A molecular marker for identifying immune traits of Tibetan sheep and its application

Abstract

The present invention relates to the field of molecular marker technology, and particularly to a molecular marker for identifying immune traits of Tibetan sheep and its application. A molecular marker for identifying immune traits of Tibetan sheep, the molecular marker is located at the 61,720,490th base on chromosome 12 of the international sheep genome version Oar_v4.0, and the mutated base is G or A. By detecting the base at the 61,720,490th nucleotide site on chromosome 12 of Tibetan sheep, the present invention can determine the contents of immunoglobulin IgA and IgG in Tibetan sheep individuals. The present invention provides a new SNP molecular marker resource for marker-assisted selection of immune traits of Tibetan sheep for non-diagnostic purposes.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and particularly relates to a molecular marker for identifying immune traits of Tibetan sheep and its application. Background Art

[0002] With the continuous development of the sheep farming industry, the types of sheep diseases are increasing, the complexity is intensifying, and the control is becoming more and more difficult. The harm of sheep diseases to sheep farming production is becoming increasingly serious. At the same time, the use of a large number of drugs will make the animal body develop drug resistance, posing a hidden danger to the safety of livestock products.

[0003] In the long run, starting from the research on the genetic basis of disease resistance, screening resistance genes, carrying out disease-resistant breeding at the molecular level, and genetically improving the resistance of sheep to pathogens and enhancing immunity are important ways to fundamentally solve this problem. Tibetan sheep have long lived in the Qinghai-Tibet Plateau region with a harsh environment and need higher disease resistance to adapt to this environment. Therefore, only by improving the disease resistance of Tibetan sheep can sheep have stronger adaptability to harsh natural environments such as high altitude, low air pressure, strong ultraviolet rays, hypoxia, and nutritional stress in the cold season.

[0004] Immune indexes can reflect the disease resistance of animals. The disease resistance of animals mainly depends on the health status and ability of their immune systems. The main function of the immune system is to recognize and eliminate pathogens invading the body, such as bacteria, viruses, etc. When pathogens invade, the immune system will quickly respond and initiate a series of immune response processes to fight against and eliminate pathogens.

[0005] Immunoglobulin (Ig) refers to globulins with antibody (Ab) activity or chemical structure, which are similar to antibody molecules. Immunoglobulin is a four - peptide chain structure composed of two identical light chains and two identical heavy chains linked by inter - chain disulfide bonds. Immunoglobulins are divided into five categories, namely immunoglobulin G (IgG), immunoglobulin A (IgA), immunoglobulin M (IgM), immunoglobulin D (IgD), and immunoglobulin E (IgE). IgG refers to immunoglobulin G, accounting for about 75% of serum antibodies, which can enhance the body's immunity and has functions such as antiviral and anti - inflammatory effects. IgA refers to immunoglobulin A, ranking second in content in the body's serum, second only to IgG, and has the function of anti - infection. If the content of IgG and IgA in the body decreases, it is easy to lead to low immune function. If the content of IgG and IgA in the body increases, the disease - resistance ability of the body is enhanced. And the enhancement of disease - resistance ability can reduce the use of drugs, lower production costs, and increase breeding efficiency. Therefore, screening SNP molecular markers associated with the immune traits of Tibetan sheep is of great significance. Moreover, immune indicators can be used as an important reference to evaluate the disease - resistance ability and health status of animals. By monitoring the changes in immune indicators, immune problems in animals can be detected in a timely manner, and corresponding measures can be taken to improve their disease - resistance ability and prevent and treat diseases.

[0006] Therefore, how to use means such as genetics and genetic engineering technologies to find the variation sites at the gene level in Tibetan sheep breeding, discover the relationship between genes and traits through association analysis between them, and conduct early selection, so as to improve the selection efficiency and accuracy, has broad application value. Summary of the Invention

[0007] The purpose of the present invention is to provide a molecular marker for identifying the immune traits of Tibetan sheep and its application.

