Transgenic crop cultivation method based on high photosynthetic efficiency genetic breeding characteristics of corn

Abstract

The invention discloses a transgenic crop cultivation method based on corn high-photosynthetic-efficiency genetic breeding characteristics, which comprises the following steps: screening according to specific data indexes to obtain a high-photosynthetic-efficiency gene donor material bearing the corn high-photosynthetic-efficiency genetic breeding characteristics and a target gene or a target gene combination in the high-photosynthetic-efficiency gene donor material; the C3 crop is transformed based on the target gene or the target gene combination, and the target C3 crop with higher light and efficiency and / or higher yield potential compared with a wild crop is obtained. According to the application, a high-photosynthetic-efficiency gene donor material with high enzymatic activity and photosynthetic rate is screened from a large number of maize inbred lines, the high-photosynthetic-efficiency gene PEPC is separated and cloned from the high-photosynthetic-efficiency gene donor material, an efficient expression vector is constructed and is introduced into common wheat by a gene gun mediation method, and the PEPC enzymatic activity, net photosynthetic rate and yield of the transgenic wheat are obviously higher than those of a control group; the high-photosynthetic-efficiency transgenic wheat is obtained, and meanwhile, a good reference is provided for high-photosynthetic-efficiency breeding research of other C3 crops such as rice and the like.

Description

Technical Field

[0001] The invention relates to the technical field of crop genetic breeding, and in particular to a method for cultivating transgenic crops based on the high light-efficiency genetic breeding characteristics of corn. Background Art

[0002] Wheat is an important food crop in my country. Its production capacity and supply and demand have always been related to major strategic issues such as my country's national economic development and food security. Due to the rigid growth of my country's population, the development of urbanization and industrialization, it is impossible for the wheat planting area to resume growth significantly. To ensure the main self-sufficiency of wheat in my country, the only way out is to continue to increase the yield. At present, the increase in wheat yield is mainly due to the genetic improvement of variety yield potential and the improvement of production conditions. The genetic improvement of yield potential is mainly achieved through the improvement of wheat morphological traits. Under the circumstances that the yield level of existing wheat varieties is relatively high and the leaf area index and harvest coefficient are close to the limit, it is difficult to achieve a leapfrog improvement in wheat yield potential by relying solely on the genetic improvement of morphological traits. In this context, many scholars at home and abroad have turned their attention to the genetic improvement of wheat light energy conversion efficiency, hoping to achieve a substantial increase in biological yield by improving photosynthetic efficiency, and then achieve a breakthrough in the improvement of wheat yield potential.

[0003] Photosynthesis is the basis of all green plant material production, and more than 90% of the dry matter of crops comes from photosynthesis. According to the different ways of CO2 fixation, higher plants can be divided into C3, C4 and Crassulacean acid (CAM) plants. Among them, C4 plants such as corn, sorghum, and sugarcane have a CO2 concentration mechanism, a high light compensation point, a low CO2 compensation point, and weak photorespiration. They have obvious growth advantages, especially under adverse conditions such as high temperature and drought. Therefore, the biological yield is much higher than that of C3 plants such as wheat and rice (generally 1.5-3 times higher). Therefore, introducing the C4 pathway high-efficiency system into C3 crops such as wheat and rice, improving the intrinsic genetic basis of photosynthesis in C3 crops, and driving the increase in biological yield and grain yield by significantly improving photosynthetic efficiency has always been a frontier topic in plant biological science research. In terms of technical approaches, sexual hybridization methods are difficult to overcome the sterility caused by genetic distance between C4 and C3 plants. Transgenic technology can break the reproductive isolation of species, achieve communication between different species at the genetic level and the aggregation of multiple excellent traits. Therefore, introducing key enzyme genes of the C4 pathway into C3 crops through transgenic means has become an important breakthrough in the research of high-light-efficiency breeding of C3 crops.

[0004] Based on the above technical status, this study further developed a complete set of technical systems and operating methods to genetically improve C3 crops based on the high light efficiency genetic characteristics of corn. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a method for cultivating transgenic crops based on the genetic breeding characteristics of high light efficiency of corn. The technical scheme adopted is as follows:

[0006] A method for breeding transgenic crops based on the high-light-efficiency genetic breeding characteristics of corn, wherein high-light-efficiency gene donor materials carrying the high-light-efficiency genetic breeding characteristics of corn and target genes or target gene combinations in the high-light-efficiency gene donor materials are screened according to specific data indicators, and C3 crops are transformed based on the above-mentioned target genes or target gene combinations to obtain target C3 crops with higher light efficiency and / or higher yield potential compared with wild crops.

