Melanoma cell marker detection method based on USP45-MRGPRF interaction and application

Abstract

The invention belongs to the technical field of melanoma marker detection, and discloses a melanoma cell marker detection method based on USP45-MRGPRF interaction and application of the melanoma cell marker detection method. A deubiquitination enzyme USP45 controls the ubiquitination level and stability of MRGPRF in melanoma cells; uSP45 controls proliferation, cell cycle, apoptosis, migration and invasion ability of melanoma cells by regulating the stability of MRGPRF protein; the USP45 can effectively inhibit the growth of melanoma in a xenotransplantation animal model, which indicates that the USP45-MRGPRF ubiquitin proteasome system can be used as a melanoma molecular therapeutic target and is used for diagnosing, preparing and screening melanoma therapeutic drugs.

Description

Technical Field

[0001] The present invention belongs to the technical field of melanoma marker detection, and in particular relates to a melanoma cell marker detection method based on USP45-MRGPRF interaction and application thereof. Background Art

[0002] Melanoma is a malignant skin cancer, and its incidence and mortality have shown a rapid upward trend in recent years, becoming the third most common skin cancer after basal cell carcinoma and squamous cell carcinoma. Although targeted therapy and immunotherapy have significantly improved the survival rate of melanoma patients, the treatment of advanced melanoma patients still faces severe challenges due to the limited effective response rate and the gradual emergence of drug resistance.

[0003] In the study of melanoma, deubiquitinases are an important class of regulatory proteins whose main function is to increase the stability of substrate proteins. Among them, the ubiquitin-specific protease (USP45) family has attracted much attention due to its large number of members and key roles in tumorigenesis. However, the functions of many members of this family are still unclear.

[0004] MRGPRF is a recently discovered melanoma tumor suppressor gene, whose expression in melanoma tissue is significantly lower than that in adjacent tissues, and its expression level is positively correlated with the survival rate of melanoma patients. However, the post-transcriptional regulatory mechanism of MRGPRF protein needs to be further studied.

[0005] It is worth noting that melanoma cells have the characteristics of evading treatment and metastasizing to other organs. Once metastasis occurs, conventional treatments are often difficult to effectively control. Therefore, early diagnosis and intervention become the key to effective treatment of melanoma.

[0006] Ubiquitination plays an important role in the pathogenesis of melanoma and is closely related to the proliferation of melanoma cells, tumor progression and poor prognosis. The ubiquitination process can be reversed by deubiquitinating enzymes, among which the function of USP45 family members in melanoma is particularly noteworthy. Studies have found that several USP45s affect the growth, apoptosis, division and migration of melanoma cells and are related to the survival and prognosis of melanoma patients.

[0007] Further studies have found that MRGPRF is not only related to the division and migration of skin melanoma tissues and cells, as well as the growth and metastasis of xenograft tumors, but its expression is also closely related to the prognosis of skin melanoma patients. At the same time, studies have shown that increased ubiquitination levels lead to accelerated degradation of MRGPRF protein and shortened half-life, thereby impairing its tumor suppressor function.

[0008] By deeply analyzing the transcriptome sequencing (RNAseq) data of melanoma patients in public databases and corresponding clinical data, the research team screened forty USP45s that regulate the stability of MRGPRF protein, and found that the expression of USP45 in melanoma tissues was significantly lower than that in adjacent cancer tissues, just like MRGPRF. Moreover, the prognostic indicators such as the overall survival rate of melanoma patients with high USP45 expression were also better than those of patients with low expression.

[0009] This discovery reveals that USP45, as a new melanoma tumor suppressor gene, can regulate the stability of MRGPRF protein through the ubiquitination proteasome system, thereby participating in the development of melanoma. This discovery not only clarifies the targeting value of USP45 as a tumor suppressor gene in melanoma treatment, but also provides a new potential target for melanoma detection and an important theoretical basis for the development of related therapeutic drugs.

[0010] Through the above analysis, the problems and defects of the prior art are as follows:

[0011] MRGPRF is a recently discovered melanoma tumor suppressor gene. Its expression in melanoma tissue is significantly lower than that in adjacent adjacent tissues. Its expression level is positively correlated with the survival rate of melanoma patients. However, the post-transcriptional regulatory mechanism of MRGPRF protein has not yet been studied.

[0012] The expression of USP45 in melanoma tissues is correlated with the expression of MRGPRF, but it is not clear whether USP45 plays the role of a melanoma tumor suppressor gene by stabilizing the protein of MRGPRF. There is no relevant research on the role and regulatory mechanism of the USP45-MRGPRF-related ubiquitination proteasome system in melanoma. Summary of the invention

[0013] In view of the problems existing in the prior art, the present invention provides a method and application of detecting melanoma cell markers based on USP45-MRGPRF interaction.

[0014] The present invention is achieved in this way: a melanoma cell marker detection method based on USP45-MRGPRF interaction and its application include:

[0015] Step 1: construct 40 USP45 overexpression vectors, co-transfect 293T cells with MRGPRF carrying luciferase, and screen USP45 that enhances the stability of MRGPRF based on luciferase activity; verify the expression difference of USP45 in melanoma tissue and normal skin tissue by immunohistochemistry; and use bioinformatics analysis to evaluate the correlation between USP45 expression in melanoma tissue and patient prognosis;

[0016] Step 2, detect the expression of USP45 in melanoma cells, and verify the role of USP45 in melanoma cells by overexpressing or knocking down USP45 to verify cell proliferation, cell cycle, apoptosis, migration and invasion;

[0017] Step 3: Overexpress USP45 and MRGPRF in melanoma cells, and detect their interaction by immunoprecipitation and GST Pulldown. Construct USP45 functional domain mutants and domain truncation mutants, and study their binding sites with MRGPRF and functional sites that affect MRGPRF ubiquitination by immunoprecipitation. Construct different ubiquitin mutants, and study the types of MRGPRF ubiquitination affected by USP45 by immunoprecipitation. Overexpress or knock down USP45 in melanoma cells to evaluate its effects on the ubiquitination level and stability of MRGPRF.

[0018] Step 4, knock down or overexpress MRGPRF in melanoma cells with overexpression or knockdown of USP45, and verify through recovery experiments whether USP45 regulates melanoma cells by enhancing the stability of MRGPRF;

[0019] Step 5. Finally, USP45-overexpressing stable melanoma cells and xenograft models were constructed, and in vivo experiments were performed to verify its effect on melanoma growth.

[0020] Another object of the present invention is to provide an application system of USP45-MRGPRF interaction in the detection of melanoma markers, comprising:

[0021] A screening module was used to construct 40 USP45 overexpression vectors, which were co-transfected with MRGPRF carrying luciferase into 293T cells, and USP45 that enhanced the stability of MRGPRF was screened based on luciferase activity; the expression difference of USP45 in melanoma tissue and normal skin tissue was verified by immunohistochemistry; and the correlation between the expression of USP45 in melanoma tissue and the prognosis of patients was evaluated by bioinformatics analysis;

[0022] The validation module is used to detect the expression of USP45 in melanoma cells. By overexpressing or knocking down USP45, cell proliferation, cell cycle, apoptosis, migration and invasion are verified to reveal the role of USP45 in melanoma cells.

[0023] Evaluation module, used to overexpress USP45 and MRGPRF in melanoma cells, and detect the interaction between the two by immunoprecipitation and GST Pulldown; construct USP45 functional domain mutants and domain truncation mutants, and study their binding sites with MRGPRF and functional sites affecting MRGPRF ubiquitination by immunoprecipitation; construct different ubiquitin mutants, and study the types of MRGPRF ubiquitination affected by USP45 by immunoprecipitation; overexpress or knockdown USP45 in melanoma cells to evaluate its effects on the ubiquitination level and stability of MRGPRF;

[0024] A regulatory module is used to knock down or overexpress MRGPRF in melanoma cells in which USP45 is overexpressed or knocked down, and to verify through a recovery experiment whether USP45 plays a regulatory role on melanoma cells by enhancing the stability of MRGPRF;

[0025] The building blocks were used to construct USP45-overexpressing stable melanoma cells and xenograft models, and in vivo experiments were performed to verify their effects on melanoma growth.

[0026] Another object of the present invention is to provide a method for detecting melanoma based on the USP45-MRGPRF interaction ubiquitin proteasome system, comprising the following steps:

[0027] The expression vectors of USP45 and MRGPRF were constructed and co-transfected into melanoma cells;

[0028] The interaction between USP45 and MRGPRF was detected by co-immunoprecipitation and GST pulldown techniques;

[0029] The effect of USP45 on the ubiquitination level and stability of MRGPRF was evaluated to enable the detection of melanoma.

