A kit for detecting SNP markers of south xinjiang local meat sheep and its application

Abstract

The application discloses a kit for detecting SNP markers of double-lamb of Nanjiang local meat sheep and Duolang sheep and application thereof, relates to the field of molecular breeding, and the SNP marker of the application is located downstream of a COL21A1 gene, the SNP marker is located at a 4505310th position of a 20th chromosome of sheep, an original base is T, and a variation base is C; the nucleotide sequence of the SNP marker is NSE; the lamb number of an individual with a TC genotype of the SNP site is significantly higher than that of an individual with a TT genotype. The nucleotide sequences of primers of the application are NSEF1 and NSER2. The kit is applied to detection of the lamb number of Duolang sheep, and how the lamb number of Duolang sheep is determined by detecting the genotypes of the SNP markers. The kit can be used for breeding of the reproductive traits of Duolang sheep.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular breeding, and in particular to a kit for detecting SNP markers in twin lambs of Duolang sheep, a local meat sheep in southern Xinjiang, and applications thereof. Background Art

[0002] The Duolang sheep is a superior dual-purpose breed of sheep from the Xinjiang Uyghur Autonomous Region, a member of the genus Ovis, family Ovis, order Artiodactyla. Because its primary production area is in Maigaiti County, it is also known as the Maigaiti sheep. Duolang sheep are large, produce abundant, tender meat, and have a fine, downy coat. They have a high reproductive rate and mature early, making them an ideal breed for lamb production.

[0003] Duolang sheep have a high reproductive capacity and sexual maturity early. Male lambs generally reach sexual maturity at 6-7 months of age, while female lambs are first mated at 6-8 months of age. Most one-year-old ewes have already given birth. The estrus cycle of ewes is generally 15-18 days, with an average estrus duration of 24-48 hours. The gestation period is 150 days. Ewes typically give birth to three litters in two years, while those in good condition can give birth to two per year. The twinning rate is high, reaching 33%, and some have even given birth to three or four lambs in a single litter. A single ewe can produce up to 15 lambs in its lifetime.

[0004] However, there are significant differences in the number of lambs born by different multi-lang ewes. Therefore, how to predict the number of lambs born by multi-lang ewes in advance and effectively screen out multi-lang ewes for breeding remains a technical problem that herders urgently need to solve.

[0005] In Chinese patent CN108048578B, it was discovered that the number of lambs born in Duolang sheep is closely associated with the SNPs at 32015148G>A and 32033237A>G in the NCOA1 gene. However, the inventors of the present invention further discovered that the SNPs associated with the number of lambs born in Duolang sheep are not limited to those disclosed in the aforementioned patent, which led to the completion of the present invention. Summary of the Invention

[0006] In view of this, the present invention provides a kit for detecting SNP markers in twin lambs of the local meat sheep Duolang sheep in southern Xinjiang and its application. To achieve the above-mentioned purpose, the present invention mainly provides the following technical solutions:

[0007] On the one hand, the present invention relates to a kit for detecting SNP markers in twin lambs of Duolang sheep, a local meat sheep in southern Xinjiang. The SNP marker is located at position 4505310 on chromosome 20 of sheep, the original base is T, and the variant base is C; the nucleotide sequence where the SNP marker is located is NSE.

[0008] In a preferred embodiment of the present invention, the SNP marker further comprises the NCOA1 gene SNP sites 32015148G>A and / or 32033237A>G. By combining the SNP sites known in the prior art with the newly discovered SNP sites of the present invention, the detection accuracy is further improved.

[0009] Preferably, the number of lambs born by individuals with the TC genotype at the SNP site is significantly higher than that of individuals with the TT genotype.

[0010] On the other hand, the kit of the present invention includes primers for detecting the above-mentioned SNP markers, and the nucleotide sequence of the primers is NSE.

[0011] On the other hand, an embodiment of the present invention provides the use of the above-mentioned detection kit in the breeding of Duolang sheep.

[0012] On the other hand, an embodiment of the present invention provides a method for screening SNP markers that affect the lambing number of Duolang sheep, the method comprising: determining the lambing number trait of the sheep by detecting the above-mentioned SNP markers in the genes of the sheep to be tested.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The present invention uses whole-genome resequencing and whole-genome association analysis to screen for the above-mentioned specific SNP sites, and verifies the credibility of these sites through first-generation sequencing. Further, through association analysis with lambing number, the genotype of individuals with high lambing number is determined. A significance test is then performed to determine whether the SNP site significantly affects the lambing number of Duolang sheep. Ultimately, SNP markers that affect the lambing number of Duolang sheep are identified and screened. The genotypes determined in the present invention are TT and TC. Individuals with the TC genotype are selected to improve the lambing number of Duolang sheep. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Manhattan plots calculated by two software programs in the method of the present invention: PLINK software for autosomes (A) and chromosome X (B); GCTA software for autosomes (C) and chromosome X (D); SAIGE software for autosomes (E) and chromosome X (F); G, information on 18 significant or suggestive loci, with different colors representing the proportion of different genotypes within the group. The top of each locus plot shows the annotated gene, and the right side shows, from top to bottom, the physical location, GWAS P value, P value of the additive effect of a single locus, and P value of the heterozygous effect of a single locus.