[0008] In order to achieve the above - mentioned invention purpose, the present invention provides the following technical solutions:

[0009] The present invention provides a molecular marker for identifying the immune traits of Tibetan sheep. The molecular marker is located at the 61720490th base on chromosome 12 of the international sheep genome version Oar_v4.0, and the mutant base is G or A.

[0010] Preferably, the genotype of Tibetan sheep with the mutant base G is GG or GA;

[0011] The genotype of Tibetan sheep with the mutant base A is AA;

[0012] The levels of immunoglobulin IgA and IgG in Tibetan sheep individuals with the AA genotype are significantly higher than those in individuals with the GG and GA genotypes;

[0013] There was no significant difference in immunoglobulin IgA and IgG between Tibetan sheep individuals with GG and GA genotypes.

[0014] The present invention also provides the application of the described molecular marker in marker-assisted selection of immune traits of Tibetan sheep for non-diagnostic purposes.

[0015] The present invention also provides the application of the described molecular marker in the assisted breeding of Tibetan sheep.

[0016] The present invention also provides a primer pair for amplifying the described molecular marker, and the primer pair is shown as SEQ ID NO.2 and 3.

[0017] The present invention also provides the application of the described primer pair in the preparation of a product for marker-assisted selection of immune traits of Tibetan sheep for non-diagnostic purposes.

[0018] The present invention also provides the application of the described primer pair in the preparation of a product for the assisted breeding of Tibetan sheep.

[0019] The present invention also provides a method for marker-assisted selection of immune traits of Tibetan sheep for non-diagnostic purposes, including the following steps:

[0020] (1) Extract genomic DNA of Tibetan sheep;

[0021] (2) Using the genomic DNA of Tibetan sheep obtained in step (1) as a template, amplify with the described primer pair to obtain an amplification product;

[0022] (3) Perform genotype analysis on the amplification product to obtain Tibetan sheep with different genotypes; associate the genotypes of Tibetan sheep with immune indicators; the immune indicators include IgA and / or IgG.

[0023] Preferably, the amplification system described in step (2) is: 22 μL of GoldMix (green), 1 μL of each of the upstream and downstream primers, and 1 μL of template DNA;

[0024] The amplification program described in step (2) is: 98 °C for 2 min; 98 °C for 10 s, 56 °C for 10 s, 72 °C for 10 s, a total of 40 cycles; 72 °C for extension for 2 min.

[0025] The present invention also provides a kit for marker-assisted selection of immune traits of Tibetan sheep for non-diagnostic purposes and / or assisted breeding of Tibetan sheep, including reagents for detecting the described molecular marker or the described primer pair.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The SNP molecular marker described in the present invention is located at the 61,720,490th base on chromosome 12 of the international sheep reference genome version Oar_v4.0; the mutation type is G / A, named g61720490G>A, and there are three genotypes. When the 61,720,490th base on chromosome 12 is G, the genotype is GG or GA; when the 61,720,490th base on chromosome 12 is A, the genotype is AA. Through the correlation analysis between different genotypes and the contents of immunoglobulins IgA and IgG, it is found that the contents of immunoglobulins IgA and IgG in Tibetan sheep individuals with the AA genotype are significantly higher than those in individuals with the GG and GA genotypes (p<0.05), and there is no significant difference in the contents of immunoglobulins IgA and IgG between Tibetan sheep individuals with the GG and GA genotypes (p>0.05).

[0028] By detecting the base at the 61,720,490th nucleotide site on chromosome 12 of Tibetan sheep, the present invention can judge the contents of immunoglobulins IgA and IgG in Tibetan sheep individuals, and the present invention provides a new SNP molecular marker resource for marker-assisted selection of immune traits of Tibetan sheep for non-diagnostic purposes. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative work.

[0030] Figure 1 is the PCR amplification product; where M represents Marker; 1, 2, and 3 represent 3 groups of replicates.