[0030] Further, the method further comprises the following steps:

[0031] 1. Construct USP45 functional domain mutants and domain truncation mutants to study its binding sites with MRGPRF and the functional sites that affect MRGPRF ubiquitination;

[0032] 2. Based on the effect of USP45 on the type and level of MRGPRF ubiquitination, provide a theoretical basis for improving treatment methods and drug development for melanoma.

[0033] Further, the method further comprises the following steps:

[0034] Overexpression or knockdown of USP45 in melanoma cells further verified its effects on melanoma cell proliferation, cell cycle, apoptosis, migration and invasion;

[0035] Melanoma cells and xenograft models with stable overexpression of USP45 were constructed, and in vivo experiments were performed to verify its effect on melanoma growth, thereby providing experimental basis for the treatment of melanoma.

[0036] The present invention provides a method for diagnosing melanoma, the method comprising the following steps:

[0037] 1. Construct an expression vector containing the USP45 gene, which can efficiently express the USP45 protein;

[0038] 2. Transfect the constructed USP45 expression vector into melanoma cells that already express MRGPRF protein, and ensure that USP45 protein is expressed in the cells through appropriate transfection technology;

[0039] 3. Use molecular biology techniques, such as Western Blot or real-time quantitative PCR, to detect the expression level of USP45 protein in transfected cells, as well as the effect of USP45 on the expression of specific markers or cell biological behavior of melanoma cells;

[0040] 4. Based on the expression of USP45 protein and the cellular changes it causes, evaluate its diagnostic value for melanoma, thereby achieving accurate diagnosis of melanoma.

[0041] The present invention further provides a method for combined diagnosis of melanoma based on the interaction between USP45 and MRGPRF, and the use of USP45 as a potential drug target, the method comprising:

[0042] 1) Combined diagnostic method: First, confirm the natural expression of MRGPRF in melanoma cells, and then transfect the cells with expression vectors of USP45 or its mutants (designed for specific functions). By comparing the effects of different USP45 variants on MRGPRF function and cell status, the role of the USP45-MRGPRF complex in the development of melanoma is evaluated. Combined with a variety of molecular biology and cell biology methods, such as flow cytometry, cell proliferation / apoptosis detection, etc., the effect of the interaction between USP45 and MRGPRF on the characteristics of melanoma is comprehensively analyzed, thereby establishing the effectiveness of USP45-MRGPRF as a combined diagnostic marker for melanoma.

[0043] 2) USP45 as a drug target: Based on the key role of USP45 in melanoma cells and its interaction with MRGPRF, USP45 is proposed as a potential target for the development of new anti-melanoma drugs. Small molecule inhibitors or activators targeting USP45 are designed and screened, and their potential to inhibit melanoma growth, promote cell apoptosis or enhance immunotherapy effects is verified through in vitro and in vivo experiments, providing new strategies and directions for the treatment of melanoma. Further, the following steps are also included:

[0044] Construct USP45 functional domain mutants and domain truncation mutants to study its binding site with MRGPRF and the functional site that affects MRGPRF ubiquitination;

[0045] Based on the effect of USP45 on the ubiquitination type and level of MRGPRF, a theoretical basis is provided for improving treatment methods and drug development for melanoma.

[0046] Further, the method further comprises the following steps:

[0047] Overexpression or knockdown of USP45 in melanoma cells further verified its effects on melanoma cell proliferation, cell cycle, apoptosis, migration and invasion;

[0048] Melanoma cells and xenograft models with stable overexpression of USP45 were constructed, and in vivo experiments were performed to verify its effect on melanoma growth, thereby providing experimental basis for the treatment of melanoma.

[0049] In combination with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0050] First, luciferase screening experiments confirmed that USP45 can significantly improve the stability of MRGPRF protein. The results of immunohistochemistry and bioinformatics analysis showed that the expression level of USP45 in melanoma tissue was significantly lower than that in adjacent cancer tissues, and its expression level was positively correlated with the survival rate of melanoma patients.

[0051] Cell biology results showed that overexpression of USP45 could significantly inhibit cell proliferation of melanoma cells, hinder cell cycle progression, promote cell apoptosis, and weaken cell migration and invasion. Conversely, knocking down USP45 in melanoma cells led to increased cell proliferation, accelerated cell cycle progression, and enhanced cell migration and invasion.

[0052] At the molecular level, USP45 binds to MRGPRF through its deubiquitinase catalytic domain and reduces its K63 ubiquitination level, thereby increasing its stability.

[0053] Further in vitro experiments showed that knocking down MRGPRF in melanoma cells with overexpression of USP45 significantly promoted cell proliferation, accelerated cell cycle progression, reduced cell apoptosis, and enhanced cell migration and invasion. Conversely, overexpressing MRGPRF in melanoma cells with knockdown of USP45 reduced cell proliferation, hindered cell cycle progression, and weakened cell migration and invasion.

[0054] In a melanoma xenograft model, USP45 overexpression significantly inhibited melanoma growth.

[0055] Second, as auxiliary evidence of the inventiveness of the claims of the present invention, it is also reflected in the following important aspects:

[0056] (1) The expected benefits and commercial value of the technical solution of the present invention after transformation are:

[0057] For melanoma, whose morbidity and mortality rates are rising rapidly, existing targeted and immunotherapies have great limitations. This invention provides a new target for the treatment of melanoma, and is expected to achieve early detection of melanoma before clinical symptoms appear, predict the prognosis of melanoma patients, and provide certain support for prolonging the lives of patients and advancing medical research.

[0058] (2) The technical solution of the present invention fills the technical gap in the industry at home and abroad:

[0059] At present, only MRGPRF is found to be a tumor suppressor gene of melanoma, and its post-transcriptional regulatory mechanism is still unclear. The present invention clarifies that USP45 binds to MRGPRF through its deubiquitinase catalytic domain, thereby increasing its stability, and by stabilizing the expression of MRGPRF, it inhibits the proliferation of melanoma cells and weakens their invasion and migration capabilities. This further improves and expands the current scheme for the detection and treatment of melanoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 It is a melanoma cell marker detection method based on USP45-MRGPRF interaction and an application flow chart provided in an embodiment of the present invention.

[0061] Figure 2 It is a structural block diagram of the application system of USP45-MRGPRF interaction in melanoma marker detection provided by an embodiment of the present invention.

[0062] Figure 3This is the effect of overexpression of 40 USP45s provided in the embodiment of the present invention on the fluorescence intensity of MRGPRFNanoluc. The results of the dual fluorescein activity assay showed that the fluorescence intensity in HEK293T cells overexpressing USP45 was the highest, and the fluorescence intensity in HEK293T cells overexpressing USP4514 was the lowest.

[0063] Figure 4 The effects of overexpression of USP45, USP4530 and USP4520 on the expression of MRGPRF protein in HEK293T cells provided by the embodiments of the present invention. (A) The immunoblotting experimental data show that overexpression of USP45 can significantly increase the expression level of FlagMRGPRF protein in HEK293T cells, while USP4530 and USP4520 have no significant effect on the protein level of FlagMRGPRF. (B) Grayscale statistics of FlagMRGPRF protein.

[0064] Figure 5 The expression of USP45 provided in the embodiments of the present invention is lower in melanoma tissue than in adjacent tissues. (A) Immunohistochemistry results show that the expression of USP45 protein in melanoma tissue is lower than that in normal skin epidermal tissue. (B) Statistical analysis results of immunohistochemistry results, a single data point represents the numerical value of a sample. (C, D) Bioinformatics analysis data based on RNA second-generation sequencing results show that the mRNA expression level of USP45 in melanoma tissue is significantly lower than that in adjacent tissues. (EH) The expression of USP45 is higher in early melanoma tissue than in mid- and late-stage melanoma, but its expression level is not significantly different from the M stage.

[0065] Figure 6 The expression of USP45 in melanoma tissue provided by the embodiment of the present invention is positively correlated with the prognosis of the patient. (AC) The survival analysis results based on RNA second-generation sequencing results and clinical data showed that the overall survival (A), specific disease survival (B) and progression-free interval (C) of melanoma patients with high expression of USP45 were better than those of patients with low expression of USP45.

[0066] Figure 7 The expression levels of USP45 in skin cells and melanoma cell lines provided by the embodiments of the present invention are shown in Figure 1. (A, B) The results of quantitative PCR (A) and immunoblotting (B) show that compared with HACAT cells, the expression level of USP45 protein in melanoma cell lines SKMEL28, SKMEL2, A875 and A375 is lower than that in keratinocytes Hacat. (C) Grayscale statistical analysis results of immunoblotting experimental data.

