Application of gene FTO in improvement of forage grass quality, yield and stress resistance

Abstract

The invention discloses application of a gene FTO in improvement of forage grass quality, yield and stress resistance. According to the invention, the FTO gene is subjected to codon optimization according to the metatropism of alfalfa and is overexpressed in alfalfa to obtain a transgenic alfalfa plant overexpressed with the FTO gene, and compared with wild alfalfa, the transgenic alfalfa plant overexpressed with the FTO gene has the advantages that the growth performance is enhanced; the crude protein content, the soluble carbohydrate content and the in-vitro dry matter digestibility are obviously higher than those of the wild type; the crude fiber content, the acid detergent fiber content, the neutral detergent fiber content and the lignin content of the transgenic alfalfa plant are obviously lower than those of a wild type; in addition, the drought resistance and salt stress resistance of the transgenic alfalfa plant are also obviously enhanced, which indicates that the FTO gene has the functions of improving forage grass quality, resisting stress or positively regulating plant growth. The method has application prospects in the aspects of improving forage grass quality and stress resistance or promoting plant growth and the like.

Description

Technical Field

[0001] The present invention relates to FTO Gene and its application, especially codon optimization according to alfalfa preference FTO Genes and their application in improving plant forage quality, stress resistance or promoting plant growth, belonging to FTO Genes and their applications. Background Art

[0002] Alfalfa ( Medicago sativa L.) is an excellent perennial legume forage grass, known as the "king of forage grass" for its high protein content and good palatability. In addition, alfalfa also has multiple functions such as maintaining nitrogen balance, soil and water conservation, fertilizing soil fertility, and ecological restoration. At present, alfalfa is the largest legume forage crop in terms of cultivation area. In recent years, with the rapid development of DNA recombinant technology and transgenic technology, molecular breeding research has also been further deepened, and new high-yield and high-quality alfalfa germplasm, new materials, and new varieties have been cultivated, which are of great significance to the national economy, animal husbandry development and ecological environment.

[0003] m 6 A not only plays an important regulatory role in animal stem cell differentiation, tissue development, brain memory, immunity, and disease, but also plays an important role in plant growth. 6 A is also necessary for the normal development of plants and plays an important role in regulating plant growth and development. 6 A demethylase affects cell growth and proliferation, but there is no homologous protein in plants. Studies have shown that FTO Gene overexpression can promote the increase of rice seed yield and potato tuber yield, significantly promote rice tiller formation and root growth, enhance photosynthesis, and improve drought resistance. FTO Overexpression of the gene in poplars can promote increased root length, adventitious root number, plant height, internode number, and / or increased salt stress tolerance. FTO There are no reports on the related research of the gene in legumes, especially alfalfa. Summary of the invention

[0004] The main purpose of the present invention is to FTO Gene, FTO protein, containing FTO The gene expression cassette or recombinant plant expression vector is used to improve forage quality, promote plant growth or enhance plant resistance to adverse stress.

[0005] In order to achieve the above object, the main technical solutions adopted by the present invention include: One aspect of the present invention is to FTO Gene, FTO protein, containing FTO The gene expression cassette or recombinant plant expression vector is used to improve forage quality.

[0006] In a preferred specific embodiment of the present invention, the improving the quality of forage includes: increasing the crude protein content, soluble carbohydrate content or in vitro dry matter digestibility of the forage; or reducing the crude fiber content, acid detergent fiber content, neutral detergent fiber content or lignin content of the forage.

[0007] In a preferred embodiment of the present invention, the forage grass is a legume plant; the legume plant is alfalfa, preferably alfalfa.

[0008] Another aspect of the present invention is to FTO Gene, FTO protein, containing FTO The gene expression cassette or recombinant plant expression vector is used to promote plant growth.

[0009] In a preferred embodiment of the present invention, the promoting plant growth comprises: increasing the number of plant branches, plant height, leaf area, stem diameter, taproot length or the number of lateral roots.

[0010] Another aspect of the present invention is to FTO Gene, FTO protein, containing FTO The gene expression cassette or recombinant plant expression vector is used to improve the plant's resistance to adverse stress.

[0011] In a preferred embodiment of the present invention, the improving the plant's resistance to adverse stress is improving the plant's resistance to abiotic adverse stress; preferably, the abiotic adverse stress includes drought stress or salt stress.

[0012] In a preferred embodiment of the present invention, the plant comprises a dicotyledon or a monocotyledon; preferably a leguminous plant, and most preferably alfalfa.

[0013] For reference, the present invention provides an implementation scheme. That is, by overexpressing the coding gene of FTO protein, increasing the expression amount or activity of FTO protein, thereby improving the quality of forage, promoting plant growth or improving the resistance of plants to adverse stress, thereby increasing the crude protein content, soluble carbohydrate content or in vitro dry matter digestibility of forage; or reducing the crude fiber content, acid detergent fiber content, neutral detergent fiber content or lignin content of forage; or increasing the number of plant branches, plant height, leaf area, stem diameter, taproot length or number of lateral roots; or improving the resistance of plants to drought stress or salt stress.

