtain competent cells.

[0125] 4. Electroporate the pTarget-Blue-recA plasmid into the pEcCas9 competent state

[0126] Use an electroporator to transfer the plasmid pTarget-Blue-recA into the pEcCas9 competent cells prepared above. After electroporation, quickly add 600 μL of LB medium in an ice bath, then transfer to a sterile EP tube, resuscitate at 37°C for 1 hour, spread on an LB plate containing spectinomycin resistance, and place in a 37°C incubator for culture.

[0127] 5. recA + Confirmation of gene coding sequence knockout

[0128] Colonies containing pTarget-Blue-recA will appear blue, while colonies without the plasmid will appear white. After selecting a single blue colony for expansion, use colony PCR to verify recA + Whether the gene coding sequence is knocked out. Use the forward primer located upstream of the recA HR-LF sequence in the genome and the reverse primer located downstream of the recA HR-RR sequence in the genome for colony PCR identification. + Whether the gene coding sequence has been successfully knocked out.

[0129] 6. Elimination of plasmid pTarget-Blue-recA

[0130] The correctly transformed strain was inoculated into LB medium containing kanamycin resistance, rhamnose was added at a final concentration of 10mM, and cultured overnight at 37°C. Rhamnose can induce the transcription of gRNA-pMB1 located on the pEcCas plasmid, and its transcription product can cut off the pMB1 sequence located in pTarget-Blue-recA under the action of Cas9 protein, thereby helping to eliminate the plasmid.

[0131] Streak the bacterial solution on a plate containing kanamycin resistance and culture it overnight at 37°C. The white plaques that grow are more likely to be cells where the pTarget-Blue-recA plasmid has been eliminated. Select multiple white colonies and shake them in a 96-well plate containing kanamycin resistance LB medium for about 4 hours. Spread each bacterial solution on a plate containing kanamycin and on a plate containing kanamycin and spectinomycin. Strains that grow on kanamycin plates but not on plates containing kanamycin and spectinomycin indicate that the plasmid has been successfully eliminated.

[0132] 7. Elimination of plasmid pEcCas

[0133] The strain from which the pTarget-Blue-recA plasmid had been eliminated was inoculated into LB medium containing 5 g / L glucose, and after shaking at 37°C for about 4 hours, it was streaked onto an LB plate containing 5 g / L glucose and 10 g / L sucrose, and cultured overnight at 37°C. Since the pEcCas plasmid contains the SacB gene, the expression product of which can convert sucrose into fructan to kill the cells, so the colonies grown on the LB plate containing sucrose have eliminated the pEcCas plasmid.

[0134] Select colonies and inoculate them in LB medium without antibiotics, shake at 37°C for 4 hours, streak on plates without antibiotics and plates containing kanamycin, and culture overnight at 37°C. Strains that grow on antibiotic-free plates but not on kanamycin plates indicate that plasmid pEcCas has been successfully eliminated.

[0135] If multiple gene knockouts are required, the pEcCas plasmid can be directly transferred into another pTarget-Blue plasmid without eliminating the pEcCas plasmid first, but arabinose needs to be added again to induce the recombinase.

[0136] 8. recF + Knockout of gene coding sequences

[0137] Follow the steps 3 to 7 above to perform recF using the pTarget-Blue-recF plasmid. + The knockout of gene coding sequences will not be described again here.

[0138] Example 2

[0139] In this embodiment, recA + and recF + Comparison of the effects of simultaneous knockout and single knockout of gene coding sequences

[0140] Using Escherichia coli DH5a strain, recA + DH5a strain with knockout gene coding sequence - BW2 (recAΔ), recF + DH5a strain with knockout gene coding sequence - BW8 (recFΔ) and recA + recF + Plasmid fermentation was performed on the DH5a strain BW17 (recAΔrecFΔ) in which the gene coding sequences were simultaneously knocked out, further demonstrating the significance of simultaneous knockout of the two regions.

[0141] 1. First, use the pUC57-HB4329 plasmid containing a polyadenosine sequence (poly A) for testing.

[0142] The supercoiled monomer band of the plasmid in agarose gel electrophoresis was excised and recovered, and the plasmid DNA was transferred into DH5a, BW2 (recAΔ), BW8 (recFΔ) and BW17 (recAΔrecFΔ), where Δ indicates gene fragment knockout. Four monoclonal colonies were selected from each transformant plate, inoculated in a tube containing LB medium containing kanamycin resistance, and shaken overnight at 37°C for about 17 hours. The plasmid was extracted using the UE plasmid sales preparation kit (Ultraland 231226KA1) and 300 ng was taken for agarose electrophoresis detection. The results are shown in Figure 5As shown in the figure, the red arrow indicates the band is a supercoiled monomer plasmid, and the blue arrow indicates the band is a dimer plasmid. + The gene coding sequence was knocked out separately, and the recF + Gene coding sequence knockout and recA + With recF + After the gene coding sequence was knocked out at the same time, the proportion of supercoiled monomers in the extracted plasmid increased significantly. According to the agarose gel electrophoresis results, it was preliminarily judged that the recA + With recF + When the gene coding sequence was knocked out at the same time, the proportion of supercoiled monomers in the plasmid was increased to the greatest extent.