[0067] Figure 8It is that USP45 provided in the embodiments of the present invention inhibits the activation of the PI3K / AKT pathway in melanoma cells. (A and B) Real-time fluorescence quantitative PCR shows that the plasmid encoding USP45 can increase the mRNA level of USP45 in cells (A), and the plasmid encoding USP45shRNA can reduce the mRNA level of USP45 in cells (B). (C) Real-time fluorescence quantitative PCR detects the mRNA levels of USP45 and MRGPRF in A375 cells that stably overexpress USP45 and SKMEL2 cells that stably knock down USP45. (D) Immunoblotting experimental data show that USP45 overexpression increases the expression of MRGPRF in A375 cells and attenuates the phosphorylation levels of PI3K and AKT. USP45 knockdown reduces the expression of MRGPRF in SKMEL2 cells and increases the phosphorylation levels of PI3K and AKT. (EH) Statistical analysis results of grayscale values ​​in immunoblotting experiments.

[0068] Fig. 9 It is the USP45 provided in the embodiment of the present invention that inhibits the proliferation of melanoma cells. (A) The results of the MTT experiment show that USP45 overexpression reduces the proliferation of A375 cells, while USP45 knockdown promotes the proliferation of SKMEL2 cells. (B) The results of the clone formation experiment show that excessive USP45 inhibits the clone formation ability of A375 cells, while USP45 knockdown enhances the clone formation ability of SKMEL2 cells. (C) Statistical analysis results of the clone formation experiment.

[0069] Fig.10 It is the USP45 provided in the embodiments of the present invention that hinders the cell cycle progression of melanoma cells. (A) The results of the 7AAD staining experiment show that excessive USP45 causes an increase in the number of A375 cells that remain in the G0 / G1 phase and a decrease in the number of cells that enter the S phase. (B) The results of the 7AAD staining experiment show that USP45 knockdown promotes more SKMEL2 cells to enter the S phase, while reducing the number of cells that remain in the G0 / G1 phase.

[0070] Fig.11 The excessive USP45 provided in the embodiment of the present invention promotes the apoptosis of melanoma cells. (A) The results of the AnnexinV / PI staining experiment show that USP45 overexpression significantly promotes the apoptosis of A375 cells. (B) The results of the AnnexinV / PI staining experiment show that knocking down USP45 has no significant effect on the apoptosis of SKMEL2 cells

[0071] Fig.12It is the USP45 provided in the embodiments of the present invention that reduces the migration and invasion ability of melanoma cells. (A) Transwell assay results show that overexpression of USP45 weakens the migration ability of A375 cells, while knocking down USP45 enhances the migration of SKMEL2 cells. (B) Statistical analysis results of migration data. (C) Transwell assay results show that excess USP45 reduces the invasion ability of A375 cells, while knocking down USP45 enhances the invasion level of SKMEL2 cells. (D) Statistical analysis results of invasion data

[0072] Fig.13 The USP45 with a mutation in the deubiquitinase functional domain provided in the embodiment of the present invention cannot inhibit the activation of the PI3K / AKT pathway. (A) Schematic diagram of the USP45 protein structure. (B) Real-time fluorescence quantitative PCR detection of the mRNA levels of USP45 and MRGPRF in A375 cells overexpressing USP45 or USP45C199A. (C) Immunoblotting experiments detected the protein levels of USP45, MRGPRF, PI3K and AKT in A375 cells overexpressing USP45 or USP45C199A, as well as the phosphorylation levels of PI3K and AKT. (D) Grayscale statistics of protein immunoblotting results.

[0073] Fig.14 The deubiquitinase functional domain mutation provided by the embodiment of the present invention weakens the anti-tumor effect of USP45 on melanoma cells. (A) The results of the MTT experiment showed that the proliferation level of A375 cells overexpressing USP45C199A was higher than that of A375 cells overexpressing USP45; (B) The results of the clone formation experiment showed that the clone formation ability of A375 cells overexpressing USP45C199A was stronger than that of A375 cells overexpressing USP45; (C) The data of the 7AAD staining experiment showed that the promoting effect of USP45C199A overexpression on the cell cycle of A375 was stronger than that of USP45 overexpression; (D) The results of AnnexinV / PI staining showed that the apoptosis of A375 cells overexpressing USP45C199A was weaker than that of A375 cells overexpressing USP45. (E and F) Transwell assay results showed that the migration and invasion abilities of USP45C199A-overexpressing A375 cells were significantly stronger than those of USP45-overexpressing A375 cells. DETAILED DESCRIPTION

[0074] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0075] like Figure 1As shown, a melanoma cell marker detection method and application based on USP45-MRGPRF interaction provided by an embodiment of the present invention comprises the following steps:

[0076] S101, 40 USP45 overexpression vectors were constructed and co-transfected with MRGPRF carrying luciferase into 293T cells, and USP45 that enhances the stability of MRGPRF was screened based on luciferase activity; the expression difference of USP45 in melanoma tissue and normal skin tissue was verified by immunohistochemistry; and the correlation between USP45 expression in melanoma tissue and patient prognosis was evaluated by bioinformatics analysis;

[0077] S102, detect the expression of USP45 in melanoma cells, and verify the cell proliferation, cell cycle, apoptosis, migration and invasion by overexpressing or knocking down USP45 to reveal the role of USP45 in melanoma cells;

[0078] S103, overexpress USP45 and MRGPRF in melanoma cells, and detect their interaction by immunoprecipitation and GST Pulldown; construct USP45 functional domain mutants and domain truncation mutants, and study their binding sites with MRGPRF and functional sites affecting MRGPRF ubiquitination by immunoprecipitation; construct different ubiquitin mutants, and study the types of MRGPRF ubiquitination affected by USP45 by immunoprecipitation; overexpress or knockdown USP45 in melanoma cells to evaluate its effects on the ubiquitination level and stability of MRGPRF;

[0079] S104, knock down or overexpress MRGPRF in melanoma cells with USP45 overexpression or knockdown, and verify through recovery experiments whether USP45 regulates melanoma cells by enhancing the stability of MRGPRF;

[0080] S105. Finally, USP45-overexpressing stable melanoma cells and xenograft models were constructed, and in vivo experiments were performed to verify its effect on melanoma growth.

[0081] like Figure 2 As shown, an application system of USP45-MRGPRF interaction in melanoma marker detection provided by an embodiment of the present invention includes:

[0082] A screening module was used to construct 40 USP45 overexpression vectors, which were co-transfected with MRGPRF carrying luciferase into 293T cells, and USP45 that enhanced the stability of MRGPRF was screened based on luciferase activity; the expression difference of USP45 in melanoma tissue and normal skin tissue was verified by immunohistochemistry; and the correlation between the expression of USP45 in melanoma tissue and the prognosis of patients was evaluated by bioinformatics analysis;

[0083] The validation module is used to detect the expression of USP45 in melanoma cells. By overexpressing or knocking down USP45, cell proliferation, cell cycle, apoptosis, migration and invasion are verified to reveal the role of USP45 in melanoma cells.

[0084] Evaluation module, used to overexpress USP45 and MRGPRF in melanoma cells, and detect the interaction between the two by immunoprecipitation and GST Pulldown; construct USP45 functional domain mutants and domain truncation mutants, and study their binding sites with MRGPRF and functional sites affecting MRGPRF ubiquitination by immunoprecipitation; construct different ubiquitin mutants, and study the types of MRGPRF ubiquitination affected by USP45 by immunoprecipitation; overexpress or knockdown USP45 in melanoma cells to evaluate its effects on the ubiquitination level and stability of MRGPRF;

[0085] A regulatory module is used to knock down or overexpress MRGPRF in melanoma cells in which USP45 is overexpressed or knocked down, and to verify through a recovery experiment whether USP45 plays a regulatory role on melanoma cells by enhancing the stability of MRGPRF;

[0086] The building blocks were used to construct USP45-overexpressing stable melanoma cells and xenograft models, and in vivo experiments were performed to verify their effects on melanoma growth.

[0087] The system provided in the embodiment of the present invention is used to study the interaction between USP45 and MRGPRF in melanoma and evaluate its application in melanoma marker detection. First, the screening module constructs 40 USP45 overexpression vectors and co-transfects 293T cells with MRGPRF carrying luciferase, and screens out USP45 that can enhance the stability of MRGPRF based on the activity of luciferase. In addition, the expression difference of USP45 in melanoma tissue and normal skin tissue is compared by immunohistochemistry, and the potential role of USP45 in the prognosis of melanoma patients is evaluated by bioinformatics analysis.

[0088] Next, the validation module detects the expression level of USP45 in melanoma cells and analyzes its effects on cell proliferation, cell cycle, apoptosis, migration and invasion by overexpressing or knocking down USP45, thereby revealing the mechanism of action of USP45 in melanoma cells. This part of the experiment can help confirm whether USP45 plays a key regulatory role in tumor progression.