[0016] Figure 2The figures are Manhattan plots of overdominance effects in the methods of the embodiments of the present invention: A, Manhattan plot calculated by plink software; B, Manhattan plot calculated by GCTA software; C, Manhattan plot calculated by SAIGE software; D, information on 27 significant or suggestive loci, with different colors representing the proportion of different genotypes within the group. The top of each locus plot shows the annotated gene, and the right side shows, from top to bottom, the physical location, the GWAS P value, and the P value of the heterozygous effect of a single locus.

[0017] Figure 3 This is a diagram of genomic DNA extraction in the method of the embodiment of the present invention;

[0018] Figure 4 This is a PCR amplification diagram in the embodiment of the present invention;

[0019] Figure 5 This is the genotype diagram of this site determined by first-generation sequencing of 120 sheep in the method of the embodiment of the present invention. DETAILED DESCRIPTION

[0020] To further illustrate the technical means and effects employed by the present invention to achieve its intended objectives, the following detailed description of the specific implementation methods, technical solutions, features, and effects of the present invention is provided below, using preferred embodiments as an example. The specific features, structures, or characteristics of the various embodiments described below may be combined in any suitable manner.

[0021] Example 1

[0022] (1) Genome-wide association analysis of reproductive traits in Duolang sheep

[0023] Based on the whole genome sequence (10X) variation data of 151 twin-bearing sheep and 151 single-bearing sheep, the first five principal components were used as fixed effects. Case-control additive effect GWAS analysis was performed using three software programs: plink, SAIGE, and GCTA. It was found that 18 gene loci had significant or suggestive signals (P < 1×10-6) ( Figure 1 AF). Further single-locus chi-square test found that these 18 gene loci had significant differences in the single and twin lamb groups (P<0.05). We further used chi-square test to detect the differences between heterozygotes and homozygotes in the single and twin lamb groups and found that 16 loci had significant differences (P<0.05) ( Figure 1 G).

[0024] Based on the additive effect GWAS finding that there are significant differences between groups in heterozygotes at significant or suggestive loci, we further conducted a GWAS analysis of heterozygote effects (i.e., overdominance effects) and found that 27 gene loci had significant or suggestive signals (P < 1 × 10 -6 )( Figure 2 AC). Further chi-square test found that the effects of these 27 gene loci were significant (P<0.001) ( Figure 2 D) Association analysis revealed a strong association between a single nucleotide polymorphism (SNP) at position 4505310 on chromosome 20 and lamb size. To further verify whether this locus had a false-positive effect and whether the mutation affected lamb size, this study conducted a validation study in 120 additional sheep.

[0025] (2) Extraction and detection of genomic DNA

[0026] DNA was extracted from 120 sheep blood samples using the phenol-chloroform extraction method. The quality of the DNA was tested by 1% agarose gel electrophoresis. If the DNA met the requirements, it was stored in a -200°C refrigerator for future use. The genomic DNA was tested by 1% agarose gel electrophoresis. The results showed that the genomic DNA bands were clear and bright ( Figure 3 ). This indicates that the extracted genomic DNA is of high purity and good quality and can be used for subsequent experiments.

[0027] (3) Primer design and synthesis

[0028] Primers were designed using prime 5 software and synthesized by Shanghai Sangon Biotechnology Co., Ltd. The primer sequences are as follows: The nucleotide sequence of the SNP marker is NSE:

[0029] CAAGGATCAAAGCATCTGGCTTTATGAGAGCCAGGTTCTGGCAGGGGTGGCTGGCGGTCTTCTCAAGAAAGCTGACATCTGCTGAGGAT[T / C]AGAAGTCTGAAAGGGAAGTACTAT AGGTGAATATGGTGTGGTACATAGAGGTGAATGGGGTCGGGTGCCATCAGGGTTTCTG GGATGTGTTCTGAGACATCTC

[0030] The above ([T / C]) in the NSE sequence is a mutant base.

[0031] NSEF1, upstream primer: 5'-CAAGGATCAAAGCATCTGGCTTTATG-3'

[0032] NSER2, downstream primer: 5'-GAGATGTCTCAGAACACATCCCAGAAA-3'

[0033] The annealing temperature was 58°C.

[0034] (4) PCR amplification reaction

[0035] The PCR amplification reaction system and reaction procedures are shown in Tables 1 and 2.