[0143] The extracted plasmid samples were subjected to high performance liquid chromatography (HPLC) analysis to detect the proportion of supercoiled monomeric plasmids contained in each sample. The summary results are shown in Table 1 below.

[0144] Table 1

[0145]

[0146] As shown in Table 1, the HPLC analysis results are consistent with the agarose gel electrophoresis analysis results. + or recF + After the gene coding sequence was knocked out alone, the proportion of supercoiled monomers in the pUC57-HB4329 plasmid increased. + and recF + After the gene coding sequence was knocked out at the same time, the proportion of supercoiled monomers in the plasmid was higher than that of the single knockout result. + and recF + The effect of simultaneous knockout of the two genes in increasing the proportion of supercoiled monomers is significantly better than that of knocking out the two genes alone.

[0147] 2. The BB29301-15 plasmid, which is prone to produce aggregates, was used for testing.

[0148] The plasmid was linearized and then circularized with T4 ligase before being transferred into each test strain. The subsequent operations were consistent with the above-mentioned pUC57-HB4329 plasmid test. The results of agarose gel electrophoresis are shown in Figure 2. Figure 6 As shown in the figure, the red arrow indicates the band is a supercoiled monomer plasmid, and the blue arrow indicates the band is a dimer plasmid. + and recF + After the gene coding sequence was simultaneously knocked out, the dimer component of the BB29301-15 plasmid was reduced to the greatest extent, and the proportion of supercoiled monomers was significantly increased.

[0149] The extracted plasmid samples were subjected to high performance liquid chromatography (HPLC) analysis to detect the proportion of supercoiled monomeric plasmids contained in each sample. The summary results are shown in Table 2.

[0150] Table 2

[0151]

[0152] According to the test results using the pUC57-HB4329 plasmid and the BB29301-15 plasmid, recA + and recF + Knocking out the gene coding sequence alone or simultaneously can increase the proportion of supercoiled monomers in the plasmid. When both sequences are knocked out simultaneously, the effect of increasing the proportion of supercoiled monomers is the best.

[0153] Example 3

[0154] Testing of Stable3 modified strains

[0155] Escherichia coli Stable3 strain and BW20 (recA + and recF + The lentiviral plasmid was fermented in a Stable3 strain in which the gene coding sequence was simultaneously knocked out, which illustrates the effect of the scheme of the present invention on optimizing the ratio of supercoiled monomers in the Stable3 strain.

[0156] After linearization, the lentiviral plasmid V1831940 and plasmid V1831945 were recircularized using T4 ligase, and then introduced into the E. coli Stable3 strain and BW20 strain, spread on the LB plate containing kanamycin resistance, and cultured at 30°C throughout the process. Two monoclonal colonies were selected on each transformant plate, inoculated in an LB medium tube containing kanamycin resistance and shaken overnight for about 17 hours. Then, the bacterial liquid was inoculated in an EM medium shake flask containing kanamycin resistance at a volume ratio of 0.25%, and after overnight shaking culture, the plasmid was extracted using a large-scale plasmid extraction process. 300 ng of plasmid was taken for agarose gel electrophoresis analysis, and the results are as follows Figure 7 As shown. The red arrow indicates the band is a supercoiled monomer plasmid, and the blue arrow indicates the band is a dimer plasmid. From the agarose gel electrophoresis results, the proportion of supercoiled monomer plasmids in the Stable3 strain and the BW20 strain is similar, and it is necessary to combine the high-performance liquid chromatography results for analysis.

[0157] The extracted plasmid samples were subjected to high performance liquid chromatography (HPLC) analysis to detect the proportion of supercoiled monomeric plasmids contained in each sample. The summary results are shown in Table 3.

[0158] Table 3

[0159]

[0160] According to the above results, recA + and recF + The simultaneous knockout of gene coding sequences can increase the proportion of supercoiled monomeric plasmids in the lentiviral plasmids V1831940 and V1831945 fermented by the Stable3 strain.

[0161] Example 4

[0162] Testing of Top 10 Transformed Strains

[0163] The Top10 strain was recA + and recF + The genes were knocked out simultaneously and transformed into the BW23 strain.