[0014] A preferred embodiment of the present invention is a method for improving forage quality, promoting plant growth or improving plant resistance to adverse stress, comprising: overexpressing in a plant a codon optimized according to the preference of alfalfa. FTO Gene, FTO The expression of the gene is increased or the function or activity of the FTO protein is enhanced; for example, FTO The gene is connected to the expression control element to obtain a recombinant plant expression vector for expressing the gene in plants; the recombinant plant expression vector is transformed into plants, so that FTO The gene is overexpressed in the plant, and the resulting transgenic plant has improved forage quality or enhanced growth performance.

[0015] For reference, the present invention provides a FTO Gene plant recombinant expression vector, comprising: codon optimized according to the preference of alfalfa FTO The gene is connected to the expression control element to obtain a recombinant plant expression vector; the recombinant plant expression vector may be composed of a 5' non-coding region, the nucleotides shown in SEQ ID NO.2 and a 3' non-coding region; wherein the 5' non-coding region may include a promoter sequence, an enhancer sequence and / or a translation enhancement sequence; the promoter may be a constitutive promoter, an inducible promoter, a tissue or organ specific promoter; the 3' non-coding region may include a terminator sequence, an mRNA cleavage sequence, etc. Suitable terminator sequences may be taken from the Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase terminator regions.

[0016] The recombinant plant expression vector may also contain a selective marker gene for selecting transformed cells, for selecting transformed cells or tissues. The marker gene includes genes encoding antibiotic resistance and genes conferring resistance to herbicidal compounds. In addition, the marker gene also includes phenotypic markers, such as β-galactosidase and fluorescent protein.

[0017] The transformation protocol and the protocol for introducing the polynucleotide or polypeptide into the plant may vary depending on the type of plant or plant cell to be transformed. Suitable methods for introducing the polynucleotide into plant cells include microinjection, electroporation, Agrobacterium-mediated transformation, direct gene transfer, and high-velocity ballistic bombardment. In certain embodiments, various transient transformation methods may be used to introduce the polynucleotide into plant cells. FTO Genes are provided to plants. Transformed cells can be regenerated into stably transformed plants using conventional methods (McCormick et al. Plant Cell Reports. 1986. 5:81-84).

[0018] The present invention FTOThe nucleotide sequence of the CDS of the gene is the polynucleotide sequence shown in SEQ ID No.2; the amino acid sequence of the FTO protein is the amino acid sequence shown in SEQ ID No.1.

[0019] In addition, those skilled in the art can also optimize the polynucleotide shown in SEQ ID NO.2 to enhance the expression efficiency in plants (especially alfalfa). For example, the polynucleotide shown in SEQ ID NO.2 can be site modified to obtain a modified variant.

[0020] The "variant" means a substantially similar sequence. For polynucleotides, variants include deletions, insertions, and / or substitutions of one or more nucleotides at one or more sites in natural polynucleotides. For polynucleotides, conservative variants include those variants that do not change the encoded amino acid sequence due to the degeneracy of the genetic code. Naturally occurring variants such as these can be identified by existing molecular biology techniques. Variant polynucleotides also include polynucleotides of synthetic origin, such as polynucleotide variants that still encode FTO proteins obtained by site-directed mutagenesis or by recombinant methods (e.g., DNA shuffling). Those skilled in the art can screen or evaluate the function or activity of the protein encoded by the variant polynucleotide by the following molecular biotechnology means: DNA binding activity, interactions between proteins, activation of gene expression in transient studies, or effects of expression in transgenic plants, etc.

[0021] The present invention can also be used to obtain mutants by deleting one or several codons for amino acid residues in the DNA sequence shown in SEQ ID No. 2, and / or performing missense mutations of one or several base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to the 5′ end and / or 3′ end of the amino acid sequence of the protein encoded by its gene.

[0022] Those skilled in the art can easily adopt known methods, such as directed evolution or point mutation, to FTO The nucleotide sequence of the gene is mutated. FTO Nucleotides with 75% or higher identity to the nucleotide sequence of a gene are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as the encoded protein has the function of improving forage quality, promoting plant growth or improving plant resistance to adverse stress.

[0023] In addition, the nucleotide sequence described in the present invention can be DNA, such as cDNA, genomic DNA or recombinant DNA; it can also be RNA, such as mRNA or hnRNA.

