TMEM165 gene SNP (Single Nucleotide Polymorphism) molecular marker related to feed conversion rate of yellow feather broiler and application of TMEM165 gene SNP molecular marker

Abstract

The invention discloses a TMEM165 gene SNP (Single Nucleotide Polymorphism) molecular marker related to the feed conversion rate of yellow feather broilers and application of the TMEM165 gene SNP molecular marker, and belongs to the technical field of animal genetic breeding and molecular biology. The SNP molecular marker is located at a 64634301 site basic group of a chicken chromosome 4 rs312546095 sequence, and the polymorphism is G / A. The invention provides the SNP molecular marker of the TMEM165 gene related to the feed conversion rate of the yellow-feathered broilers, the polymorphism of the SNP molecular marker is remarkably related to the feed conversion rate of the yellow-feathered broilers, and the yellow-feathered broilers with low feed conversion rate can be quickly selected and remained when the SNP molecular marker is applied to breeding of the yellow-feathered broilers; the method can be applied to efficiently screening individual or parent yellow-feather hens with low feed conversion rate and excellent shapes, effectively reduces feed consumption in the production process, and improves economic benefits and competitiveness of enterprises.

Description

Technical Field

[0001] The present invention relates to the technical field of animal genetic breeding and molecular biology, and in particular to a TMEM165 gene SNP molecular marker associated with the feed conversion rate of yellow-feathered broiler chickens and an application thereof. Background Art

[0002] Yellow-feathered broilers are native broilers in my country, bred by hybridization of local high-quality breeds; compared with white-feathered broilers, yellow-feathered broilers have a longer growth cycle and more delicious meat, which meets the taste preferences of Chinese consumers. In 2023, the average monthly inventory of yellow-feathered grandparent breeders was 2.1634 million sets, an increase of 0.43% over 2022. With the rise in corn and soybean meal prices in 2022, especially the sharp rise in soybean meal prices, broiler feed has risen to a historical high. Affected by factors such as rising feed costs, the cost of raising yellow-feathered broilers in 2023 will rise by 2.36%. Therefore, saving feed costs is one of the key issues in raising yellow-feathered broilers.

[0003] Feed conversion rate is an indicator of feed efficiency in animal husbandry production. It indicates the amount of feed consumed per unit weight of product produced. Studies have shown that feed conversion rate, as a phenotypic trait for evaluating feed utilization efficiency, has moderate heritability and a good selection response. Selection of feed conversion rate will lead to less feed consumption without reducing production speed. Selecting a basic population with low feed conversion rate for genetic selection is conducive to reducing feed costs in breeding.

[0004] SNP molecular marker technology is a powerful tool for early selection of feed conversion rate traits and accelerating the genetic breeding process. Currently, there are few SNP molecular markers related to chicken feed conversion rate, and there is a lack of sufficient SNP molecular markers to be applied to the breeding of yellow-feathered broilers with low feed conversion rate. Summary of the invention

[0005] In order to solve the above technical problems, the purpose of the present invention is to provide a TMEM165 gene SNP molecular marker associated with the feed conversion rate of yellow-feathered broilers and its application, so as to solve the problem of the existing lack of SNP molecular markers associated with the feed conversion rate of yellow-feathered broilers.

[0006] The technical solution of the present invention to solve the above technical problems is as follows:

[0007] A TMEM165 gene SNP molecular marker associated with the feed conversion rate of yellow-feathered broilers. The SNP molecular marker is located at the 64634301 base of the rs312546095 sequence on chicken chromosome 4, and the polymorphism is G / A.

[0008] Furthermore, the mutation site and upstream and downstream sequences of the SNP molecular marker are shown in SEQ ID NO.1, wherein n is an A>G mutation site, and when n is A, it is a yellow-feathered broiler with low feed conversion rate;

[0009] SEQ ID NO.1: 5'-GCCTGGAAATGAGTCGTTGGAGGTGGTTTGCAC TTTGAAGTTTCCATTGCGTTTGCAGCCTGAGATGCAAATTCTTGCTTTAGAAGCTGATGTGGAAATTCCCCTGGAACTGGCAGGGATGTGTGCCGGAACTGATAATGCATCCCGCTTCAGTAGGGTTGGAAAGGCTGTGCTGGGTCATTGCTTGTGTTCACATTGCTnGTGTGGTGATTTGCAGAG CCTTATCTTCACTGCCTAAGCATCCACTCACCACATTTAACATCCTCCAGCCACAAGAGCAAACAAAATAGCAGAGAACCATCAAAAGCTCCAGCTACTTTAGTCTCTGTTTCTCATTCTACTGTGCGAGGCAAACTCAAAATATTTAAAAGGAAGAGTACTATTTAAATTGTGTACATTTC-3'.