[0007] As a preferred technical solution of the present invention, data indicators with photosynthetic gene enzyme activity and net photosynthetic rate as the core are constructed, while other reference indicators are allowed to be added as needed. Then, according to the above data indicators and based on the screening of a large population of corn inbred line materials, germplasm resources with excellent performance in both the two core indicators of photosynthetic gene enzyme activity and net photosynthetic rate and other reference indicators are obtained as high photosynthetic gene donor materials, from which one or more target genes or target gene combinations carrying the genetic breeding characteristics of high photosynthetic efficiency of corn are screened, and the above one or more target genes carrying the genetic breeding characteristics of high photosynthetic efficiency of corn are introduced into C3 crops to obtain target C3 crops with higher light and efficiency and / or higher yield potential compared with wild crops.

[0008] As a preferred technical solution of the present invention, the method includes the following optional operating steps:

[0009] 1) Screening of high-photoefficiency gene donor materials and their target gene combinations;

[0010] 2) Construction of efficient expression vector;

[0011] 3) High photosynthesis efficiency genes are gradually transformed into common C3 crops.

[0012] As a preferred technical solution of the present invention, the method further comprises the following optional subsequent steps:

[0013] 4) Molecular identification of C3 crop plants transgenic for high light efficiency;

[0014] 5) Determination of photosynthetic physiological indicators of transgenic high-efficiency C3 crop plants;

[0015] 6) Determination of yield indicators of C3 crops and receptors transgenic for high light efficiency;

[0016] 7) Select transgenic C3 crops with high photosynthesis efficiency.

[0017] As a preferred technical solution of the present invention, materials with high photosynthetic efficiency gene enzyme activity and net photosynthetic rate are selected from a large number of corn inbred lines as high photosynthetic efficiency gene donor materials, and the net photosynthetic rate of the leaves of the corn inbred lines is measured using a portable photosynthetic measurement system. Each plant is measured three times and the average value is taken. During the measurement, the leaf chamber temperature is about 23°C and the light intensity is about 1300 μmolm-2s-1.

[0018] As a preferred technical solution of the present invention, the target gene combination includes: the maize phosphoenolpyruvate carboxylase gene PEPC and the pyruvate phosphate dikinase gene PPDK from a high-light-efficiency gene donor material.

[0019] As a preferred technical solution of the present invention, the construction of the efficient expression vector is to insert the high light efficiency gene into the efficient expression vector pCAMBIA3301.

[0020] As a preferred technical solution of the present invention, the operating steps of the step-by-step transformation of common C3 crops with high-light-efficiency genes are as follows: first, the high-light-efficiency gene PEPC is introduced into common C3 crops using a gene gun-mediated method, and transgenic plants with positive PEPC gene and significantly increased photosynthetic rate compared with the control are selected as receptor materials, and then another high-light-efficiency gene PPDK is transferred using a gene gun-mediated method.

[0021] As a preferred technical solution of the present invention, the molecular identification of the high-light-efficiency gene-transgenic C3 crop plants is performed by PCR, RT-PCR, Western blot and other methods to identify the integration, transcription and expression of exogenous genes in the transgenic C3 crop plants.

[0022] The present invention also includes the recombinant expression vector, transgenic cell line, transformant and transgenic crops prepared by the method involved in the method; the transgenic crops specifically include wheat, rice and other conventional C3 crops.

[0023] Compared with the prior art, the present invention has the following technical advances:

[0024] In general, this study screened high-light-efficiency gene donor materials with high enzyme activity and photosynthetic rate from a large number of corn inbred lines, isolated and cloned the high-light-efficiency gene PEPC, constructed an efficient expression vector, and introduced it into common wheat through the gene gun-mediated method. The PEPC enzyme activity, net photosynthetic rate and yield of the transgenic wheat were significantly higher than those of the control.

[0025] Furthermore, in the process of obtaining high-light-efficiency transgenic wheat, the present invention found that the source of the high-light-efficiency gene greatly affects the improvement of the photosynthetic characteristics of the transgenic wheat and the increase in its yield. Therefore, high-light-efficiency gene donor materials were screened from a large number of corn inbred lines, and the two high-light-efficiency genes obtained were introduced step by step into common wheat, which can significantly improve the photosynthetic characteristics of the transgenic wheat and increase the yield level. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention.