[0031] Figure 2 is the peak map and sequence obtained after the PCR product is purified and sequenced. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0032] The following will describe in detail the technical solutions provided by the present invention in combination with the embodiments, but they cannot be understood as a limitation to the protection scope of the present invention.

[0033] Example 1

[0034] 1. Sample collection

[0035] The samples were from Tibetan sheep populations under natural grazing conditions, including 60 from Gannan Tibetan Autonomous Prefecture, Gansu Province, 40 from Yushu Tibetan Autonomous Prefecture, Qinghai Province, and 60 from Shigatse City, Tibet Autonomous Region. 5 mL of fasting Tibetan sheep blood samples were collected from 160 sheep into clean coagulation-promoting vacuum blood collection tubes, left standing for 30 min, then centrifuged at 3500 r / min for 15 min, and the supernatant was aspirated into a clean PE tube, sealed and stored in a -20 °C low-temperature refrigerator; another 5 mL of blood samples were collected into blood collection tubes containing EDTA-K2 anticoagulant, quickly mixed after blood sample collection, placed in a sampling box with ice packs for temporary storage, and stored frozen in a -20 °C refrigerator after being transported back to the laboratory for genomic DNA extraction.

[0036] 2. Main Reagents and Instruments

[0037] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; Blood Genomic DNA Extraction Kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific Company, USA; DL2000 Marker, agarose, and nucleic acid dye were all purchased from Beijing Solarbio Science & Technology Co., Ltd.; GoldMix (green) was purchased from Beijing Tsingke Biotechnology Co., Ltd.; Electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad Company. Immunoglobulin A (IgA) (E027-1-1) and Immunoglobulin G (IgG) (E026-1-1) detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0038] 3. Methods

[0039] 3.1 Detection of Immunoglobulins IgA and IgG

[0040] The IgA and IgG detection kits from Nanjing Jiancheng Bioengineering Institute were used for determination by spectrophotometry. First, a standard curve was established using standard products; secondly, 7 μL of distilled water, standard solution, and the sample to be tested were added to the blank tube, standard tube, and determination tube respectively, and R1 solution was added to make up to 900 μL, incubated at 37 °C for 5 min, and the reading at a wavelength of 340 nm was recorded as A1; then 180 μL of R1 solution was added to each tube, incubated at 37 °C for 5 min, and the reading at a wavelength of 340 nm was recorded as A2; finally, ΔA = A2 - A1 was calculated, and the IgA and IgG concentrations of the samples were calculated by substituting ΔA into the standard curve equation.

[0041] 3.2 Extraction of Blood Genomic DNA

[0042] Use the blood genomic DNA extraction kit from Tiangen Biochemical Technology (Beijing) Co., Ltd. to extract genomic DNA from blood samples. Place the extracted DNA under an ultraviolet spectrophotometer to detect the concentration and purity. A concentration > 20 ng / μL and an OD260 / OD280 between 1.7 and 1.9 meet the experimental requirements, and store it at -20°C for future use.

[0043] 3.3 Primer Design

[0044] Refer to the gene sequence of chromosome 12 in the international sheep genome Oar_v4.0 version (GenBank accession number: NC_019469.2), and use the primer premier5.0 software to design a pair of specific primers, which contain the g61720490G>A SNP locus.

[0045] Primer sequences:

[0046] F: 5'-GACATGCCCTCACTCAGACCT-3' (as shown in SEQ ID NO: 2);

[0047] R: 5'-ATGCCATGTGTCCAGATCACC-3' (as shown in SEQ ID NO: 3).

[0048] The amplified fragment length is 694 bp, and the primers are synthesized by Beijing Tsingke Biotechnology Co., Ltd.

[0049] 3.4 PCR Amplification and Sequencing

[0050] The PCR amplification system is 25 μL: 22 μL of gold medal Mix (green), 1 μL of each upstream and downstream primer, and 1 μL of template.

[0051] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, a total of 40 cycles; 72°C for extension for 2 min.