[0024] The present invention uses alfalfa (Zhongmu No. 1) as the experimental material. FTOBased on the nucleotide sequence of the gene, codon optimization was performed according to the preference of alfalfa to construct a plant overexpression vector pCAMBIA3301-35Spro:: FTO Using Agrobacterium-mediated method, alfalfa (Zhongmu No. 1) was genetically transformed to obtain overexpression FTO The new plants with the gene have passed the intermediate test of the safety assessment of transgenic plants by the Ministry of Agriculture and Rural Affairs. FTO The number of branches, internode length, plant height, leaf size, stem diameter, taproot length, and number of lateral roots of alfalfa with the gene were significantly increased; the crude protein content, soluble carbohydrate content, and in vitro dry matter digestibility of the plant were significantly increased; the crude fiber content, acid detergent fiber content, neutral detergent fiber content, and lignin content of the plant were significantly reduced; under drought and salt stress, the drought and salt tolerance of transgenic alfalfa were significantly improved compared with the wild type, proving FTO The gene has the function of improving forage quality, resisting stress or positively regulating plant growth. The present invention has application prospects in improving forage quality or promoting plant growth.

[0025] Definitions of terms used in this invention Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods, devices and materials are now described.

[0026] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-strand or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless specifically limited otherwise, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioate, phosphoramidate, etc.). Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences and explicitly specified sequences of conservative modifications thereof. Specifically, degenerate codon substitutions can be achieved by generating a sequence in which the 3rd position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues.

[0027] "Stringent hybridization conditions" as used herein refer to conditions of low ionic strength and high temperature as known in the art. Typically, under stringent conditions, the detectable degree of hybridization of a probe to its target sequence is higher than the detectable degree of hybridization to other sequences (e.g., at least 2 times greater than background). Stringent hybridization conditions are sequence-dependent and will vary under different environmental conditions, with longer sequences specifically hybridizing at higher temperatures. Target sequences that are 100% complementary to the probe can be identified by controlling the stringency of hybridization or washing conditions. For detailed guidance on nucleic acid hybridization, reference may be made to the literature (Tijssen, Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid hybridization"). acidassays.1993). More specifically, the stringent conditions are usually selected to be about 5-10°C lower than the thermal melting point (Tm) of the specific sequence at a specified ionic strength pH. Tm is the temperature (under specified ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence in a balanced state (because the target sequence is present in excess, 50% of the probes are occupied in a balanced state at Tm). The stringent conditions may be the following conditions: wherein the salt concentration is lower than about 1.0 M sodium ion concentration at pH 7.0 to 8.3, usually about 0.01 to 1.0 M sodium ion concentration (or other salts), and the temperature is at least about 30°C for short probes (including but not limited to 10 to 50 nucleotides), and at least about 60°C for long probes (including but not limited to greater than 50 nucleotides). Stringent conditions can also be achieved by adding destabilizing agents such as formamide. For selective or specific hybridization, a positive signal can be at least two times the background hybridization, optionally 10 times the background hybridization. Exemplary stringent hybridization conditions can be as follows: 50% formamide, 5×SSC and 1% SDS, incubated at 42°C; or 5×SSC, 1% SDS, incubated at 65°C, washed in 0.2×SSC and washed in 0.1% SDS at 65°C. The wash can be performed for 5, 15, 30, 60, 120 minutes or longer.

[0028] The "plurality" mentioned in the present invention generally means 2-8, preferably 2-4; the "replacement" mentioned refers to the replacement of one or more nucleotide residues with different nucleotide residues; the "deletion" mentioned refers to the reduction in the number of nucleotide residues, that is, the lack of one or more nucleotide residues therein; the "insertion" mentioned refers to the change of the nucleotide residue sequence, which results in the addition of one or more nucleotide residues relative to the natural molecule.

[0029] The term "recombinant host cell strain" or "host cell" means a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce a recombinant host cell, such as direct uptake, transduction, f-mating, or other methods known in the art. The exogenous polynucleotide may be maintained as a non-integrating vector such as a plasmid or may be integrated into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

[0030] The term "operably linked" refers to a functional connection between two or more elements. The operably linked elements may be contiguous or non-contiguous.