[0027] In the attached picture:

[0028] Figure 1 It is a line graph of daily variation of net photosynthetic rate of flag leaves of transgenic wheat of the present invention and its control;

[0029] Figure 2 It is a line graph showing the response of flag leaf photosynthetic rate of the transgenic wheat of the present invention and its control to light intensity;

[0030] Figure 3 Schematic diagram of the yield traits of transgenic wheat and the control.

[0031] In the figure: Pn, net photosynthetic rate; CK, Zhoumai 19; PK, PPDK gene-transformed plants; PC, PEPC gene-transformed plants; PKC, PEPC+PPDK gene-transformed plants; PPFD, photosynthetically active radiation. DETAILED DESCRIPTION

[0032] The following specific embodiments may be combined with each other, and the same or similar concepts or processes may not be described in detail in some embodiments. The embodiments of the present invention will be described below in conjunction with the accompanying drawings.

[0033] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or combinations thereof.

[0034] It should also be understood that the term “and / or” used in the specification and appended claims refers to any and all possible combinations of one or more of the associated listed items, and includes these combinations.

[0035] As used in the specification and appended claims of this application, the term "if" can be interpreted as "when" or "uponce" or "in response to determining" or "in response to detecting", depending on the context. Similarly, the phrase "if it is determined" or "if [described condition or event] is detected" can be interpreted as meaning "uponce it is determined" or "in response to determining" or "uponce [described condition or event] is detected" or "in response to detecting [described condition or event]", depending on the context.

[0036] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0037] References to "one embodiment" or "some embodiments" etc. described in the specification of this application mean that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Therefore, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in this specification do not necessarily refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "including", "comprising", "having" and their variations all mean "including but not limited to", unless otherwise specifically emphasized in other ways.

[0038] Example 1

[0039] The maize inbred lines were provided by the Grain Crops Institute of Henan Academy of Agricultural Sciences, and the wheat variety Zhoumai 19 was provided by the Molecular Breeding Laboratory of the Wheat Research Institute of Henan Academy of Agricultural Sciences. All experimental materials were planted at the experimental base of Henan Academy of Agricultural Sciences and conventional field management was adopted.

[0040] Example 2

[0041] Selection of high-photosynthetic-efficiency maize inbred lines. The PEPC enzyme activity method was used to measure the net photosynthetic rate of leaves of transgenic wheat plants and control plants using the CIRAS-1 portable photosynthetic measurement system (PPSystem, UK). Each plant was measured 3 times and the average value was taken. During the measurement, the leaf chamber temperature was about 23°C and the light intensity was about 1300μmolm-2s-1.

[0042] Then, the high-light-efficiency gene cloning and efficient expression vector construction were used. That is, primers were designed using Primer 5.0 software based on the cDNA sequences of the maize phosphoenolpyruvate carboxylase (PEPC) gene and pyruvate phosphokinase (PPDK) gene. A specific restriction site BglⅡ and pmlⅠ were added to both ends of the PEPC gene primer. The sequence was:

[0043] P1:5'--GCAGATGTGCTCGAACCATCTCGCTTCCGTG--3', (SEQ ID NO.1)

[0044] P2:5'--GGCACGTGGTCGCCTAGCCAGTGTTCTGCAT--3'; (SEQ ID NO.2)

[0045] Add a specific restriction site BglⅡ and AanⅠ at both ends of the PPDK gene primer, the sequence is:

[0046] P1:5'--GCAGATGTTCGGCTCGCTCTCCCCTTGCTCCAT--3', (SEQ ID N O.3)

[0047] P2:5'--GGTTATAACACATCCACGAGCAGCAGGCAATCC--3', (SEQ ID NO.4)

[0048] Primers were synthesized by Shanghai Sangon Co., Ltd. Total RNA extraction and cDNA synthesis of corn were carried out according to the instructions of RNA extraction kit and MLV reverse transcription kit of Promega Co., Ltd.

[0049] PCR amplification was performed using corn total cDNA as a template. The PCR reaction system was: 10-50 ng / ul genomic template; 0.5 μl each of 10 μM P1 and P2; 2.5 μl 10× Reaction Buffer; 4 μl dNTP mix (2.5 mM); 0.5 μl LA–Taq enzyme, and water was added to 25 μl.

