KASP marker for rapidly identifying powdery mildew resistance in aegilops tauschii and application of KASP marker

Abstract

The invention relates to the technical field of wheat genetics and molecular breeding thereof, and discloses a KASP marker for rapidly identifying powdery mildew resistance in aegilops tauschii and application of the KASP marker. The molecular marker SDAU-kaspPm2013 closely linked with the powdery mildew resistance gene PmKu-2013 is designed and developed by means of genetic positioning of the powdery mildew resistance gene PmKu-2013 and in combination with a reference sequence of a wheat D genome, the molecular marker can be used for wheat powdery mildew resistance breeding and early molecular marker-assisted selection of powdery mildew resistance characters, and the breeding efficiency can be improved.

Description

Technical Field

[0001] The invention relates to the technical field of wheat genetics and molecular breeding thereof, and in particular to a KASP marker for rapidly identifying powdery mildew resistance in Aegilops tauschii and an application thereof. Background Art

[0002] Powdery mildew of wheat is caused by Ceratocystis graminearum ( Blumeria graminis f. sp .) is a destructive disease caused by the fungus Blumeria graminis of the Ascomycetes, which seriously threatens wheat yield and food safety. In recent years, with climate change, the disease has become increasingly serious in major wheat-growing areas in my country, such as the southwest, northwest, north China, and northeast China. Therefore, prevention and control of wheat powdery mildew is of great significance to improving wheat quality and increasing wheat yield. Identification of resistance genes is the most environmentally friendly and effective strategy for developing disease-resistant varieties and controlling the disease.

[0003] So far, more than 110 Pm genes have been identified in wheat and its closely related wild germplasms, and 18 have been cloned. Pm2b , Pm4 , Pm50 etc. However, linked harmful traits and hybrid disadvantages will reduce yield and quality, such as Pm16 Resulting in 15% yield loss. In addition, existing Pm genes such as Pm1 to Pm5 and Pm8 etc. are gradually losing Bgt Isolates with resistance, even the most potent genes Pm21 , but also faces strong selection pressure and the risk of losing resistance. Therefore, finding new powdery mildew resistance genes that can balance broad-spectrum resistance and agronomic traits is the key to improving wheat high yield and multi-resistance.

[0004] Aegilops truncatula ( Aegilopstus , 2n=14, DD), is the donor of the allohexaploid wheat D genome, which contains rich resistance genes and can be easily transferred to wheat for utilization.

[0005] As a simple and low-cost technology, molecular markers also play a vital role in the molecular identification of distant hybrid materials between wheat and its closely related species. If we want to achieve the goal of efficiently aggregating multiple disease resistance genes and optimizing agronomic traits at the same time, we can directly aggregate multiple genes with complementary functions through molecular-assisted selection to enhance the broad-spectrum and durable resistance of wheat without sacrificing other agronomic traits. Summary of the invention

[0006] In view of the defects of the prior art, this patent provides a KASP marker for rapid identification of powdery mildew resistance in Aegilops truncatula and its application.

[0007] After identification of powdery mildew resistance, Aegilops truncatula KU-2013 was found to be a source of persistent immunity to wheat powdery mildew. Identification and genetic analysis of wheat powdery mildew resistance showed that KU-2013 carries a single dominant disease resistance gene on chromosome 2D, which is temporarily named PmKu -2013.

[0008] The present invention provides a molecular marker system and application strategy for wheat powdery mildew resistance, in order to fill the gap in the current breeding technology in the use of efficient molecular markers to assist in the selection of wheat powdery mildew resistant varieties. To achieve the above purpose, the present invention provides the following technical solutions: The inventors have preliminarily located the powdery mildew resistance gene of DHKU-2013 (artificially synthesized hexaploid wheat hybridized by Aegilops truncatula KU-2013 and Durum wheat Langdon) on its 2D chromosome 5.9M ( Picture 1 ), a group of polymorphic KASP markers for resistance and susceptibility between parents were designed within the positioning interval. Using this marker, genotype analysis was performed on 40 randomly selected varieties commonly used in wheat breeding from various parts of the country and durum wheat Langdon. The analysis results showed that the genotypes of these 40 wheat varieties and durum wheat Langdon were consistent with the genotype of the susceptible control DH2147 (artificially synthesized hexaploid wheat hybridized by Aegilops 2147 and durum wheat Langdon). This finding shows that the designed KASP marker is PmKu-2013 In the process of gene transfer to wheat breeding, it has potential molecular assisted selection effect. The KASP marker is named SDAU-kaspPm2013 , the nucleotide sequences of the primer sets are: FAM (SEQ ID NO: 1): GAAGGTGACCAAGTTCATGCTCGAAGCTGGTGAAAAATGATCGCC (susceptibility site binding); HEX (SEQ ID NO: 2): GAAGGTCGGAGTCAACGGATTCCGAAGCTGGTGAAAAATGATCGCT (disease resistance site binding); COM (SEQ ID NO:3): CACCCCAGTCTCAGTTTCTGCTAA.