[0031] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0032] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0033] The term "recombinant plant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, together with vectors with helper plasmids, are most commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, selection markers engineered to be expressed in plant cells, heterologous DNA sequences to be transcribed, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 for FTO Comparison of nucleotide sequences before and after gene codon optimization; Figure 2 Plant overexpression vector pCAMBIA3301-35Spro:: FTO Spectrum of Figure 3 For overexpression FTO Genetic alfalfa positive seedlings test results; among them, Figure 3 -a means overexpression FTO The results of PCR test of the genome of gene alfalfa positive seedlings; Figure 3 -b means overexpression FTO Figure RT-PCR test results of gene alfalfa positive seedlings; Figure 4 Wild type and overexpression FTO Genetic alfalfa phenotype diagram; among them, Figure 4 -a represents wild type and overexpression FTO Genetic alfalfa plant height phenotype diagram; Figure 4 -b is wild type and overexpression FTOGenetic alfalfa plant height statistics chart; Figure 4 -c is wild type and overexpression FTO Gene Medicago truncatula branch number map; Figure 4 -d for wild type and overexpression FTO Genetic alfalfa leaf phenotype diagram; Figure 4 -e for wild type and overexpression FTO Genetic alfalfa leaf area statistics; Figure 4 -f is wild type and overexpression FTO Genetic alfalfa stem thickness statistics; Figure 5 Wild type and overexpression FTO Genetic alfalfa root growth diagram; among them, Figure 5 -a represents wild type and overexpression FTO Genetic Alfalfa root phenotype diagram; Figure 5 -b is wild type and overexpression FTO Genetic alfalfa root length statistics; Figure 5 -c is wild type and overexpression FTO Genetic alfalfa lateral root number statistics; Figure 6 Wild type and overexpression FTO The field growth of genetically modified alfalfa; Figure 6 -a represents wild type and overexpression FTO Genetic alfalfa phenotype in the field; Figure 6 -b is wild type and overexpression FTO Plant height statistics of genetic alfalfa in the field; Figure 6 -c means overexpression FTO The number of branches of genetic alfalfa in the field; Figure 6 -d for wild type and overexpression FTO Average fresh weight per plant of genetic alfalfa in the field; Figure 7 Wild type and overexpression FTO Quality analysis of genetic alfalfa; Figure 7 -a is crude protein content; Figure 7 -b is the lignin content; Figure 7 -c is crude fiber content; Figure 7 -d is the neutral detergent fiber content; Figure 7 -e is the acid detergent fiber content; Figure 7 -fSoluble carbohydrate content; Figure 7 -g is the in vitro dry matter digestibility; Figure 7 -h is the relative feed value; Figure 7 -i is the relative forage quality; Figure 8 Wild type and overexpression FTOGenetic alfalfa drought resistance and salt tolerance phenotype diagram; among them, Figure 8 -a represents wild type and overexpression FTO The phenotype of gene alfalfa under drought stress for 10 days; Figure 8 -b is wild type and overexpression FTO The phenotype of gene alfalfa under 200 mM NaCl stress for 10 days; Fig. 9 Wild type and overexpression FTO Physiological index detection diagram of genetic alfalfa under drought and salt stress; among them, Fig. 9 -a is the relative conductivity; Fig. 9 -b is the soluble sugar content; 9-c is the actual photosynthetic efficiency; 9-d is the relative water content; 9-e is the chlorophyll content; 9-f is the malondialdehyde content. DETAILED DESCRIPTION

[0035] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention.

[0036] Test Example 1 FTO Codon Optimization and Synthesis of Gene CDS Sequences Download from NCBI (https: / / www.ncbi.nlm.nih.gov / ) database FTO The gene sequence and the protein coding sequence of the gene (gene number: NM_001080432.3) were codon-optimized according to alfalfa preference and synthesized by the company. FTO Comparison of nucleotide sequences before and after gene codon optimization Figure 1 As shown, the nucleotide sequence alignment rate before and after optimization was 77.47%.

[0037] The amino acid sequence of the FTO protein is as follows: MKRTPTAEEREREAKKLRLLEELEDTWLPYLTPKDDEFYQQWQLKYPKLILREASSVSEELHKEVQEAFLTLHKHGCLFRDLVRIQGKDLLTPVSRILIGNPGCTYKYLNTRLFTVPWPVKGSNIKHTEAEIAAACETFLKLNDYLQIETIQALEELAAKEKANEDAVPLCMSADFPRVGMGSSYNGQDEVDIKSRAAYNVTLLNFMDPQKMPYLKEEPYFGMGKMAVSWHHDENLVDRSAVAVYSYSCEGPEEESEDDSHLEGRDPDIWHVGFKISWDIETPGLAIPLHQGDCYFMLDDLNATHQHCVLAGSQPRFSSTHRVAECSTGTLDYILQRCQLALQNVCDDVDNDDVSLKSFEPAVLKQGEEIHNEVEFEWLRQFWFQGNRYRKCTDWWCQPMAQLEALWKKMEGVTNAVLHEVKREGLPVEQRNEILTAILASLTARQNLRREWHARCQSRIARTLPADQKPECRPYWEKDDASMPLPFDLTDIVSELRGQLLEAKP* (SEQ ID NO.1).

[0038] According to alfalfa preference FTO

[0039] Test Example 2 FTO Genetic transformation, screening and functional identification experiments 1 pCAMBIA3301-35Spro:: FTO Construction of plant expression vector The enzyme cutting sites FTO The PCR product of gene (SEQ ID NO.2) and the empty vector pCAMBIA3301 were used for Nco I and Eco 91I double digestion, recovery of digestion products, use T4 DNA ligase to connect the target gene fragment and expression vector, and transform the ligation product into competent E. coli. FTO Vector map Figure 2 shown.