[0050] PEPC gene reaction program: 94°C pre-denaturation for 5 min; 94°C denaturation for 45 s, 62°C annealing for 1 min, 72°C extension for 3 min, 35 cycles; then 72°C extension for 10 min.

[0051] The PPDK gene reaction program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at 65°C for 45 s, extension at 72°C for 3 min, 35 cycles; and then extension at 72°C for 10 min.

[0052] The PCR products were detected by 0.8% agarose gel electrophoresis, and the 3kb target fragment was recovered by agarose gel DNA recovery kit, connected to the pMD19-T vector by T / A cloning method, transformed into Escherichia coli DH5α, plated and cultured overnight, and positive clones were picked and entrusted to Beijing Boshan Biological Company for sequencing. The correct clones were named pMD19-PEPC and pMD19-PPDK. pMD19-PEPC and binary expression vector pCOMBIA3301 were double-digested with BglⅡ and pmlⅠ, respectively, and pMD19-PPDK and binary expression vector pCOMBIA3301 were double-digested with BglⅡ and AanⅠ, respectively, detected by agarose gel electrophoresis, and the 3kb target band and the 9257bp fragment of the expression vector were recovered by cutting the gel. The clones were connected at 16°C overnight and transformed into Escherichia coli DH5α. The correct clones identified by PCR and double enzyme digestion were named p3301-PEPC and p3301-PPDK.

[0053] Example 3

[0054] The gene gun transformation method was used. That is, the young embryos were taken from the immature seeds of the same size in the middle of the ear 12-14 days after flowering. The young seeds were disinfected with 70% alcohol surface for 30 seconds, rinsed with sterile water 3-4 times, disinfected with 0.1% HgCl2 for 10 minutes, and rinsed with sterile water 3-4 times. Then, the young embryos were peeled out with dissecting forceps on the clean bench, inoculated on the induction medium, and incubated in the dark for 4-5 days. After osmotic treatment on the hypertonic medium for 4-6 hours, the gene gun bombardment was performed. After the gene gun bombardment, the hypertonic treatment was performed for 16 hours, and then transferred to the induction medium. After culturing for 2 weeks, it was transferred to the glufosinate resistance screening regeneration medium, and then screened twice continuously, each time for 2 weeks. The screened resistant seedlings were transferred to the rooting medium, and after rooting and strong seedlings, they were moved into flower pots.

[0055] The genomic DNA of all regenerated plants was extracted, and a pair of specific primers were designed based on the cloned PEPC gene sequence using Primer5.0 software.

[0056] PP1:5'-CGCCGTTCGATACAGTCTCA-3(SEQ ID NO.5)

[0057] PP2:5'-CATCTCGCTGCTGTGCTTAG-3'(SEQ ID NO.6)

[0058] The primers were used to perform PCR detection on the regenerated plants to identify the positive plants.

[0059] PCR program: 10-50ng / ul genomic template; 0.5μl of 10μM P3 and P4; 2.5μl 10×ReactionBuffer; 4μl dNTPmix (2.5mM); 0.5μl Taq enzyme, add water to 25μl. PCR reaction conditions: 94℃5 minutes; 94℃45 seconds, 58℃45 seconds, 72℃1 minute, 35 cycles; 72℃10 minutes, PCR products were detected by 1% agarose gel electrophoresis. Some plants can amplify the target band of 800bp and are identified as positive plants.

[0060] Based on the PEPC gene transgenic wheat positive plants, the PPDK gene was introduced into the PEPC gene transgenic plants by gene gun bombardment, and the genomic DNA of all regenerated plants was extracted. According to the cloned PPDK gene sequence, a pair of specific primers P3 (ATGGTGTTGTTGCGCTCGC TCTT) (SEQ ID NO.7) and P4 (GATTGTCGTCTCGCGCCTTCAGT) (SEQ ID NO.8) were designed using Primer5.0 software. The primers were used to perform PCR detection on the regenerated plants to identify the positive plants.

[0061] PCR program: 10-50ng / ul genomic template; 0.5μl of 10μM P3 and P4; 2.5μl 10×Reaction Buffer; 4μl dNTP mix (2.5mM); 0.5μl Taq enzyme, add water to 25μl. PCR reaction conditions are: 94℃ pre-denaturation for 3 minutes; 94℃ 45 seconds, 57℃ 45 seconds, 72℃ 50 seconds, 35 cycles; 72℃ extension for 10 minutes, PCR products were detected by 1% agarose gel electrophoresis. Some plants can amplify the target band of 951bp, which is identified as positive plants, which are transgenic PEPC+PPDK double-gene wheat plants.