[0010] Furthermore, the forward primer sequence of the primer is shown as SEQ ID NO.2, and the reverse primer sequence is shown as SEQ ID NO.3;

[0011] SEQ ID NO.2: 5'-GTTGGAGGTGGTTTGCACTTTGA-3';

[0012] SEQ ID NO. 3: 5'-TGCCTCGCACAGTAGAATGAGAA-3'.

[0013] A kit for detecting the above-mentioned SNP molecular markers comprises the above-mentioned primers.

[0014] Application of the above-mentioned SNP molecular markers or primers or kit in breeding yellow-feathered broilers with low feed conversion rate.

[0015] A method for breeding yellow-feathered broilers with low feed conversion rate comprises the following steps: amplifying and sequencing SNP molecular markers of individuals to be tested by PCR technology, and screening to obtain homozygous individuals whose SNP molecular marker genotype is AA.

[0016] Furthermore, the above primers or kits are used to perform PCR amplification of SNP molecular markers.

[0017] Furthermore, the PCR amplification system was: 2×Taq Master Mix 10 μL, forward and reverse primers 1 μL each, DNA template 1 μL, and ddH2O to 20 μL.

[0018] Furthermore, the PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, extension at 72°C for 15 s, 35 cycles; and extension at 72°C for 5 min.

[0019] The present invention has the following beneficial effects:

[0020] The present invention provides a SNP molecular marker of the TMEM165 gene associated with the feed conversion rate of yellow-feathered broilers. The polymorphism of the SNP molecular marker is significantly correlated with the feed conversion rate of yellow-feathered broilers. By applying the SNP molecular marker to the breeding of yellow-feathered broilers, yellow-feathered broilers with low feed conversion rates can be quickly selected. The marker can be used to efficiently screen individuals or parents of yellow-feathered hens with excellent shapes with low feed conversion rates, effectively reducing feed consumption in the production process and improving the economic benefits and competitiveness of the enterprise. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Manhattan plot of the SNP molecular markers in Example 1;

[0022] Figure 2 This is the SNP molecular marker genotype sequencing diagram in Example 2. DETAILED DESCRIPTION

[0023] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. If specific conditions are not specified in the embodiments, they are carried out according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0024] Example 1: Screening of SNP molecular markers

[0025] 1872 healthy yellow-feathered broiler chickens were selected. All the experimental chickens were mixed and fed until 56 days of age. After 56 days of age, they were transferred to individual cages for feeding. The experiment ended at 98 days of age. The feed intake, initial test weight and final weight of each chicken were recorded, and the feed conversion rate was calculated. The calculation formula is as follows:

[0026]

[0027] Where, FCR is feed conversion rate; W f is feed consumption; W a To increase the weight of living organisms.

[0028] The lower the FCR value, the lower the feed conversion rate, which means that less feed is consumed for the same production capacity during the production process, which means that feed is saved. In the characterization records of the 49-day-old body weight trait, there are minimum values ​​that deviate far from the core distribution area. This may be an erroneous record or other abnormal situation and needs to be eliminated.

[0029] The above trait characterization records were subjected to quality control processing, and the upper / lower limits of the quality control standard were the mean ± 3 × standard deviation (x ± 3u). The phenotypes within this range were valid records, and the phenotypes outside this range were invalid records and set to missing values ​​(NA).

[0030] 1872 DNA samples of yellow-feathered chicken breeders were collected and tested for quality. The DNA concentration was tested using Qubit Fluorometer, and the DNA fragment size and degradation degree were tested using agarose gel electrophoresis. The test results showed that 99 samples were unqualified, and the qualified 1773 yellow-feathered chicken breeder DNA samples were used for subsequent library construction and sequencing.

[0031] The 1773 samples that passed the quality inspection were sequenced. The library was constructed using the MGIEasy DNA library rapid preparation kit. The genomic DNA was interrupted by double enzyme digestion, and the fragments were recovered and connected to the adapters; equal amounts of connection products were selected and mixed, and single-stranded circles and DNB balls were amplified by PCR. PE100 sequencing was performed using BGISEQ500. The sequencing data were downloaded three times, with 188 samples downloaded in the first time, 1491 samples downloaded in the second time, and 94 samples downloaded in the third time.