[0089] In the evaluation module, USP45 and MRGPRF were overexpressed in melanoma cells, and the interaction between the two was detected by immunoprecipitation and GST Pulldown experiments. At the same time, USP45 functional domain mutants and domain truncation mutants were constructed to study the binding sites and functions of USP45 and MRGPRF, especially its effects on MRGPRF ubiquitination. Through immunoprecipitation experiments with different ubiquitin mutants, the types and mechanisms of USP45 affecting MRGPRF ubiquitination were further explored.

[0090] Finally, the regulatory module knocked down or overexpressed MRGPRF in melanoma cells and performed a recovery experiment to verify whether USP45 played a role by regulating the stability of MRGPRF. In addition, by constructing stable melanoma cells and xenograft models with overexpression of USP45, its effect on melanoma growth was verified in in vivo experiments, thus revealing the regulatory role of USP45 in the development of melanoma. This system provides new potential targets for the detection and treatment of melanoma markers.

[0091] The present invention constructs 40 USP45 overexpression vectors, co-transfects 293T cells with MRGPRF carrying luciferase, and screens out USP45 that enhances the stability of MRGPRF according to luciferase activity; validates the expression difference of USP45 in melanoma tissue and normal skin tissue by immunohistochemistry; and uses bioinformatics analysis to evaluate the correlation between the expression of USP45 in melanoma tissue and the prognosis of patients.

[0092] The expression of USP45 was detected in melanoma cells, and the role of USP45 in melanoma cells was revealed by overexpressing or knocking down USP45 and verifying cell proliferation, cell cycle, apoptosis, migration and invasion.

[0093] USP45 and MRGPRF were overexpressed in melanoma cells, and their interaction was detected by co-immunoprecipitation and GST pulldown. USP45 functional domain mutants and domain truncation mutants were constructed and immunized.

[0094] The coding sequence of MRGPRF gene was cloned into pmirGLOG4SNanoluc vector for detecting luciferase activity, and the plasmid was named pmirGLOG4SMRGPRFNanoluc (abbreviated as MRGPRF Nanoluc). The MRGPRF coding sequence was cloned into pcDNA3.1FLAG vector and named pcDNA3.1FLAGMRGPRF (abbreviated as FlagMRGPRF). USP45, USP4530, USP452, USP4518, USP4519, USP455, USP4520, USP4521, USP4510, USP456, USP4535, USP451, USP4525, USP4544, USP4549, USP4554, USP4553, USP4532, USP4511, USP458, USP4552, USP4551, USP 454, USP4515, USP4540, USP4513, USP457, USP4526, USP4529, USP4548, USP453, USP4533, USP4522, USP4546, USP4536, USP4527X, USP4538, USP45L1, USP4539, and USP4514 overexpression vectors were purchased from Xiamen Antihera Technology Co., Ltd. The vector is pcDNA3.1HA. The inserted USP45 sequence was sequenced and confirmed to be correct. Because the vector carries HAtag, the overexpression of USP45 can be detected with HAtag antibody in the future. The primer sequences required for vector construction are shown in Table 1.

[0095] Table 1 Vector construction primer information

[0096] Primer name Primer sequence 5'-3' MRGPRF-Nanoluc-F TGGAGCCACCGAATTCATGGCTGGAAACTGCTCCTGGGAGG MRGPRF-Nanoluc-R CCCGAGCCACCGCCACCAGAGGAGGCGTTCCCCGGGGGAC Flag-MRGPRF-F TAGAGCTAGCGAATTCGCCACCATGGCTGGAAACTGCTCCTG Flag-MRGPRF-R CTTTGTAGTCGGATCCGGAGGCGTTCCCCGGGGGACACTGCATCTCCATG

[0097] The construction of the overexpression vector uses cDNA as a template, finds the corresponding gene information on the NCBI website, and then designs primers to amplify the coding region of the target gene, and amplifies it with a high-fidelity DNA polymerase, and introduces restriction sites at both ends of the primers. After the PCR is completed, the target band is recovered and purified by gel recovery, and the concentration of the obtained product is determined by Nanodrop. Subsequently, the vector plasmid and PCR product are digested with restriction endonucleases and then purified. The purified product is connected with T4 ligase and reacted at 16°C for 4 hours. The product is then used to transform competent bacteria. The method is to incubate at 42 degrees for 90 seconds, then immediately put it on ice for 2 minutes, and then the transformed competent cells are revived with 1mL of antibiotic-free culture medium for 1 hour. Finally, the bacterial solution is evenly applied to the culture dish and inverted and cultured overnight at 37°C. The next day, several clones were selected and inoculated into 5mL of bacterial culture solution, and cultured in a bacterial shaker for 6 hours at a speed of 200rpm. The positive clones were then identified by bacterial liquid PCR. The template is bacterial liquid, and the PCR reaction conditions are the same as those during amplification. After positive clones were identified, the bacterial liquid was inoculated into fresh culture medium and cultured overnight with shaking. The plasmid was then extracted and identified by enzyme digestion. After the identification was completed, agarose gel electrophoresis was performed. After confirming that the band size was correct, the plasmid was sequenced and identified.

[0098] HEK293T cells were cultured in DMEM + 10% fetal bovine serum + 100 U / mL penicillin / streptomycin medium, and 0.25% trypsin / EDTA was used for cell passage.

[0099] Lipofectamine2000 was used for all cell transfections, and the steps were strictly in accordance with the instructions. The cells were inoculated into the culture plate at an appropriate density so that the confluence on the second day was about 80%. Then the culture medium was aspirated and the cells were rinsed once with PBS, and then an appropriate volume of OptiMEM culture medium was added. At the same time, two centrifuge tubes were prepared, and Lipofectamine2000 and OptiMEM culture medium were mixed evenly according to the number of samples to be transfected, and then the plasmid was mixed with OptiMEM culture medium in another centrifuge tube and allowed to stand at room temperature for 5 minutes. Then the two were mixed in a 1:1 ratio and allowed to stand at room temperature for 15 minutes. Finally, the liposome plasmid mixed solution was slowly added to the cell culture medium and gently shaken to mix. After 6 hours of culture, the old culture medium was aspirated, and the newly prepared culture medium was added, and the culture was continued for 48 hours or longer, depending on the experimental requirements.

[0100] After 48 hours of cell transfection, the cells were rinsed twice with PBS, and then 100 μL of the cell lysis buffer (1×CellLysisBuffer) provided in the kit was added. After incubation for 5 minutes, the cells were repeatedly blown with a pipette and transferred to a 1.5 mL centrifuge tube, and then centrifuged at room temperature for 2 minutes at a speed of 12000g. The supernatant was carefully collected for later use. 100 μL of Firefly luciferase substrate pre-equilibrated to room temperature was added to the ELISA plate, 20 μL of cell lysis buffer supernatant was added, and the supernatant was quickly mixed with a pipette, and then placed in a Luminometer to detect the activity of the Firefly luciferase reporter gene. Then 100 μL of Renilla luciferase substrate pre-equilibrated to room temperature was added to the above reaction system, and the Renilla luciferase reporter gene activity was immediately detected after being quickly mixed with a pipette. Finally, the Firefly luciferase activity was standardized with the Renilla luciferase activity.

[0101] After removing the culture medium, rinse, protein quantification, Western blot, primary antibody incubation, development, recording and analysis are performed. There is no need to rinse three times, each time for 10 minutes.

[0102] Skin and melanoma tissues were dehydrated with 25%, 50%, 75% and anhydrous ethanol gradients, then embedded in paraffin and cut into 5-micron thick tissue sections. The sections were rehydrated with xylene and different concentrations of ethanol gradients. The immunohistochemistry steps were strictly in accordance with the instructions of the kit. After the experiment was completed, the tissue sections were dehydrated again, sealed with gum, observed and photographed with an inverted microscope for statistical analysis. The USP45 antibody used was purchased from Affnity Bioscience, catalog number DF4595, with a dilution ratio of 1:200.

[0103] The RNAseq and related clinical data of melanoma patients were collected using the TCGASKCM dataset (https: / / portal.gdc.cancer.gov / projects / TCGASKCM), which contains 472 tumor samples and one control sample. Clinical data were downloaded from the Xena database (https: / / xena.ucsc.edu / ). In addition, 604 skin_not_sun_exposed_suprapubic normal skin samples and 701 skin_sun_exposed_lower_leg normal skin samples were downloaded from the GTEx official website (https: / / www.gtexportal.org / ) as controls.