[0040] Take out the competent cells of E. coli from the -80 ℃ refrigerator and thaw them on ice. When the competent cells have just thawed, add the ligation product, flick to mix, and place in an ice-water bath for 30 min. After the ice-water bath, heat shock in a 42 ℃ metal bath for 30 s and immediately place on ice for more than 3 min. Add 700 μL of LB medium without antibiotics, mix well, and recover at 37 ℃, 200 rpm for 1 h. After the recovery, centrifuge at low speed for 2 min to collect the cells, discard part of the supernatant, retain 150 μL of the supernatant, blow and resuspend the cells, evenly spread on LB solid medium (containing 100 mg / mL Kan) plates, invert and culture in a 37 ℃ incubator overnight, pick a single clone colony and inoculate it in 1mL of LB liquid medium containing Kan (100 mg / mL), and culture at 37 ℃, 200 rpm until the bacterial solution becomes turbid, then perform bacterial solution PCR to detect the transformation results. Bacterial liquid PCR: Using turbid bacterial liquid as template and primers FTO-F / R, positive clone detection was performed. The specific PCR reaction system and reaction procedure are shown in Tables 1 and 2.

[0041] The nucleotide sequences of primers FTO-F and FTO-R are as follows: FTO-F: ATGAAGAGGACACCTACTGCTGAGG (SEQ ID NO.3); FTO-R: TCAAGGTTTAGCCTCAAGAAGCTG (SEQ ID NO. 4).

[0042] Table 1 Bacterial liquid PCR reaction system

[0043] Table 2 PCR reaction procedure

[0044] The PCR amplification products were detected by gel electrophoresis, and the correct positive clone samples were selected by their band size and sent to the company for sequencing. The positive clones were screened according to the sequencing results, and the vector was named pCAMBIA3301-35Spro:: FTO . To the vector containing pCAMBIA3301-35Spro:: FTO Glycerol (final concentration 20%) was added to the Escherichia coli bacterial solution, and the solution was quickly frozen with liquid nitrogen and stored in a -80°C refrigerator.

[0045] Take the competent cells of Agrobacterium tumefaciens (GV3101) stored in this laboratory out of the -80 ℃ freezer, thaw on ice, add 5 μL of the recombinant expression vector when the competent cells have just thawed, and flick to mix. In turn, place in an ice-water bath for 5 min, freeze in liquid nitrogen for 5 min, heat shock in a 37 ℃ metal bath for 5 min, and finally place in an ice-water bath for more than 5 min. Add 700 μL of YEB medium without antibiotics, mix well, and resuscitate at 28 ℃, 200 rpm for 2 h-3 h. After the recovery, centrifuge at low speed for 2 min to collect the cells, discard part of the supernatant, retain 150 μL of the supernatant, blow and resuspend the cells, and evenly spread them on a YEB solid medium (containing 50 μg / mL Kan, 20 μg / mL Rif) plate, and invert it in a 28 ℃ incubator for 2-3 days. After the culture is completed, pick a white monoclonal colony and inoculate it into 1 mL of YEB liquid medium containing 50 μg / mL Kan and 20 μg / mL Rif. Cultivate at 28 °C and 200 rpm until the bacterial solution becomes turbid. Then perform bacterial solution PCR to detect the transformation results. Bacterial solution PCR: Use the turbid bacterial solution as the PCR reaction template, the reaction primers are FTO-F / R, and perform positive clone detection. The PCR reaction system and procedure are shown in Tables 1 and 2.

[0046] Contains the expression vector pCAMBIA3301-35Spro:: FTO Agrobacterium colony positive clone detection Figure 3 -a, the correct positive clone sample was picked out according to the size of the band, and the sample containing the vector pCAMBIA3301-35Spro:: FTO into Agrobacterium containing the vector pCAMBIA3301-35Spro:: FTO Add glycerol (final concentration is 20%) to the Agrobacterium bacterial solution, freeze it quickly with liquid nitrogen and store it in a -80℃ refrigerator.

[0047] 2 Genetic transformation of alfalfa 2.1 Genetic transformation of alfalfa The plant expression vector pCAMBIA3301-35Spro:: FTOThe bacteria are introduced into alfalfa through Agrobacterium-mediated genetic transformation, and then transplanted into a greenhouse after infection, co-cultivation, screening culture, callus culture, differentiation culture, bud culture, rooting culture, and seedling hardening.

[0048] (1) Cultivation of alfalfa: Spread the seeds of alfalfa Zhongfu No. 1 flat on a sterilized culture dish with filter paper, add water to germinate, and after about 3-4 days, when the first true leaf grows, move it to a prepared soil pot. Mix nutrient soil and vermiculite in a ratio of 1:1, put it in the pot, and let it fully absorb water through the holes at the bottom.