[0032] The raw data of each sample is obtained through sequencing, filtered using SOAP software, compared with the reference genome using bwa software, and then variants are detected and genotyped using SAMtools, GATK and other software. After obtaining high-quality marker data, subsequent bioinformatics analysis is performed.

[0033] The EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html) was used to perform GWAS analysis on the recorded traits of 1773 yellow-feathered chicken breeders in the population. The analysis model is as follows:

[0034] y=Xb+Za+Wp+e;

[0035] In the model, y represents the true value of the trait record, X represents the fixed effect association matrix, b represents the fixed effect vector, the fixed effect includes batch effect and three principal component effects, Z represents the additive genetic effect association matrix, u represents the individual additive genetic effect vector, e represents the residual, u~N(0, Gσ 2α ), e~N(0,Iσ 2 ε α), G represents the genome kinship matrix, I represents the identity matrix, σ 2 α , σ 2 ε α represents the additive genetic effect variance and residual variance, and m represents the SNP marker effect.

[0036] According to the results of association analysis, a SNP molecular marker associated with the feed conversion rate trait of yellow-feathered broiler chickens was found. The marker is located on the TMEM165 gene on chromosome 4 of yellow-feathered broiler chickens. Figure 1 As shown in the Harman diagram, the mutation site and upstream and downstream sequences of the SNP molecular genetic marker are as follows:

[0037] SEQ ID NO.1: 5'-GCCTGGAAATGAGTCGTTGGAGGTGGTTTGCAC TTTGAAGTTTCCATTGCGTTTGCAGCCTGAGATGCAAATTCTTGCTTTAGAAGCTGATGTGGAAATTCCCCTGGAACTGGCAGGGATGTGTGCCGGAACTGATAATGCATCCCGCTTCAGTAGGGTTGGAAAGGCTGTGCTGGGTCATTGCTTGTGTTCACATTGCTnGTGTGGTGATTTGCAGAG CCTTATCTTCACTGCCTAAGCATCCACTCACCACATTTAACATCCTCCAGCCACAAGAGCAAACAAAATAGCAGAGAACCATCAAAAGCTCCAGCTACTTTAGTCTCTGTTTCTCATTCTACTGTGCGAGGCAAACTCAAAATATTTAAAAGGAAGAGTACTATTTAAATTGTGTACATTTC-3';

[0038] n is a mutation site. When n at the 201st nucleotide of the above sequence is A or G, ie, n(A / G), the above sequence polymorphism is caused; 5'- and -3' respectively represent the 5' end and 3' end of the nucleotide sequence.

[0039] Example 2: Validation of SNP Molecular Markers

[0040] (1) The SNP molecular marker was verified in another yellow-feathered broiler group, with a total of 1,773 healthy individuals. All experimental chickens were mixed and fed until 56 days of age. After 56 days of age, they were transferred to individual cages for feeding. The experiment ended at 98 days of age. The daily feed intake, initial test weight and final weight of each chicken were recorded, and the feed conversion rate was calculated. 150 individuals with low feed conversion rate (FCR less than 3.0) and high feed conversion rate (FCR greater than 3.0) were selected, and blood was taken for DNA extraction. The average FCR of the 150 individuals with low feed conversion rate was 2.6±0.38, and the average FCR of the individuals with high feed conversion rate was 3.4±0.39.

[0041] (2) Using the DNA extracted in step (1) as a template, a forward primer (SEQ ID NO. 2: 5'-GTTGGAGGTGGTTTGCACTTTGA-3') and a reverse primer (SEQ ID NO. 3: 5'-TGCCTCGCACAGTAGAATGAGAA-3') were added to carry out a PCR reaction.

[0042] PCR amplification system: 2×Taq Master Mix 10μL, forward and reverse primers 1μL each, DNA template 1μL, ddH2O to 20μL.

[0043] PCR reaction conditions: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min.

[0044] (3) Sequencing and analyzing the PCR products of step (2) using the Sanger sequencing method. Record the corresponding genotype of each individual according to the sequencing peak graph of each sample (e.g. Figure 2 ), only one peak appeared at the corresponding site in the genotype AA sequencing map, indicating that the alleles were the same, both A; there were two peaks at the corresponding site in the genotype AG sequencing map, indicating that the alleles were different, one was A and the other was G. The genotype and allele of the SNP molecular marker and the feed conversion rate were analyzed by one-way analysis of variance using SPSS26.0, and the results are shown in Tables 1 and 2. In this SNP molecular marker, there were extremely significant differences in genotype frequency and allele frequency between the low feed conversion rate and high feed conversion rate groups (P < 0.01). In the low feed conversion rate, the frequency of allele A was higher than that of allele G, and the frequency of genotype AA was higher than that of genotype AG, indicating that the 201st AA genotype individual had a better feed conversion rate phenotype than the AG genotype individual. It further shows that the polymorphism of the screened molecular marker is significantly correlated with the feed conversion rate trait, and it is a SNP site associated with the feed conversion rate trait, which can be used for the breeding of low feed conversion rate traits in yellow-feathered broilers.