[0104] The analysis method of USP45 expression difference was unpaired t test; 'survminer' R package (v0.4.9) was used to calculate the optimal cutpoint (OptimalCutpoint), and 'survival' R package (v3.57) was used to draw the survival curve (KaplanMeier curve). The survival analysis removed samples with a survival time of 0 or unknown.

[0105] In order to study the potential regulatory effect of USP45 on the stability of MRGPRF protein, the embodiment of the present invention first constructed the MRGPRFNanoluc vector, and then co-transfected HEK293T cells with the plasmid and a single USP45 overexpression vector, and used an empty vector as a control. The activity of luciferase was measured after 48 hours of culture. The results showed that compared with the control transfected with the USP45 overexpression empty vector, most of the USP45 overexpression could increase the fluorescence intensity of MRGPRFNanoluc, reflecting that these USP45s can increase the stability of MRGPRFNanoluc. Only four USP45 overexpressions had no obvious effect on the stability of MRGPRFNanoluc, and five USP45s had a negative effect on the stability of MRGPRFNanoluc ( Figure 3 ). These screening results showed that most of the USP45s had a positive regulatory effect on the stability of the MRGPRF protein. The results of the dual fluorescein activity assay showed that the fluorescence intensity was the highest in HEK293T cells overexpressing USP45, and the lowest in HEK293T cells overexpressing USP4514.

[0106] In order to verify the regulatory effect of USP45 on the stability of MRGPRF protein, the three USP45s with the highest stability of MRGPRFNanoluc luciferase intensity were selected in the embodiment of the present invention: USP45, USP4530 and USP4520, and then these overexpression vectors were co-transfected with the FlagMRGPRF overexpression vector into HEK293T cells. After 48 hours of culture, the expression level of FlagMRGPRF protein was detected by immunoblotting. The results showed that USP45, USP4530 and USP4520 can all be expressed in HEK293T cells, but compared with the control, only USP45 overexpression can significantly increase the protein level of FlagMRGPRF ( Figure 4 These data indicate that USP45 can indeed increase the expression level of MRGPRF protein, and suggest that the regulation of ubiquitination level plays an important role in the stability of MRGPRF protein.

[0107] As mentioned above, USP45 can significantly enhance the stability of MRGPRF, which is a tumor suppressor gene of melanoma. The present invention uses immunohistochemistry to detect the difference in expression of USP45 in normal skin tissue and melanoma tissue, and finds that the expression of USP45 protein in the melanoma group is lower than that in the normal epidermal tissue ( Figure 5 A and B). The present invention example analyzed the melanoma RNAseq expression data in the public database TCGA. The results showed that the expression of USP45 in melanoma tissue was significantly lower than that in adjacent tissues ( Figure 5 C and D). According to the TNM staging of melanoma, the expression level of USP45 was lower in T3&T4 than in T1&T2, and lower in N2&N3 than in N0&N1 ( Figure 5 E and F), lower in Stage IIIV than in Stage I ( Figure 5 H), but no significant difference between M0 and M1 ( Figure 5 G). These results indicate that the expression level of USP45 in early-stage melanoma tissues is higher than that in mid- and late-stage melanoma tissues.

[0108] The expression of USP45 is reduced in melanoma tissue, suggesting that it is associated with the prognosis of patients. The present invention analyzes the expression of USP45 and the overall survival (OS) of melanoma patients. Figure 6 A), melanoma-specific disease survival (DSS) ( Figure 6 B) and progression-free interval (PFI) ( Figure 6 The results showed that the above prognostic indicators of patients with high expression of USP45 were significantly better than those of patients with low expression of USP45 (P<0.05, Figure 6 ). These data suggest that USP45 plays a role as a tumor suppressor gene in melanoma.

[0109] Through exploratory studies on the stability of MRGPRF protein, the embodiments of the present invention screened multiple USP45s that affect the stability of the protein. Overexpression of most USP45s, including USP45, can increase the stability of MRGPRF, which is consistent with the characteristics of deubiquitinases, because deubiquitination usually inhibits protein degradation. However, there are still several USP45s (such as USP4514, USP4539, USP45L1, USP4538) that significantly reduce the stability of MRGPRF. The reason is that these USP45s reduce the stability of MRGPRF by stabilizing the negative regulatory factors of MRGPRF, or certain types of ubiquitination increase the stability of substrate proteins. These deubiquitinases reduce the stability of MRGPRF by removing the ubiquitination modification that stabilizes MRGPRF. Since there are few studies on the ubiquitination modification of MRGPRF, the embodiments of the present invention need further experiments to verify the above properties.

[0110] The screening of the embodiment of the present invention was carried out in HEK293T cells, based on overexpression, rather than endogenous MRGPRF. Whether the effect of USP45 on the stability of MRGPRF is the same in other cells and tissues, especially melanocytes and melanomas, still needs more experimental verification. In addition, although only USP45 can improve the stability of MRGPRF protein among the three USP45s that enhance the activity of MRGPRFNanoluc luciferase, it is because the luciferase is more sensitive, or the luciferase changes the structure of MRGPRF in series, thereby affecting its stability. Therefore, the results of the luciferase screening test need other experimental verification. Although the function of MRGPRF as a melanoma tumor suppressor gene has been revealed, its role in melanocytes is still unknown. Melanocytes and many nerve cells have the same origin, and their cell morphology also has a dendritic structure similar to that of nerve cells. In view of the role of the MRGPRF family in the nervous system, MRGPRF is also involved in regulating the function of melanocytes. These USP45s are also involved in regulating the physiological activities of melanocytes, and further research is needed to verify these properties.

[0111] Vector construction: Primers pLVXUSP45F and pLVXUSP45R2 were used to amplify the USP45 sequence with HA tag from the pcDNA3.1HAUSP45 plasmid, primers pLVXUSP45F plus pLVXUSP45mutR were used to amplify the USP45mut1 sequence from the USP45 sequence, and pLVXUSP45mutF plus pLVXUSP45R1 were used to amplify the USP45mut2 sequence from the USP45 sequence. Then, the USP45mut1 sequence and the USP45mut2 sequence were mixed as templates, and the USP45C199A sequence with HA tag was amplified using pLVXUSP45F plus pLVXUSP45R2. USP45 or USP45C199A was inserted into the pLVXCMVPGKPuro vector. Select the shRNA sequence targeting USP45 with high scores on the MERCK website, and then perform Blast sequence alignment. Select three sequences with high specificity to synthesize shRNA oligonucleotides, and use deionized water to prepare a solution with a concentration of 100μM. Then use a PCR instrument to perform double-strand annealing. The reaction system and conditions are as follows: 10μl forward oligonucleotide solution, 10μl reverse oligonucleotide solution, 5μl 10XT4 ligase buffer, and 25μl deionized water to make a volume of 50μl. The reaction program is 95℃ for 5 minutes; 90℃ for 1 minute; then gradually reduce to 25℃ with a program of reducing 5℃ and incubating for 1 minute in each step, and place on ice for one minute for standby use. Then mix the pre-enzyme linearized vector with T4 ligase and ligation buffer, add the annealing product, mix well, and place at 16℃ for ligation overnight. The shRNA sequence was cloned into the pLKO.1puro vector and named shUSP451, shUSP452, and shUSP453. The following transformation and identification steps are the same as those for constructing overexpression vectors, and finally sequencing is performed for identification. The primer sequences required for constructing all the above vectors are shown in Table 2.

[0112] Table 2 Primer information for USP45 knockdown vector construction.

[0113]

[0114] Cell culture and transfection: All cells were cultured in a carbon dioxide incubator at 37°C and 5% carbon dioxide concentration. The culture medium is as follows: 293T and HACAT cell culture medium: DMEM + 10% fetal bovine serum + 100U / mL penicillin / streptomycin; SKMEL28 cell culture medium: MEM + 10% fetal bovine serum + 100U / mL penicillin / streptomycin; SKMEL2 cell culture medium: MEM + 10% fetal bovine serum + 100U / mL penicillin / streptomycin; A875 cell culture medium: MEM + 10% fetal bovine serum + 100U / mL penicillin / streptomycin; A375 cell culture medium: DMEM + 10% fetal bovine serum + 100U / mL penicillin / streptomycin. All cell transfections were performed using Lipofectamine 2000, and the steps were strictly in accordance with the instructions. The cells were seeded into the culture plate at an appropriate density so that the confluence reached about 80% on the second day. Then aspirate the culture medium and rinse the cells once with PBS, then add an appropriate volume of OptiMEM culture medium. At the same time, prepare two centrifuge tubes, mix Lipofectamine2000 and OptiMEM culture medium in proportion according to the number of samples to be transfected, and then mix the plasmid with OptiMEM culture medium in another centrifuge tube and let it stand at room temperature for 5 minutes. Then mix the two in a 1:1 ratio and let it stand at room temperature for 15 minutes. Finally, slowly add the liposome plasmid mixed solution to the cell culture medium and shake it gently to mix. After 6 hours of culture, aspirate the old culture medium, add the newly prepared culture medium, and continue to culture for 48 hours or longer. The specific time depends on the experimental requirements.