[0062] Example 4

[0063] Functional analysis of high photosynthetic efficiency genes in transgenic wheat. A portable photosynthetic analyzer (Ciras-2, PP-systems, Amesbury, MA, USA) was used to measure the daily changes in flag leaf Pn (net photosynthetic rate) of transgenic plants and controls (Zhoumai 19) during the flowering period (sunny day), and the daily accumulation of photosynthesis was calculated according to the following formula:

[0064]

[0065] Where Pi is the net photosynthetic rate measured for the ith time, Pi+1 is the net photosynthetic rate measured for the i+1th time, n is the number of measurements, t is the interval time, and the response of PPFD (photosynthetically active radiation) - Pn (net photosynthetic rate) is measured two weeks after flowering. The PPFD-Pn response curve is drawn in the order of 1800, 1600, 1400, 1200, 1000, 800, 600, 400, 200, 150, 80, 30 μmol / m2 / s. The light intensity corresponding to the maximum value of the Y-axis ordinate in the PPFD-Pn response curve equation is the saturated light intensity, and the corresponding Pn of the Y-axis ordinate is the photosynthetic rate of light saturation.

[0066] Example 5

[0067] Test results reference Figures 1 to 3 .like Figure 1 As shown, the daily changes in photosynthetic rate of different transgenic materials and their controls are quite different and show a certain regularity. The difference in net photosynthetic rate between materials is the smallest in the morning and evening. When under strong light and high temperature conditions (11:00-14:00), there are large photosynthetic differences between strains. The maximum daily photosynthetic rate of PKC strain and PC strain occurred at 11:00, which were 27.9μmolCO2m-2s-1 and 25.0μmolCO2m-2s-1, respectively; while the maximum daily photosynthetic rate of PK strain and control occurred at 10:00, which were 23.1 and 22.1μmolCO2m-2s-1, respectively. The maximum daily photosynthetic rate of PKC strain, PC strain and PK strain were 26.4%, 13.3% and 4.5% higher than that of the control, respectively; the daily photosynthetic accumulation of PKC strain, PC strain and PK strain were 828, 778 and 730mmolCO2m-2, respectively. The daily photosynthetic accumulation of PKC strain, PC strain and PK strain were 21.3%, 13.9% and 6.9% higher than that of the control (683mmolCO2m-2), respectively. At the same time, the test materials all showed a lunch break phenomenon under strong light and high temperature conditions at noon, but the photosynthetic rate during the lunch break was still PKC>PC>PK>control.

[0068] like Figure 2 and Figure 3As shown, the light compensation point of the transgenic lines and the control was not much different, and the light saturation point and the maximum photosynthetic rate of light saturation showed great differences among the three transgenic lines. The light saturation points of the PKC line, PC line, PK line and the control were 1630, 1555, 1505 and 1465 μmol m-2 s-1, respectively, and the photosynthetic rates of light saturation were 25.42, 23.03, 21.15 and 20.23 μmol CO2 m-2 s-1, respectively. The light saturation point of the PKC line, PC line and PK line increased by 11%, 6% and 3% respectively compared with the control, and the light saturation rate increased by 25.6%, 13.8% and 4.6% respectively compared with the control. The yield of the PEPC+PPDK double-gene transgenic wheat was significantly higher than that of the control and the PEPC single-gene transgenic wheat, indicating that the photosynthetic characteristics and yield of the high-light-efficiency transgenic wheat obtained by this method were better than those of the control.

[0069] Based on the above embodiments, it can be seen that the method of the present invention starts with the screening of high-light-efficiency gene donor materials, uses the gene gun-mediated method to introduce the high-efficiency expression vector containing the high-light-efficiency gene into common wheat, and establishes a method for obtaining high-light-efficiency transgenic wheat through molecular identification and the determination of photosynthetic physiological indicators and yield indicators, thereby providing theoretical and material support for the breeding of high-light-efficiency transgenic wheat.

[0070] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0071] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein with equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the scope of protection of the claims of the present invention.