[0052] The PCR products are detected by 1.5% agarose gel electrophoresis. After the PCR products are qualified by agarose gel electrophoresis, direct sequencing is used for sequencing, which is completed by Beijing Tsingke Biotechnology Co., Ltd. The amplified nucleotide sequence is as shown in SEQ ID NO.1, and the SNP marker is located at the 396th position of the nucleotide sequence shown in SEQ ID NO.1.

[0053] Use the biological analysis software MEGA 6.0 to compare the sequencing results of the PCR products, analyze the sequencing peak map, and complete the genotyping.

[0054] 4. Statistical Analysis

[0055] According to the genotyping results, the number of individuals with different genotypes at each locus was counted. The Popgen32 software was used to calculate the gene frequency, genotype frequency, effective number of alleles (Ne), heterozygosity (He) of the locus, and Hardy-Weinberg equilibrium test of the g61720490G>A gene, and the polymorphism information content (PIC) was calculated using the PIC (polymorphism information content) calculation software. The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and immunoglobulins IgA and IgG, and the results were expressed as "mean ± standard error".

[0056] 5. Results

[0057] 5.1 PCR Amplification and Sequencing Results

[0058] The amplification products of the g61720490G>A SNP locus on chromosome 12 of Tibetan sheep were detected using 1.5% agarose gel (see Figure 1 ), the bands were clear without heterozygous bands, the specificity was good, and the fragment size of the PCR product was 694 bp, which was consistent with the expected size, and the next experiment could be carried out.

[0059] SEQ ID NO.1

[0060] GACATGCCCTCACTCAGACCTCTCTCTTCTAATGGAATTTGCTGAACGCCATGAGGGGAAAGAGTATGGGTCCCAGCTGGGAAACCTACCTAGTATTGAAGCCCTGCAGATAGAAGGTCAGGAACACCATCTCCTGCAAGAACAGCCCAGGGTGAACTTAGGTCATCAGAGAACATTCAGTGTTTGTTAGTGTCTATCATCCAAGTGCCCTGGGCATCAGGAGCTGCCTGCCAAGAAGTATCAGATGTGGCTCTTGCCCTTGGAAAGCTTACATTCTGGATAAAAAGAAAATGAACAACAGATGAAACGTTAAATAAATGGCTTAGCTCTCTCCTAGAAGAGATGTCTGAAGTGGTTTGTTTCTTGGAAGGTGGCGCGCAGACACAGAAGTTGGTGACAGGCCAGGGCAAAGGGCACGGGGCCGGAGTCTACAGTCTCGTCCTGCCAAGCCGTCAGAGGCCCACGCCCCTCTCTGTAAAACAAGATGCCTGCTTCTCAGGGCTGCCTGGAGGGTCACGTCCATTTGTAAGGTTTATAATCAGGGCTTCGTGAAGAGCAGCAATTCCTACATCAATAATGGAGCACCCCCATCAAGTCCTCTGCTCAAACTCAAAGATGACAAGATGCCTTACTTCCTCGCCTCTGTTTCTTTCCTCTCTCCTTCTTGATTGGTGGTGATCTGGACACATGGCAT。

[0061] The peak map and sequence obtained after purification and sequencing of the PCR product are shown in Figure 2 . It can be seen from Figure 2 that there is a G-A mutation at the g61720490G>A SNP site, and there are three genotypes: GG, GA, and AA.

[0062] 5.2 Statistical analysis results

[0063] Analysis was carried out on the genotype and allele frequencies of the g61720490G>A SNP locus on chromosome 12 of Tibetan sheep from the perspective of population genetics. As can be seen from Table 1, at the g61720490G>A SNP locus, the GG genotype frequency was the highest, being the dominant genotype, and the G allele frequency was 94.7%, showing the dominant allele. The χ2 goodness-of-fit test indicated that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.101, and the PIC was 0.096. With PIC<0.25, it belonged to low polymorphism.