[0115] Lentivirus packaging and purification: After 293T cells were cultured to 80% confluence in a 10 cm culture plate, the culture medium was changed to serum-free culture medium and cultured for 2 hours. Then, 9 μg of control plasmid (containing GFP coding sequence), plasmid encoding USP45 or plasmid encoding shUSP45, 6 μg of psPAX2 plasmid, and 3 μg of pMD2.G plasmid were transfected. After 6 hours of culture, the culture medium was replaced with fresh serum-containing culture medium. After 48 hours of culture, the culture medium was recovered, centrifuged at 8000 rpm for 10 minutes, the supernatant was taken, and after centrifugation at 30000 rpm at 4°C for 2 hours, the supernatant was carefully removed. Then, the virus was resuspended in one-tenth of the fresh culture medium, placed at 4°C for 2 hours to promote the dissolution of the virus precipitate, and finally filtered with a 0.45 μm filter and packaged in sterile centrifuge tubes, stored in a refrigerator at 80°C, and the titer (MOI) was determined. The determination process is as follows: dilute the virus from 103, 104, and then to 109 times, and then infect 293T cells respectively, and repeat 6 wells. After 48 hours of culture, observe the number of GFP-positive cells under a fluorescence microscope, and determine the virus titer based on the mean fluorescence ratio of infected cells.

[0116] Construction of stable cell lines: Melanoma cells were cultured to 80% confluence, the culture medium was removed and fresh culture medium containing 10 μg / mL polybrene and 10 MOI lentivirus was added. After 3 days of culture, the old culture medium was removed and fresh culture medium containing 2.0 μg / ml puromycin was added to continue culture. The culture medium containing 2.0 μg / ml puromycin was replaced every 2 days. After 7 days, the culture medium was replaced with a culture medium without puromycin and continued to culture and identify changes in target gene expression.

[0117] RNA extraction and reverse transcription: Trizol was used to extract total RNA from cells. First, remove the cell culture medium, then rinse twice with pre-cooled PBS, add 1 mL of Trizol, incubate on ice for 10 minutes, then blow the cells off the bottom of the culture plate with a pipette several times, continue incubation for 5 minutes, then transfer the cell lysate to a 1.5 mL centrifuge tube, shake for 30 seconds, and let stand at room temperature. After 5 minutes, add 200 μL of chloroform and cover the tube tightly, shake for 30 seconds to mix, let stand at room temperature for 5 minutes, and then centrifuge in a refrigerated centrifuge for 10 minutes at 4°C and 12000g. Carefully transfer the upper liquid phase (about 250 μL) after centrifugation to a 1.5 mL centrifuge tube, then add an equal volume of isopropanol and mix thoroughly, let stand at room temperature for 10 minutes, and then centrifuge at 4°C for 15 minutes at 14000rpm. After carefully aspirating the supernatant, add pre-cooled 70% ethanol solution to resuspend the precipitate, then centrifuge at 4°C for 5 minutes at a speed of 14000rpm. After the centrifugation, aspirate the supernatant, open the tube cap and place it in a fume hood to dry for 20 minutes, finally dissolve the RNA with 30μLDEPC water, measure the RNA concentration with Nanodrop, and then use it for reverse transcription. The remaining RNA is stored in an ultra-low temperature refrigerator. The template for reverse transcription is 1μgRNA, and the reverse transcription steps refer to the manufacturer's instructions. The cDNA obtained after reverse transcription is stored in an ultra-low temperature refrigerator.

[0118] Real-time fluorescence quantitative PCR: The operation steps of real-time fluorescence quantitative PCR were in accordance with the instructions of the kit manufacturer. Each sample was repeated in three wells, and the single-well reaction system (20 μL) was: 2×ChamQ Universal SYBR qPCR Master Mix——————10 μL forward primer (10 μM)——————0.4 μL reverse primer (10 μM)——————0.4 μL template cDNA (diluted 5 times)——————1 μL deionized water——————7.2 μL The reaction procedure was as follows: the first step, 95°C for 30 seconds; the second step, 95°C for 10 seconds, 60°C for 30 seconds, 40 cycles; the quantitative method of the target gene used the 2-ΔΔCq algorithm, and the internal reference gene was 18S. The primer information used for real-time fluorescence quantitative PCR is shown in Table 3.

[0119] Table 3 Real-time fluorescence quantitative PCR primer information

[0120] Primer name Primer sequence 5'-3' USP45-qPCR-F TATGGTCGCCGCAGTTTCTC USP45-qPCR-R AGGGATCAGGAAGCCGAGT 18S-F CGACGACCCATTCGAACGTCT 18S-R CTCTCCGGAATCGAA CCCTGA

[0121] Immunoblotting: First remove the cell culture medium, then rinse twice with pre-cooled PBS, add RIPA cell lysis buffer containing protease inhibitors, incubate on ice for 15 minutes, and repeatedly blow several times with a pipette every 5 minutes to promote cell lysis. Then transfer the lysis mixture to a centrifuge tube, shake for 30 seconds, and centrifuge it in a refrigerated centrifuge for 10 minutes at 4°C and 12000g. Carefully collect the supernatant, quantify the protein concentration with a BCA kit, then add the loading buffer and denature at 95°C for 10 minutes. The processed samples can be used directly for electrophoresis, and the remaining samples are stored in an ultra-low temperature refrigerator.

[0122] During electrophoresis, place the gel in electrophoresis buffer, then remove the comb teeth, add 15μg protein sample to each well, and select another well to add pre-stained protein molecular weight markers. The electrophoresis parameters are 300mA and the time is 1 to 2 hours. After the electrophoresis, take out the gel, cut off the excess part, and assemble it into a transfer membrane complex with PVDF membrane (pre-soaked in methanol for 5 to 10 minutes), filter paper, sponge, etc. Pay attention to remove the bubbles between the PVDF membrane and the gel, and then proceed to the next step of transfer electrophoresis, the parameters are 300mA, the time is 1.5 hours, and the electrophoresis needs to be performed on ice. After the transfer, mark the front and back of the PVDF membrane, block it with 5% skim milk powder solution for 1 hour, then rinse the PVDF membrane with TBST solution three times, and cut the PVDF membrane according to the molecular weight of the target protein to be detected in the experiment, combined with the pre-stained molecular marker. The cut PVDF membrane is incubated with sufficient primary antibody solution at 4°C overnight. The next day, the PVDF membrane was removed and rinsed three times on a shaker with TBST solution for 10 minutes each time. Then the PVDF membrane was incubated with the secondary antibody solution at room temperature for one hour. After the incubation, the membrane was placed in the TBST solution and rinsed three times on a shaker for 10 minutes each time. Then the membrane was reacted with the pre-configured ECL developer. After 5 minutes, the excess developer was removed and the bands were observed and recorded in ChemiDoc. The grayscale value of the bands was quantified by ImageJ software for statistical analysis. See Table 35 for information on antibodies used in immunoblotting experiments.

[0123] The MTT test is used to detect cell proliferation. The operation process refers to the instructions of the kit. First, 25 mg of MTT in the kit is prepared into a 5 mg / mL MTT solution with PBS and stored at 20°C in the dark. During the experiment, cells were first inoculated in a 96-well plate with a density of 10,000 cells per well, and 200 μL of culture medium was added. Then, 7. μL MTT solution was added according to the set culture time (0 hours, 24 hours, 48 ​​hours, 72 hours). After continuing to culture for 4 hours, all the liquid was sucked off, and then 150 μL DMSO was added to each well. Incubate for 4 hours until the crystals dissolved, and shake several times to promote the dissolution of crystals. Then, the absorbance value at 490 nanometers (OD490) was measured with an enzyme marker. Six wells were repeated for each condition, and the average value was taken. The cell growth curve was drawn with time as the horizontal axis and absorbance value as the vertical axis.

[0124] 1000 cells were inoculated in a 6 cm culture dish and cultured for 14 days, with the culture medium replaced every three days. The culture medium was then aspirated and the cells were rinsed twice with PBS. 1 mL of Giemsa staining solution was then added and incubated for 5 minutes. The staining results were observed until the expected signal appeared. The reaction was terminated and the cells were rinsed three times with PBS and dried at room temperature. Finally, the results were photographed and quantitatively analyzed using ImageJ.