[0049] (2) Preparation of infection solution: Pipette 100 uL containing plasmid pCAMBIA3301-35Spro:: FTO The Agrobacterium solution was added to 100 mL YEB liquid containing 50 μg / mL Kan and 20 μg / mL Rif, placed in a 250 mL conical flask, and cultured overnight at 28°C and 200 rpm until OD 600 =0.8-1.0, divide the shaken bacterial solution into 50 mL centrifuge tubes in the clean bench, centrifuge at 4000rpm for 10 min, pour out the supernatant, and dilute it with MS resuspension solution to OD 600 =0.3-0.4, placed in a 250 mL conical flask.

[0050] (3) Preparation of sterile explants: Take healthy leaves of Zhongmu No. 1 and place them in a culture bottle. Wash them with sterile water. Add 75% alcohol and soak for 2 min. Add 1% sodium hypochlorite (containing 1‰ Tween-20, v / v) for 5-8 min. Wash them with sterile water 5 times, 1 min each time.

[0051] (4) Leaf infection: Place the cleaned leaves on sterile filter paper to absorb the surface moisture, and then place the treated leaves in the infection solution. Then, evacuate the infection solution and leaves at a pressure of 620 mmHg (0.082 MPa) for 10 minutes; then place them in an ultrasonic device containing an ice-water mixture for 2-3 minutes, and observe the state of the leaves during the ultrasonic process; evacuate again for 10 minutes, and place them on a clean bench for 5-10 minutes.

[0052] (5) Tissue culture: Gently remove the leaves with tweezers, place them on sterile filter paper to dry, transfer the leaves to the co-culture medium, and culture them in the dark at 24°C for 2 days. When the leaves become hard (the edges are slightly curled), place the leaves in the screening medium and culture them in the dark for 14 days. After 14 days, subculture to the callus medium and continue to culture in the dark for 14 days. Transfer the callus tissue to the differentiation medium and place it in a light incubator (16 h light / 8 h dark) for 7-10 days to differentiate and sprout. After obvious buds appear, place it in the sprouting medium and continue to culture. Subculture every 14 days for 3-4 weeks. After the true leaves grow out, place it in the rooting medium and root it in about 2 weeks. When the tissue culture seedlings grow for about 15 days and the root system is well developed, transplant them after 7 days of hardening. Wash the culture medium at the roots of the transformed seedlings with clean water, transplant them into nutrient soil, and culture them in the greenhouse.

[0053] The formula of alfalfa culture medium is shown in Table 3 below: Table 3 Alfalfa culture medium formula

[0054] In a clean bench, alfalfa leaves obtained by tissue culture were cut and genomic DNA was extracted using a plant genomic DNA extraction kit. Using genomic DNA as a template, PCR amplification was performed using primers 35S-F and FTO-R. The PCR product was detected by agarose gel electrophoresis. The PCR reaction system and reaction procedure are shown in Table 4 and Table 2. The detection results of the PCR amplification product by gel electrophoresis are shown in Figure 3 -a, the results show that overexpression has been obtained FTO Gene-positive alfalfa seedlings.

[0055] The nucleotide sequences of primers 35S-F and FTO-R are as follows: 35S-F: 5'-TGAGACTTTTCAACAAAGGGTAATATC-3' (SEQ ID NO. 5); FTO-R: 5'-TCAAGGTTTAGCCTCAAGAAGCTG-3' (SEQ ID NO. 4).

[0056] Table 4 PCR reaction system

[0057] 2.2 Detection of positive transgenic alfalfa seedlings (1) Genome extraction: Cut transgenic alfalfa leaves, grind them in liquid nitrogen for later use, and use a plant genomic DNA extraction kit to obtain genomic DNA.

[0058] (2) Genomic PCR detection: Using the genome as a template, the genes are tested separately FTO and marker genes Bar Test results such as Figure 3 -a, transgenic lines 1#, 4#, 8#, 11#, 12#, 13#, 25#, 29#, 31#, 32#, 34#, 41# have clear FTO Genes and Bar The gene bands indicate that the target gene has been successfully transferred into the alfalfa genome.

[0059] (3) cDNA synthesis: Cut transgenic alfalfa leaves, grind them in liquid nitrogen for later use, and use a plant total RNA extraction kit to obtain total RNA; use a reverse transcription kit to obtain cDNA, and the obtained cDNA is stored at -20°C.

[0060] (4) RT-PCR detection: Using the cDNA obtained by reverse transcription as a template, PCR amplification was performed using primers 35S-F and FTO-R. The PCR product was detected by agarose gel electrophoresis. The detection results are shown in Figure 3 -b. The results showed that in wild-type plants, no gene FTO Band, in heterologous overexpression plants, gene FTO The target band indicates that the target gene can be transcribed and expressed normally in the transgenic strain.

[0061] 3. Functional identification test of transgenic alfalfa 3.1 Results of evaluation of the growth performance of transgenic alfalfa After about 15 days of growth, the tissue culture seedlings were transplanted to the greenhouse for growth after hardening. After 2 months of growth, the number of branches was measured. Figure 4 -c shows that the average number of branches in the wild type is 4, while the overexpression FTO The average number of branches of the gene plants was 7, which was significantly higher than that of the wild type.