[0064] Table 1 Polymorphism of the g61720490G>A SNP locus on chromosome 12 of Tibetan sheep

[0065]

[0066] 5.3 Association analysis of different genotypes with immunoglobulin IgA and IgG

[0067] The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and the contents of immunoglobulin IgA and IgG. The results showed that the contents of immunoglobulin IgA and IgG in Tibetan sheep individuals with the AA genotype were significantly higher than those in individuals with the GG and GA genotypes (p<0.05), and there was no significant difference in the immunoglobulin IgA and IgG between Tibetan sheep individuals with the GG and GA genotypes (p>0.05). This indicated that the base at the g61720490G>A SNP locus on chromosome 12 of Tibetan sheep was significantly correlated with IgA and IgG in Tibetan sheep, and it was an SNP marker related to IgA and IgG in Tibetan sheep. The results are shown in Table 2.

[0068] Table 2 Correlation analysis between different genotypes and immunoglobulin IgA and IgG

[0069]

[0070] Note: Different lowercase letters marked between data in the same row indicate significant differences (P<0.05).

[0071] In summary, the SNP molecular marker of the present invention is located at the 61,720,490th base on chromosome 12 of the international sheep reference genome version Oar_v4.0; the mutation type is G / A, named g61720490G>A, and there are three genotypes. When the 61,720,490th base on chromosome 12 is G, the genotype is GG or GA; when the 61,720,490th base on chromosome 12 is A, the genotype is AA; through the association analysis of different genotypes with the contents of immunoglobulins IgA and IgG, it is found that the contents of immunoglobulins IgA and IgG of Tibetan sheep individuals with the AA genotype are significantly higher than those of GG and GA genotype individuals (p<0.05), and there is no significant difference in the contents of immunoglobulins IgA and IgG between GG and GA genotype Tibetan sheep individuals (p>0.05). By detecting the base at the 61,720,490th nucleotide site on chromosome 12 of Tibetan sheep, the contents of immunoglobulins IgA and IgG of Tibetan sheep individuals can be judged. The present invention provides a new SNP molecular marker resource for marker-assisted selection of immune traits of Tibetan sheep for non-diagnostic purposes.

[0072] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of a reagent for detecting molecular markers in the preparation of an in vitro detection reagent for the immune traits of Tibetan sheep or an auxiliary breeding detection reagent for the immune traits of Tibetan sheep, characterized in that, The molecular marker is located at the 61,720,490th base on chromosome 12 of the international sheep genome version Oar_v4.0, and the mutated base is G or A; among them, the levels of immunoglobulin A and immunoglobulin G in Tibetan sheep individuals with the AA genotype are significantly higher than those in individuals with the GG and GA genotypes; there is no significant difference in the levels of immunoglobulin A and immunoglobulin G between Tibetan sheep individuals with the GG and GA genotypes.

2. The application according to claim 1, characterized in that, The primer pair for detecting the molecular marker is as shown in SEQ ID NO.2-3.

3. A method for marker-assisted selection of immune traits in Tibetan sheep for non-diagnostic purposes, characterized in that, It includes the following steps: (1) Extract the genomic DNA of Tibetan sheep; (2) Using the genomic DNA of Tibetan sheep obtained in step (1) as a template, perform amplification with the primer pair as shown in SEQ ID NO.2-3 to obtain an amplification product; (3) Perform genotype analysis on the amplification product to obtain Tibetan sheep with different genotypes; correlate the genotypes of Tibetan sheep with immune indexes; the immune indexes are immunoglobulin A and immunoglobulin G; The primer pair is used for amplifying a molecular marker; the molecular marker is located at the 61,720,490th base on chromosome 12 of the international sheep genome version Oar_v4.0, and the mutated base is G or A; among them, the levels of immunoglobulin A and immunoglobulin G in Tibetan sheep individuals with the AA genotype are significantly higher than those in individuals with the GG and GA genotypes; there is no significant difference in the levels of immunoglobulin A and immunoglobulin G between Tibetan sheep individuals with the GG and GA genotypes.

4. The method according to claim 3, wherein The amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, a total of 40 cycles; 72°C for extension for 2 min.

Images