[0164] First, the pUC series plasmids were used to test the optimization effect of the supercoiled monomer ratio of the BW23 strain. The 9 pUC plasmids were linearized, recircularized using T4 DNA ligase, and introduced into the Top10 strain and the BW23 strain, spread on LB plates containing ampicillin, and cultured overnight at 37°C. Two clones were selected from each transformation plate, inoculated into LB medium containing ampicillin, and then shaken overnight for plasmid extraction. 300 ng of each plasmid sample was sampled for agarose gel electrophoresis detection, and the results are shown in the figure. Figure 8 As shown. The red arrow indicates the band is a supercoiled monomer plasmid, and the blue arrow indicates the band is a dimer plasmid. As can be seen from the figure, when using BW23 strains for pUC plasmid production, the content of plasmid dimers is significantly reduced compared to the Top10 strains.

[0165] The extracted plasmid samples were subjected to high performance liquid chromatography (HPLC) analysis to detect the proportion of supercoiled monomeric plasmids contained in each sample. The summary results are shown in Table 4

[0166] Table 4

[0167]

[0168] The antibody variable region plasmid was also used for testing. The plasmid vector part and the insert fragment part were assembled by homologous recombination and transferred into the Top10 strain and the BW23 strain, spread on the LB plate containing ampicillin, and cultured overnight at 37°C. Two clones were selected from each transformation plate, inoculated into the LB medium containing ampicillin, and then the plasmid was extracted after overnight shaking. 300 ng of each plasmid sample was sampled for agarose gel electrophoresis detection, and the results are shown as follows: Fig. 9 As shown. The red arrow indicates the band is a supercoiled monomer plasmid, and the blue arrow indicates the band is a dimer plasmid.

[0169] The extracted plasmid samples were subjected to high performance liquid chromatography (HPLC) analysis to detect the proportion of supercoiled monomeric plasmids contained in each sample. The summary results are shown in Table 5.

[0170] Table 5

[0171]

[0172]

[0173] The above results show that knocking out recA + and recF + The Top10 strains after the gene coding sequence can significantly increase the proportion of supercoiled monomer plasmids of pUC plasmids and antibody variable region plasmids.

[0174] In summary, the present invention provides a method for genetic modification of Escherichia coli, which improves existing strains and optimizes the existing problem of excessive aggregates. The method can significantly reduce the generation of plasmid aggregates and increase the proportion of plasmid supercoiled monomers.

[0175] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A method for genetically modifying Escherichia coli to increase the proportion of supercoiled monomers in a plasmid, characterized in that: The method comprises: The CRISPR / Cas9 gene editing system was used to knock out two DNA sequences in the genome of the host Escherichia coli, including recA + Gene coding sequence and recF + Gene coding sequence; The recA + The nucleotide sequence from the 5' end to the 3' end of the gene coding sequence is shown in SEQ ID NO.1; The recF + The nucleotide sequence from the 5' end to the 3' end of the gene coding sequence is shown in SEQ ID NO.

2.

2. The method for genetically modifying Escherichia coli for increasing the ratio of supercoiled monomers in a plasmid according to claim 1, characterized in that: The CRISPR / Cas9 gene editing system includes: sgRNA, homologous recombination sequence and Cas9; Preferably, the homologous recombination sequence comprises recA + Gene coding sequence or recF + Upstream and downstream homology arms required for knockout of gene coding sequences; Preferably, the lengths of the upstream and downstream homology arms are independently 400-600 bp, preferably 450-550 bp; Preferably, the Cas9 is expressed from a pEcCas9 plasmid.

3. The method for genetically modifying Escherichia coli for increasing the ratio of supercoiled monomers in a plasmid according to claim 2, characterized in that: The sgRNA includes sgRNA1 or sgRNA2; the target DNA sequence of the sgRNA1 is shown as SEQ ID NO.25, and the target DNA sequence of the sgRNA2 is shown as SEQ ID NO.

26.

4. The method for genetically modifying Escherichia coli for increasing the ratio of supercoiled monomers in a plasmid according to claim 2 or 3, characterized in that: The homologous recombination sequence, the targeting sgRNA sequence and the linearized pTarget-Blue plasmid vector are connected to obtain a homologous recombination plasmid; Preferably, knocking out recA + The homologous recombination plasmid of the gene coding sequence is composed of homologous recombination sequences A, recA + The targeting sgRNA sequence was connected to the linearized pTarget-Blue plasmid vector; Preferably, the homologous recombination sequence A is obtained by sequentially connecting SEQ ID NO.3 and SEQ ID NO.6 in upstream and downstream positions; Preferably, the recA + The targeting sgRNA sequence is obtained by sequentially connecting the promoter that initiates sgRNA transcription, the target DNA sequence SEQID NO.25 of sgRNA1, and the gRNA backbone sequence; Preferably, the recA + The targeting sgRNA sequence includes that shown in SEQ ID NO.9; Preferably, knocking out recF + The homologous recombination plasmid of the gene coding sequence is composed of homologous recombination sequence B, recF + The targeting sgRNA sequence was connected to the linearized pTarget-Blue plasmid vector; Preferably, the homologous recombination sequence B is obtained by sequentially connecting SEQ ID NO.15 and SEQ ID NO.18 in upstream and downstream positions; Preferably, the recF + The targeting sgRNA sequence is obtained by sequentially connecting the promoter that initiates sgRNA transcription, the target DNA sequence SEQID NO.26 of sgRNA2, and the gRNA backbone sequence; Preferably, the recF + The targeting sgRNA sequence includes that shown in SEQ ID NO.21; Preferably, the linearized pTarget-Blue plasmid vector comprises SEQ ID NO.