[0062] Prepare the cuttings of transgenic positive seedlings and wild-type plants. The cuttings are processed according to the principle of "one node, one bud, one leaf". The incision is kept "flat on top and slanted on the bottom". The cuttings are 4-6 cm long. After the lower part of the cuttings is soaked in rooting liquid for 2.5 hours, they are inserted into the prepared soil pot (nutrient soil: vermiculite = 1:1, soaked with rooting liquid). After 40 days of growth, the plant height, leaf area, stem diameter, taproot length and number of lateral roots are measured. The test results are as follows: Figure 4-Figure 5 As shown, Figure 4 -a represents wild type and overexpression FTO Genetic alfalfa plant height phenotype, Figure 4 -b Wild type and overexpression FTO The statistical chart of the plant height of genetically modified alfalfa showed that the average plant height of the wild type was 12 cm, while the average plant height of the transgenic positive seedlings was 16 cm, 18 cm, and 22 cm, which were significantly higher than the wild type. Figure 4-d for wild type and overexpression FTO Genetic alfalfa leaf phenotype diagram; Figure 4 -e for wild type and overexpression FTO Genetic alfalfa leaf area statistics, the results show that the wild type leaf area is 900 mm 2 , the leaf area of ​​transgenic positive seedlings is 1000-1200 mm 2 , the leaves are significantly enlarged; Figure 4 -f is wild type and overexpression FTO Gene alfalfa stem thickness statistics, the results show that compared with the wild type, overexpression FTO The stem thickness of genetic alfalfa increased significantly; Figure 5 -a represents wild type and overexpression FTO Genetic alfalfa root phenotype diagram, Figure 5 -b is wild type and overexpression FTO Genetic alfalfa root length statistics chart, Figure 5 -c is wild type and overexpression FTO The statistical chart of the number of lateral roots of genetically modified alfalfa showed that the main root length of the wild type was 11 cm, while the main root lengths of the transgenic positive seedlings were 14 cm, 18 cm, and 25 cm, which were significantly longer than the wild type; the number of lateral roots of the wild type was 20, while the number of lateral roots of the transgenic positive seedlings were 42, 70, and 58, which were significantly more than the wild type.

[0063] Prepare transgenic positive seedlings and wild-type cuttings. The branch treatment follows the principle of "one node, one bud, one leaf". The incision should be "flat on top and slanted on the bottom". The cuttings should be 4-6 cm. After the lower part of the cuttings is soaked in rooting liquid for 2.5 hours, they are inserted into the field (rooting will take place in about 25 days). After 90 days of field growth, the plant height, number of branches and average plant fresh weight are measured. The test results are as follows: Figure 6 As shown, Figure 6 -a represents wild type and overexpression FTO The phenotype of genetic alfalfa in the field, Figure 6 -b is a statistical diagram of plant height. The results show that the average plant height of the wild type in the field is 92 cm, and the average plant height of the transgenic positive seedlings is 96 cm, 106 cm, and 107 cm, which are significantly higher than the wild type; Figure 6 -c is wild type and overexpression FTO The number of branches of transgenic alfalfa in the field showed that the average number of branches of the wild type was 15, while the average number of branches of the transgenic positive seedlings was 21, 22, and 24, which were significantly more than the wild type. Figure 6 -d for wild type and overexpression FTO The average fresh weight of alfalfa per plant in the field was 143 g for the wild type, and 159 g, 181 g, and 197 g for the transgenic positive seedlings, which were significantly higher than the wild type.

[0064] 3.2 Results of nutritional quality testing of transgenic alfalfa The nutritional quality of alfalfa is mainly affected by crude protein, soluble carbohydrates and other substances, while the digestibility of alfalfa is mainly affected by non-digestible tissues such as crude fiber and lignin. FTO In this study, the quality of wild-type and overexpressed alfalfa was analyzed by near infrared analysis system. FTO Genetic alfalfa plants were used as controls for forage quality determination.

[0065] Harvest the above-ground parts of alfalfa plants in the field. Immediately weigh the fresh weight using a scale and put it into a kraft paper bag. Use a constant temperature forced air drying oven at 55±5°C to dry to constant weight (about 5 days). After sufficient grinding, the following alfalfa quality parameters were measured using a near-infrared reflectance spectroscopy system: crude protein, crude fiber, acid detergent fiber, neutral detergent fiber, soluble carbohydrates, lignin content and in vitro dry matter digestibility based on dry matter, and the relative feed value and relative forage quality were calculated. The test results are as follows: Figure 7 As shown, Figure 7 -a is crude protein content; Figure 7 -b is the lignin content; Figure 7 -c is crude fiber content; Figure 7 -d is the neutral detergent fiber content; Figure 7 -e is the acid detergent fiber content; Figure 7 -fSoluble carbohydrate content; Figure 7 -g is the in vitro dry matter digestibility; Figure 7 -h is the relative feed value; Figure 7 -i is the relative forage quality. The results showed that the crude protein content, soluble carbohydrate content, and in vitro dry matter digestibility of the transgenic positive seedlings were significantly higher than those of the wild type; the crude fiber content, acid detergent fiber content, neutral detergent fiber content, and lignin content of the transgenic positive seedlings were significantly lower than those of the wild type; the relative forage quality and relative feed value of the transgenic positive seedlings were significantly higher than those of the wild type. Considering the above indicators comprehensively, overexpression FTO Genetic alfalfa showed better forage quality.