Claims

1. A method for cultivating transgenic crops based on the genetic breeding characteristics of high light efficiency of corn, characterized in that: According to specific data indicators, high-light-efficiency gene donor materials and target genes or target gene combinations in high-light-efficiency gene donor materials that carry the genetic breeding characteristics of high-light-efficiency corn are screened, and C3 crops are transformed based on the above-mentioned target genes or target gene combinations to obtain target C3 crops with higher light efficiency and / or higher yield potential compared with wild crops.

2. The method for cultivating transgenic crops based on the genetic breeding characteristics of high light efficiency of corn according to claim 1, characterized in that: Data indicators with photosynthetic efficiency gene enzyme activity and net photosynthetic rate as the core are constructed, while other reference indicators are allowed to be added as needed. Then, according to the above data indicators and based on the screening of a large population of corn inbred line materials, germplasm resources with excellent performance in both the two core indicators of photosynthetic efficiency gene enzyme activity and net photosynthetic rate and other reference indicators are obtained as high photosynthetic efficiency gene donor materials, from which one or more target genes or target gene combinations carrying the genetic breeding characteristics of high photosynthesis efficiency of corn are screened, and the above one or more target genes carrying the genetic breeding characteristics of high photosynthesis efficiency of corn are introduced into C3 crops to obtain target C3 crops with higher light and efficiency and / or higher yield potential compared with wild crops.

3. A method for cultivating transgenic crops based on the genetic breeding characteristics of high light efficiency of corn according to claim 1 or 2, characterized in that: The method includes the following optional steps: 1) Screening of high-photoefficiency gene donor materials and their target gene combinations; 2) Construction of efficient expression vector; 3) High photosynthesis efficiency genes are gradually transformed into common C3 crops.

4. The method for cultivating transgenic crops based on the genetic breeding characteristics of high light efficiency of corn according to claim 3, characterized in that: The method also includes the following optional subsequent steps: 4) Molecular identification of C3 crop plants with high light efficiency genes; 5) Determination of photosynthetic physiological indicators of transgenic high-efficiency C3 crop plants; 6) Determination of yield indicators of C3 crops and receptors transgenic for high light efficiency; 7) Select transgenic C3 crops with high photosynthesis efficiency.

5. The method for cultivating transgenic crops based on the genetic breeding characteristics of high light efficiency of corn according to claim 3, characterized in that: Materials with high photosynthetic efficiency gene enzyme activity and net photosynthetic rate are selected from a large number of corn inbred lines as high photosynthetic efficiency gene donor materials, and the net photosynthetic rate of leaves of the corn inbred lines is measured using a portable photosynthetic measurement system. Each plant is measured three times and the average value is taken. During the measurement, the leaf chamber temperature is about 23°C and the light intensity is about 1300µmol m-2s-1.

6. The method for cultivating transgenic crops based on the genetic breeding characteristics of high light efficiency of corn according to claim 5, characterized in that: The target gene combination includes: a maize phosphoenolpyruvate carboxylase gene PEPC and a pyruvate phosphate dikinase gene PPDK from a high-light-efficiency gene donor material.

7. The method for cultivating transgenic crops based on the genetic breeding characteristics of high light efficiency of corn according to claim 6, characterized in that: The construction of the high-efficiency expression vector is to insert the high-light-efficiency gene into the high-efficiency expression vector pCAMBIA3301.

8. The method for cultivating transgenic crops based on the genetic breeding characteristics of high light efficiency of corn according to claim 7, characterized in that: The operation steps of the step-by-step transformation of the high-light-efficiency gene into common C3 crops are: firstly, the high-light-efficiency gene PEPC is introduced into the common C3 crops by using the gene gun-mediated method, and the transgenic plants with positive PEPC gene and significantly increased photosynthetic rate compared with the control are selected as the receptor material, and then another high-light-efficiency gene PPDK is transferred by using the gene gun-mediated method.

9. The method for cultivating transgenic crops based on the genetic breeding characteristics of high light efficiency of corn according to claim 4, characterized in that: The molecular identification of the C3 crop plants with high light efficiency gene is carried out by using methods such as PCR, RT-PCR, and Western blot to identify the integration, transcription, and expression of the exogenous gene in the transgenic C3 crop plants.

10. The recombinant expression vector, transgenic cell line, transformant and transgenic crop prepared by the method as claimed in any one of claims 1 to 9; the transgenic crop is specifically: wheat, rice and other conventional C3 crops.

Images