14.

5. The method for genetically modifying Escherichia coli to increase the ratio of supercoiled monomers in a plasmid according to any one of claims 1 to 4, characterized in that: The method comprises: Knockout of recA + The homologous recombination plasmid of the gene coding sequence was transfected into competent cells containing the pEcCas9 plasmid, and recA was verified by colony PCR after culture. + Whether the gene coding sequence is knocked out; cultivate the correct strain and eliminate the knocked-out recA + Homologous recombination plasmid of gene coding sequence was obtained + Gene coding sequence knockout cells; Knockout of recF + Homologous recombination plasmids containing gene coding sequences were transfected into recA + In competent cells of gene coding sequence knockout cells, recF was verified by colony PCR after culture. + Whether the gene coding sequence is knocked out; cultivate the correct strain and eliminate the knocked-out recF + The homologous recombination plasmid of the gene coding sequence was then eliminated, and the pEcCas9 plasmid was obtained to obtain recA + Gene coding sequence and recF + Gene coding sequence double knockout cells.

6. A recombinant Escherichia coli, characterized in that The recombinant Escherichia coli is prepared by the Escherichia coli gene modification method for increasing the ratio of supercoiled monomers of plasmids according to any one of claims 1 to 5.

7. A sgRNA, characterized in that The sgRNA includes sgRNA1 or sgRNA2; the target DNA sequence of the sgRNA1 is shown as SEQ ID NO.25, and the target DNA sequence of the sgRNA2 is shown as SEQ ID NO.

26.

8. A recombinant plasmid, characterized in that: The recombinant plasmid is obtained by connecting the homologous recombination sequence, the targeting sgRNA sequence and the linearized pTarget-Blue plasmid vector; the targeting sgRNA sequence is obtained by connecting the promoter that starts the transcription of the sgRNA, the target DNA sequence of the sgRNA according to claim 7 and the gRNA backbone sequence in sequence; Preferably, the recombinant plasmid comprises: knocking out recA + Homologous recombination plasmids or knockout recF + Homologous recombination plasmids of gene coding sequences; Preferably, the knockout of recA + The homologous recombination plasmid of the gene coding sequence is composed of homologous recombination sequences A, recA + The targeting sgRNA sequence was connected to the linearized pTarget-Blue plasmid vector; Preferably, the homologous recombination sequence A is obtained by sequentially connecting SEQ ID NO.3 and SEQ ID NO.6 in upstream and downstream positions; Preferably, the recA + The targeting sgRNA sequence is obtained by sequentially connecting the promoter that initiates sgRNA transcription, the target DNA sequence SEQID NO.25 of sgRNA1, and the gRNA backbone sequence; Preferably, the recA + The targeting sgRNA sequence includes that shown in SEQ ID NO.9; Preferably, the knockout of recF + The homologous recombination plasmid of the gene coding sequence is composed of homologous recombination sequence B, recF + The targeting sgRNA sequence was connected to the linearized pTarget-Blue plasmid vector; Preferably, the homologous recombination sequence B is obtained by sequentially connecting SEQ ID NO.15 and SEQ ID NO.18 in upstream and downstream positions; Preferably, the recF + The targeting sgRNA sequence is obtained by sequentially connecting the promoter that initiates sgRNA transcription, the target DNA sequence SEQID NO.26 of sgRNA2, and the gRNA backbone sequence; Preferably, the recF + The targeting sgRNA sequence includes that shown in SEQ ID NO.21; Preferably, the linearized pTarget-Blue plasmid vector comprises SEQ ID NO.

14.

9. A CRISPR / Cas9 gene editing system, characterized in that: The gene editing system comprises the sgRNA of claim 7, the recombinant plasmid of claim 8 and Cas9.

10. Use of any one of the Escherichia coli genetic modification methods for increasing the proportion of supercoiled monomers in plasmids as described in any one of claims 1 to 5, the sgRNA described in claim 7, the recombinant plasmid described in claim 8, or the CRISPR / Cas9 gene editing system described in claim 9, or a combination of at least two thereof in Escherichia coli genetic modification.

Images