[0066] 3.3 Results of drought and salt tolerance tests on transgenic alfalfa The transgenic alfalfa and wild type at 60 days old were subjected to drought and high salt stress treatments, respectively. Drought stress lasted for 10 days without watering, and high salt stress was watered twice with 200 mM NaCl saline, with saline watering every 3-4 days. The phenotype was observed and physiological indicators were measured.

[0067] The leaves of alfalfa seedlings were taken to measure various physiological and biochemical indicators. The relative conductivity was measured by conductivity method, the malondialdehyde content was measured by thiobarbituric acid colorimetry, the soluble sugar content was measured by anthrone colorimetry, the chlorophyll content was measured by a handheld chlorophyll meter, and the actual photosynthetic efficiency was measured by an OS5p modulated chlorophyll fluorescence meter. The relative water content was measured according to the method of Wu Qiangsheng's "Plant Physiology Experiment Guide".

[0068] The test results are as follows Figure 8 As shown, Figure 8 -a represents wild type and overexpression FTO The phenotype of alfalfa under drought stress for 10 days showed that more than 80% of the leaves of the wild type wilted and dried up after 10 days of drought stress. FTO More than 80% of the leaves of genetic alfalfa are green; Figure 8 -b is wild type and overexpression FTO The phenotype of alfalfa under 200 mM NaCl stress for 10 days. The results showed that 30% of the leaves of the wild type turned yellow and dried up after 200 mM NaCl stress for 10 days. FTO Only a few leaves of the gene-expressing alfalfa began to turn yellow, and more than 90% of the leaves were green, indicating that the overexpression FTO Genetically modified alfalfa significantly improved its drought and salt resistance compared to the wild type.

[0069] Wild type and overexpression FTO The results of the physiological index test of genetic alfalfa under drought and salt stress are as follows Fig. 9 As shown, Fig. 9 -a is the relative conductivity; Fig. 9 -b is soluble sugar content; 9-c is actual photosynthetic efficiency; 9-d is relative water content; 9-e is chlorophyll content; 9-f is malondialdehyde content. The results showed that under drought and high salt stress, the soluble sugar content, relative water content, actual photosynthetic efficiency, and chlorophyll content of transgenic alfalfa were significantly higher than those of the wild type, and the relative conductivity was significantly lower than that of the wild type, indicating that the degree of cell damage in transgenic alfalfa was significantly lower than that of the wild type.

Claims

1. FTO Gene, FTO protein 、 contain FTO Application of gene expression cassette or recombinant plant expression vector in improving forage quality.

2. The use according to claim 1, characterized in that: The improving of forage quality includes: increasing the crude protein content, soluble carbohydrate content or in vitro dry matter digestibility of the forage; or reducing the crude fiber content, acid detergent fiber content, neutral detergent fiber content or lignin content of the forage.

3. The use according to claim 1 or 2, characterized in that: The forage grass is a legume plant; wherein the legume plant is alfalfa.

4. FTO Gene, FTO protein 、 contain FTO Application of gene expression cassette or recombinant plant expression vector in promoting plant growth.

5. The use according to claim 3, characterized in that: The promoting plant growth includes: increasing the number of plant branches, plant height, leaf area, stem thickness, taproot length or lateral root number.

6. FTO Gene, FTO protein 、 contain FTO The application of gene expression cassette or recombinant plant expression vector in improving the resistance of plants to adverse stress.

7. The use according to claim 6, characterized in that: The improving the plant's resistance to adverse stress includes improving the plant's resistance to abiotic adverse stress; wherein the abiotic adverse stress includes drought stress or salt stress.

8. The use according to claim 4 or 6, characterized in that: The plants include dicotyledonous plants or monocotyledonous plants.

9. The use according to any one of claims 1, 4 or 6, characterized in that: Will FTO Gene overexpression in plant cells or tissues, including: FTO The plant recombinant expression vector of the gene is transformed into plant cells or plant tissues for FTO Overexpression of genes.

10. The use according to any one of claims 1, 4 or 6, characterized in that: Said FTO The gene was codon optimized based on the preference of alfalfa FTO The gene has a polynucleotide sequence as shown in SEQ ID No.2; the amino acid sequence of the FTO protein is the amino acid sequence as shown in SEQ ID No.1.

Images