[0125] 7AAD staining experiments were used to assess the cell cycle. The time steps were as per the manufacturer's instructions. 1×106 cells were inoculated and cultured. After the cells adhered to the wall, the culture medium was removed. The cells were then rinsed once with PBS. Trypsin was then added to digest the cells until the cells could be blown off with a pipette. Then the trypsin was removed, the previous culture medium was added to blow the cells off to make a cell suspension, centrifuged at 600g for 5 minutes, and the supernatant was carefully removed. The cells were washed once with PBS, centrifuged again, the supernatant was removed, and 1 mL of 7AAD staining working solution was used to incubate the cells at 37°C for 10 minutes, and then detected by flow cytometry.

[0126] AnnexinV / PI staining experiment is used to detect cell apoptosis. The experimental steps refer to the manufacturer's instructions. Inoculate 1×106 cells for culture, remove the culture medium after the cells adhere to the wall, then rinse the cells once with PBS, and then add trypsin to digest the cells until the cells can be blown down with a pipette. Then remove the trypsin, add the previous culture medium to blow down the cells to make a cell suspension, centrifuge at 1000g for 5 minutes, carefully remove the supernatant, gently resuspend the cells with PBS and count. Take 1×105 cells, centrifuge at 1000g for 5 minutes, carefully remove the supernatant, and add 195μL AnnexinVFITC binding solution to carefully resuspend the cells. Then add 5μL AnnexinVFITC, mix carefully, and then add 10μLPI staining solution. After mixing, incubate at room temperature in the dark for 15 minutes, resuspend twice during the period, and store on ice after the end for flow cytometry detection. AnnexinVFITC is green fluorescence and PI is red fluorescence.

[0127] When studying cell migration, 200 μL of cells with a density of 3X105 cells / mL were inoculated in the upper chamber of the Transwell 24-well plate, and then 700 μL of complete culture medium was added to the lower chamber. Special attention should be paid to avoid bubbles between the culture medium in the lower chamber and the upper chamber, because once bubbles are generated, cell migration will be blocked. Therefore, special attention should be paid during operation. If bubbles appear, the upper chamber should be lifted with tweezers, and after removing the bubbles, it should be placed in the culture plate. After 48 hours of culture, the membrane of the upper chamber was cut off, fixed with methanol for 30 minutes, and then stained with 0.05% crystal violet solution for 5 minutes. After drying, the microscope was used to take pictures. When studying cell invasion, the upper chamber was pre-treated with 100 μL Matrigel (1:5 dilution) for 2 hours, and the other steps were consistent with the steps for studying cell migration. The staining results were quantified using Image6.

[0128] All statistical analyses and statistical graphs were generated using GraphPad Prism 8. The normal distribution of the data was verified using the Shapiro Wilk test. The difference between the two groups of data that conformed to the normal distribution was evaluated by unpaired two-tailed Student's t test, and the difference between the three groups of composite normal distribution data was tested by one-way analysis of variance (Oneway ANOVA). If P < 0.05 between the data groups, the difference was considered to be statistically significant.

[0129] In order to study the function of USP45 in melanoma cells, the present invention first detected the mRNA and protein expression levels of USP45 in human keratinocytes (HACAT), melanoma cell lines SKMEL28, SKMEL2, A875 and A375. Quantitative PCR and immunoblotting experimental data showed that the USP45 mRNA and protein in SKMEL28, SKMEL2, A875 and A375 cells were still significantly lower than those in HACAT. At the same time, the USP45 protein expression in A375 cells was lower than that in other melanoma cell lines, and the USP45 protein expression in SKMEL2 cells was higher than that in other melanoma cell lines ( Figure 7 ). Therefore, in the subsequent experiments of the present invention, the USP45 protein was overexpressed in A375 cells and the USP45 protein was knocked down in SKMEL2 cells.

[0130] In order to overexpress or knock down USP45, plasmids encoding USP45 and short hairpin RNA (shRNA) targeting USP45 were constructed in the present invention, and A375 cells stably overexpressing USP45 and SKMEL2 cells stably knocking down USP45 were generated. Real-time fluorescence quantitative PCR results showed that the plasmid encoding USP45 could increase the mRNA level of USP45 in cells ( Figure 8 A); Plasmids encoding USP45shRNA can reduce the mRNA level of USP45 in cells, among which USP45sh3 has the best effect ( Figure 8 B); Moreover, the mRNA level of USP45 in A375 cells stably overexpressing USP45 was significantly increased, while the mRNA level of USP45 in SKMEL2 cells stably knocking down USP45 was significantly decreased. Moreover, whether overexpressing USP45 or knocking down USP45, the mRNA level of MRGPRF in cells was not significantly affected ( Figure 8 C). Since melanoma is often caused by abnormal activation of the PI3K / AKT pathway and is associated with USP45 expression, and MRGPRF inhibits the activation of this pathway in melanoma cells, the embodiments of the present invention speculate that USP45 can also reduce the activity of this pathway in melanoma cells. The results of immunoblotting experiments showed that overexpression of USP45 led to an increase in the level of MRGPRF protein in A375 cells, which is consistent with its function in HEK293T cells. At the same time, excess USP45 significantly reduced the phosphorylation levels of PI3K and AKT proteins. Since the phosphorylation of these two proteins reflects the degree of activation of the pathway, it shows that USP45 inhibits the activity of the PI3K / AKT pathway in A375 cells. In contrast, knocking down USP45 caused a decrease in the level of MRGPRF protein in SKMEL2 cells and an increase in the phosphorylation levels of PI3K and AKT proteins, reflecting the increased activity of the PI3K / AKT pathway ( Figure 8 DH). These results suggest that USP45 inhibits the activation of the PI3K / AKT pathway in melanoma cells.

[0131] In the present embodiment, USP45 was overexpressed in A375 cells and USP45 was knocked down in SKMEL2 cells, and then the effect of USP45 on the proliferation of these two melanoma cells was detected. The results of the MTT experiment showed that USP45 overexpression significantly inhibited the proliferation of A375 cells, while knocking down USP45 promoted the proliferation of SKMEL2 cells ( Fig. 9 A). The results of the clone formation experiment supported the conclusion of the MTT experiment, showing that the number of clones formed by A375 cells with overexpression of USP45 was significantly less than that of the control, while the number of clones formed by SKMEL2 cells with knockdown of USP45 was significantly more than that of the control ( Fig. 9 B and C). These data indicate that USP45 has an inhibitory effect on the proliferation of melanoma cells.

[0132] Further experimental results showed that overexpression of USP45 reduced the proportion of cells entering the S phase in A375 cells, while knockdown of USP45 accelerated the entry of SKMEL2 cells into the S phase. These findings suggest that USP45 plays an important role in cell cycle regulation.

[0133] In addition, overexpression of USP45 can promote apoptosis of A375 cells, while knockdown of USP45 has no significant effect on apoptosis of SKMEL2 cells. The study also found that USP45 can inhibit the migration and invasion of melanoma cells by reducing the activity of the PI3K / AKT pathway. The mechanisms of these functions need further study.

[0134] Through the study of the USP45C199A mutant, it was found that its deubiquitinase catalytic domain is the core of USP45's function, which is consistent with its function as a deubiquitinase. This discovery further clarifies the tumor suppressor effect of USP45 in melanoma cells and its mechanism.

[0135] In summary, the research results of the embodiments of the present invention provide a strong theoretical basis for USP45 as a tumor suppressor gene in melanoma, and reveal its mechanism of suppressing tumors by affecting cell proliferation, apoptosis, migration and invasion.

[0136] 3.3.4 USP45 delays melanoma cell cycle progression

[0137] Next, the present invention used 7AAD staining experiments to evaluate the regulatory effect of USP45 on the melanoma cell cycle. The results showed that overexpression of USP45 led to a significant increase in the number of A375 cells remaining in the G0 / G1 phase and a decrease in the number of cells entering the S phase ( Fig.10 A). Conversely, knockdown of USP45 resulted in a decrease in the number of SKMEL2 cells remaining in the G0 / G1 phase and an increase in the number of cells entering the S phase ( Fig.10 B). These data suggest that USP45 can delay the cell cycle of melanoma cells, consistent with its function in inhibiting melanoma cell proliferation.

[0138] The present invention conducted an Annexin V / PI staining experiment to study the effect of USP45 on melanoma cell apoptosis and found that excessive USP45 significantly increased the apoptosis of A375 cells ( Fig.11 A), while knocking down USP45 can slightly reduce the apoptosis of SKMEL2 cells, but this difference is not statistically significant ( Fig.11 B). These results suggest that overexpression of USP45 promotes apoptosis of melanoma cells.