[0036] Table 1 PCR reaction system (total volume: 20ul)

[0037]

[0038] Table 2 PCR amplification reaction program

[0039]

[0040] (5) PCR amplification product detection

[0041] Agarose gel electrophoresis can be used to detect whether the marker has specific bands. 1.5% agarose gel was used to detect the PCR amplification product. The results showed that the bands were clear and bright, of good quality, and met the requirements ( Figure 4 ).

[0042] (6) PCR product sequencing

[0043] The PCR amplification product was sent to Shanghai Bioengineering for first-generation sequencing. The sequencing results showed that the T site was mutated into a C site (the results are as follows Figure 5 ).

[0044] (7) Correlation analysis and application

[0045] SPSS23.0 software was used to perform a significance test on the genotypes of the detected SNP sites: TT, TC and the number of lambs born in Duolang sheep. The results are shown in Table 3.

[0046] Table 3 Comparison of lambing numbers of individuals with different genotypes

[0047] variety genotype Number of litters Mean ± SD Duolangyang TT(66) <![CDATA[1.39±0.49 B ]]> TC(54) <![CDATA[1.64±0.48 A ]]>

[0048] Note: Mean ± SD means mean ± standard deviation. When the data in the same column are marked with different capital letters, the difference is extremely significant (P < 0.01).

[0049] Table 3 shows that this SNP is closely associated with lamb size in Duolang sheep. The average lamb size of individuals with the TC genotype is significantly higher than that of individuals with the TT genotype. In practical production applications, selecting individuals with the TC genotype can increase lamb size in Duolang sheep and accelerate the breeding of lamb-producing sheep in the Xinjiang Uyghur Autonomous Region.

[0050] The application determines the SNP molecular marker above by the method of example 1, and the specific position is Chr20:g.4505310 site T>C (base T is mutated to base C), wherein the lambing number of the individual with genotype TC is extremely significantly higher than that of the individual with genotype TT; the application can be used for screening Duolang sheep varieties with more lambing number by finding the SNP molecular marker above.

[0051] The application uses the SNP marker above for identifying the lambing number trait, and also develops a primer for detecting the SNP marker above, a forward primer (NSEF1) and a reverse primer (NSER2):

[0052] Upstream primer: 5'-CAAGGATCAAAGCATCTGGCTTTATG-3';

[0053] Downstream primer: 5'-GAGATGTCTCAGAACACATCCCAGAAA-3'.

[0054] The SNP marker, primer and kit of the application can be applied to detect the lambing number trait.

[0055] The application can detect the lambing number trait of Duolang sheep by using the SNP marker and primer above, and screen out individuals with genotype TC as the multiple product varieties, and then apply to Duolang sheep breeding.

[0056] The skilled in the art can select from the prior art for the unfinished part in the examples of the application.

[0057] The above disclosure is only a specific embodiment of the application, but the protection scope of the application is not limited to this, any skilled person in the art can easily think of changes or replacements within the technical range disclosed by the application, which should be covered in the protection scope of the application. Therefore, the protection scope of the application should be subject to the protection scope of the above claims.

Claims

1. An application of a SNP marker associated with the number of lambs born in Duolang sheep in the breeding of Duolang sheep, wherein the nucleotide sequence of the SNP marker is shown in SEQ ID No.1, the original base at position 90 of the SEQ ID No.1 is T, and the variant base is C, and the number of lambs born in individuals with the TC genotype of the SNP marker is extremely significantly higher than the number of lambs born in individuals with the TT genotype.

2. A method for detecting the lambing number trait of Duolang sheep, characterized in that: The method comprises: determining the genotype of the sheep by detecting a SNP marker in a sheep gene to be detected; wherein the SNP marker is the SNP marker according to claim 1.

3. A method for detecting the lambing number trait of Duolang sheep according to claim 2, characterized in that, The method comprises the following steps: Genomic DNA was extracted from sheep blood samples; after resequencing, specific SNP sites were analyzed using the whole-genome association analysis method; PCR amplification was performed using the DNA as an amplification template, an upstream primer with a nucleotide sequence of SEQ ID No. 2, and a downstream primer with a nucleotide sequence of SEQ ID No. 3 as amplification primers, and the amplified products were sent to the company for first-generation sequencing, and the typing results of this site were obtained as TT type and TC type. The typing of this site in all individuals was determined based on the resequencing results, and the number of lambs born of sheep corresponding to different genotypes was counted. The difference in average number of lambs born of different genotypes was compared using the independent sample T test method to determine the extent to which this site affects the number of lambs.

4. The method for detecting the lambing number trait of Duolang sheep according to claim 2, wherein: Among the genotypes of the SNP markers, the number of lambs born by individuals with the TC genotype was significantly higher than that of individuals with the TT genotype.

5. The method for detecting the lambing number trait of Duolang sheep according to claim 3, characterized in that: The PCR reaction conditions were as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, 30 cycles, annealing at 30 s, 30 cycles, extension at 72°C for 1 min, 30 cycles, extension at 72°C for 10 min, 1 cycle, and storage at 4°C. The PCR reaction system:

Images