[0045] Table 1 Statistical table of the distribution differences of SNP molecular marker genotypes between low feed conversion rate and high feed conversion rate

[0046] chromosome Location genotype High FCR (%) Low FCR (%) Chi-square value (P) Chr4 64634301bp AA 44(29％) 113(75％) 15.654 AG 106(71％) 37(25％) <![CDATA[6.9×10 -3 ]]>

[0047] Table 2: Statistical table of the distribution differences of SNP molecular marker alleles between low feed conversion rate and high feed conversion rate

[0048] chromosome Location genotype High FCR (%) Low FCR (%) Chi-square value (P) Chr4 64634301bp A 194(64.7％) 263(87.6％) 9.327 G 106(35.3％) 37(12.4％) <![CDATA[9.5×10 -5 ]]>

[0049] Example 3: Assisted molecular breeding method for low yellow feather broiler feed conversion rate trait using SNP molecular marker alleles

[0050] The method of performing assisted molecular breeding using the above-mentioned kit for detecting SNP molecular markers comprises the following steps:

[0051] (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, and stored at -20°C for DNA extraction.

[0052] (2) Amplification was performed using the kit with the DNA extracted in step (1) as a template. The PCR amplification system was: 10 μL of 2×Taq Master Mix, 1 μL of each forward and reverse primer, 1 μL of DNA template, and ddH2O to 20 μL. The PCR reaction conditions were: 94°C pre-denaturation for 2 min; 94°C denaturation for 15 s, 56°C annealing for 10 s, 72°C extension for 15 s, 35 cycles; 72°C extension for 5 min.

[0053] (3) Sequence the PCR product obtained in step (2) using the Sanger sequencing method.

[0054] (4) According to the genotyping results, homozygous individuals with the SNP molecular marker chr4-64634301 genotype of AA are selected for breeding to reduce feed conversion rate and thus reduce feed costs; selecting individuals with this marker to join the core breeding population can achieve rapid homozygosity of the alleles related to this trait, which can provide technical support for accelerating the progress of genetic selection.

[0055] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A TMEM165 gene SNP molecular marker associated with feed conversion rate of yellow-feathered broiler chickens, characterized in that: The SNP molecular marker is located at the 64634301 base of the rs312546095 sequence of chicken chromosome 4, and the polymorphism is A / G.

2. The TMEM165 gene SNP molecular marker associated with feed conversion rate of yellow-feathered broiler chickens according to claim 1, characterized in that: The mutation site and upstream and downstream sequences of the SNP molecular marker are shown in SEQ ID NO.1, wherein n is an A>G mutation site, and when n is A, it is a yellow-feathered broiler with low feed conversion rate.

3. A primer for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The forward primer sequence of the primer is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.

3.

4. A kit for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: Comprising the primer described in claim 3.

5. Use of the SNP molecular marker according to claim 1 or 2, the primer according to claim 3, or the kit according to claim 4 in breeding yellow-feathered broilers with low feed conversion rate.

6. A method for breeding yellow-feathered broilers with low feed conversion rate, characterized in that: The SNP molecular markers of the individual to be tested are amplified and sequenced by PCR technology, and homozygous individuals with the SNP molecular marker genotype of AA are screened.

7. The method for breeding yellow-feathered broilers with low feed conversion rate according to claim 6, characterized in that: The primers described in claim 3 or the kit described in claim 4 are used to perform PCR amplification of SNP molecular markers.

8. The method for breeding yellow-feathered broilers with low feed conversion rate according to claim 6, characterized in that: The PCR amplification system was as follows: 2×Taq Master Mix 10 μL, forward and reverse primers 1 μL each, DNA template 1 μL, and ddH2O to 20 μL.

9. The method for breeding yellow-feathered broilers with low feed conversion rate according to claim 6, characterized in that The PCR reaction conditions were: 94°C pre-denaturation for 2 min; 94°C denaturation for 15 s, 56°C annealing for 10 s, Extension at 72°C for 15 s, 35 cycles; extension at 72°C for 5 min.

Images