[0139] The results showed that overexpression of USP45 inhibited the migration of A375 cells, while knockdown of USP45 enhanced the migration ability of SKMEL2 cells ( Fig.12 A and B). Consistent with this, excess USP45 significantly impaired the invasive ability of A375 cells, while knockdown of USP45 effectively enhanced the invasive ability of SKMEL2 cells ( Fig.12 C and D). These results suggest that USP45 inhibits the metastasis and invasion of melanoma cells.

[0140] Figure 8 The results showed that overexpression of USP45 or knockdown of USP45 had no effect on the mRNA level of MRGPRF, but had a significant effect on its protein level, indicating that USP45 regulates the post-translational modification of MRGPRF. Considering the deubiquitinase activity of USP45, the present invention constructed a plasmid encoding USP45 with an inactivated deubiquitinase active site (USP45C199A) ( Fig.13 A), and overexpressed USP45 or USP45C199A in A375 cells. Real-time fluorescence quantitative PCR results showed that compared with overexpression of USP45, overexpression of USP45C199A did not affect the mRNA levels of USP45 and MRGPRF ( Fig.13 B). Compared with cells overexpressing USP45, the protein level of MRGPRF in cells overexpressing USP45C199A was significantly decreased, and the phosphorylation levels of PI3K and AKT were significantly increased ( Fig.13 C and D). These results indicate that USP45 with mutations in the deubiquitinase domain cannot inhibit the activation of the PI3K / AKT pathway.

[0141] The present invention embodiment examines the effect of overexpression of USP45C199A on melanoma cells. The results of the MTT experiment showed that the proliferation of A375 cells overexpressing USP45C199A was significantly higher than that of A375 cells overexpressing USP45 ( Fig.14 A). The results of the clone formation experiment showed that the clone formation ability of A375 cells overexpressing USP45C199A was stronger than that of A375 cells overexpressing USP45 ( Fig.14 B). The results of 7AAD staining experiments showed that the proportion of USP45C199A-overexpressing A375 cells that remained in the G0 / G1 phase was lower than that of USP45-overexpressing A375 cells, while the proportion of USP45C199A-overexpressing A375 cells that entered the S phase was higher than that of USP45-overexpressing A375 cells ( Fig.14 C). Annexin V / PI staining results showed that overexpression of USP45C199A reduced apoptosis of A375 cells compared with A375 cells overexpressing USP45 ( Fig.14 D). Transwell experimental data showed that compared with A375 cells overexpressing USP45, A375 cells overexpressing USP45C199A had stronger migration and invasion abilities ( Fig.14 E and F). These experimental results fully demonstrate that the deubiquitinase domain is the core functional domain of USP45 in regulating the behavior of melanoma cells. The apoptosis of A375 cells overexpressing USP45C199A is weaker than that of A375 cells overexpressing USP45. (E and F) Transwell assay results show that the migration and invasion abilities of A375 cells overexpressing USP45C199A are significantly stronger than those of A375 cells overexpressing USP45.

[0142] In the present invention, the expression level of USP45 in different melanoma cell lines was first evaluated, and it was found that compared with the skin keratinocyte Hacat, the expression of USP45 protein in SKMEL2 cells was the highest and the expression in A375 cells was the lowest. This shows that there are large differences in the expression level of USP45 in different melanoma cells. Comparing the expression difference of USP45 in common melanocytes and melanoma cells can better reflect its effect on melanoma.

[0143] Through a series of cell biology experiments, the present invention found that overexpression of USP45 can inhibit the proliferation of melanoma cells, weaken their cloning ability, and reduce the proportion of cells entering the S phase. Conversely, knocking down USP45 promotes the proliferation of melanoma cells, enhances their cloning ability and accelerates the entry of cells into the S phase. In addition, overexpression of USP45 can promote the apoptosis of A375 cells, while knocking down USP45 has no significant effect on the apoptosis of SKMEL2 cells.

[0144] The reasons for this difference are: 1. The two melanoma cells have different sensitivities to USP45. For example, the expression level of USP45 in A375 cells is low, and after overexpression, it is more sensitive to its tumor suppressor effect and apoptosis is enhanced. On the contrary, the expression level of USP45 in SKMEL2 cells is high. Even if a part of it is knocked down, the remaining USP45 can still play a tumor suppressor role. 2. There are other tumor suppressor factors in SKMEL2 cells to compensate for the tumor suppressor effect weakened by USP45 knockdown. For example, some USP45 can also stabilize MRGPRF. Therefore, the next step is to study the effects of these USP45 on MRGPRF and melanoma cells, which is of great significance to evaluate this nature.

[0145] In addition, USP45 can inhibit the migration and invasion of melanoma cells. Bioinformatics analysis and cell experiment results show that USP45 achieves these functions by reducing the activity of the PI3K / AKT pathway. Nevertheless, the specific molecular mechanism by which USP45 inhibits this pathway needs further study to explain.

[0146] These results provide a strong theoretical basis for the speculation that USP45 is a tumor suppressor gene of melanoma. The present invention also reveals that the deubiquitinase catalytic domain is the core of USP45 function by studying the effect of USP45C199A on melanoma cells, which is consistent with its function as a deubiquitinase.

[0147] Through the above studies, the embodiments of the present invention clarify the tumor suppressor effect of USP45 in melanoma cells and its mechanism, and further explore whether USP45 affects melanoma cells through interaction with MRGPRF.

[0148] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modification, equivalent substitution and improvement made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. A melanoma marker detection system based on USP45-MRGPRF interaction, It is characterized in that include: Vector construction modules for constructing different expression vectors of USP45 and / or MRGPRF; A cell transfection module, used for transfecting the expression vector into a melanoma cell line; Activity detection module, used to detect the activity changes of melanoma cells after transfection, including cell proliferation, apoptosis and viability, through biological experiments, and to evaluate the effect of the interaction between USP45 and MRGPRF on melanoma cells; The diagnostic evaluation module is used to provide auxiliary diagnostic information of melanoma based on the detection results of the interaction between USP45 and MRGPRF.

2. The melanoma marker detection system based on USP45-MRGPRF interaction according to claim 1, It is characterized in that Also includes: Drug target screening module, used to analyze the interaction between USP45 and MRGPRF in melanoma cells and identify potential drug targets; Drug Evaluation Module, used to develop and screen drug candidates targeting USP45-MRGPRF interaction and evaluate their effectiveness in melanoma treatment.

3. A method for detecting melanoma cell markers based on USP45-MRGPRF interaction, It is characterized in that The steps include: constructing different expression vectors of USP45 and / or MRGPRF, and transfecting the expression vectors into melanoma cell lines; Biological experiments were performed to detect changes in the activity of melanoma cells, including cell proliferation, apoptosis, and viability, to evaluate the effects of the interaction between USP45 and MRGPRF on the behavior of melanoma cells; Based on the above detection results, the strength of the interaction between USP45 and MRGPRF was used as an indicator to study the behavior of melanoma cells.

4. The method for detecting melanoma cell markers based on USP45-MRGPRF interaction according to claim 3, It is characterized in that By analyzing the interaction between USP45 and MRGPRF in melanoma cells, potential drug targets were further screened and used to develop candidate drugs targeting the USP45-MRGPRF interaction and evaluate their therapeutic effects in melanoma cell models.

5. The method for detecting melanoma cell markers based on USP45-MRGPRF interaction according to claim 4, It is characterized in that The following steps are also included: The expression of USP45 was detected in melanoma cells, and the effects on cell proliferation, cell cycle, apoptosis, migration and invasion were verified by overexpressing or knocking down USP45, thereby revealing the function of USP45 in melanoma cell models.

6. The method for detecting melanoma cell markers based on USP45-MRGPRF interaction according to claim 5, It is characterized in that The following steps are also included: USP45 and MRGPRF were overexpressed in melanoma cells, and their interaction was detected by co-immunoprecipitation and GST pulldown techniques; The functional domain mutants and structural domain truncation mutants of USP45 were constructed, and their binding sites with MRGPRF and the functional sites affecting MRGPRF ubiquitination were studied by co-immunoprecipitation. Different ubiquitin mutants were constructed and the effects of USP45 on MRGPRF ubiquitination were studied by co-immunoprecipitation. USP45 was overexpressed or knocked down in melanoma cells to evaluate its effect on the ubiquitination level and stability of MRGPRF.

7. The method for detecting melanoma cell markers based on USP45-MRGPRF interaction according to claim 6, It is characterized in that The following steps are also included: Knock down or overexpress MRGPRF in melanoma cells with USP45 overexpression or knockdown, and verify through recovery experiments whether USP45 regulates cell behavior in melanoma cell models by enhancing the stability of MRGPRF; Melanoma cells and xenograft models with stable overexpression of USP45 were constructed, and in vivo experiments were performed to verify its effect on melanoma growth.

Images