[0009] Utilization of Powdery Mildew Resistance Genes from Aegilops truncatula PmKu-2013 Linked markers SDAU-kaspPm2013 , and their usage methods are as follows: (1) Using wheat or Aegilops tauschii DNA as PCR template and SDAU-kaspPm2013 as primer, PCR amplification was performed in a reaction system of about 5 μl. The above reaction system specifically includes: 1 μl of 80 ng / μl DNA, 2×KASP mix 2.5 μl, KASP Primer mix 0.35 μl, and ddH2O to make up to 5 μl. (2) The PCR amplification program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing and extension at 65°C for 1 min (0.8°C reduction per cycle), 10 cycles; denaturation at 94°C for 20 s, annealing at 57°C for 1 min, 28 cycles; (3) After the PCR is completed, the cells are placed on a 384-well multi-fluorescence channel quantitative PCR instrument for fluorescence reading and detection of PCR typing results; (4) Analysis and identification: if the typing is concentrated on the Y-axis, it belongs to the disease-resistant genotype; if the typing is concentrated on the X-axis, it belongs to the disease-susceptible genotype; the typing at the origin represents the negative control.

[0010] Compared with the existing technology, this study has the following advantages: The invention obtains a linked KASP marker of PmKu-2013: SDAU-kaspPm2013; SDAU-kaspPm2013 belongs to a KASP marker, has the characteristics of high throughput, simple operation and the like, can be used for high throughput screening of a large-scale separation population, and fine positioning of PmKu2013; 40 randomly selected wheat varieties detected by SDAU-kaspPm2013 are all susceptible genotypes, and therefore can be used as a molecular marker for auxiliary selection of PmKu2013 resistance in wheat breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Picture 1 Powdery mildew resistance gene PmKu-2013 The preliminary genetic linkage map and 5DS physical location map of AL8 / 78 will PmKu-2013 It is located between the molecular markers sdau4 and sdau5, and the position of chromosome 5DS in the reference genome AL8 / 78 is between 45.49Mb and 51.39Mb; Picture 2 Indicated in PmKu-2013 The base sequences before and after a SNP site that is closely linked to powdery mildew resistance were found in the genetic mapping interval. The highlighted bases are differential SNPs, that is, the bases at this site in 8 susceptible germplasms are C, and the bases at this site in 2 resistant germplasms are T. Picture 3 express PmKu-2013 Testing of the initial positioning population parents DH2147 and DHKU-2013 SDAU-kaspPm2013Typing results, black circles represent the control with water as the template, red, blue and green circles represent the genotypes of susceptible, resistant and heterozygous plants, respectively; Picture 4 Indicates SDAU-kaspPm2013 Scanning the typing results of 40 common wheat varieties, DH2147 and DHKU-2013. The black circles represent the control with the template being water, and the red, blue and pink circles represent the genotypes of the disease-resistant plant DH2147, the disease-susceptible plant DHKU-2013 and 40 common wheat and Langdon, respectively. DETAILED DESCRIPTION

[0012] Example 1 Construction and genetic positioning of mapping population The disease-resistant synthetic hexaploid wheat DHKu-2013 was crossed with the disease-susceptible synthetic hexaploid wheat DH2147 to obtain F1, and 167 F2 plants were obtained through self-pollination. Through the identification of its disease resistance and chi-square test, it was speculated that the gene was a single dominant disease resistance gene and was temporarily named PmKu2013 Specific markers were developed on the long and short arms of each chromosome in the D genome, and the pool of F2 susceptible plants was scanned and screened to find that the markers on 5DS were PmKu2013 The results showed that the gene was located on chromosome 5DS of DHKU-2013. The 167 F2 strains of DHKU-2013 and DH2147 were genotyped by using the newly developed polymorphic markers, and the powdery mildew resistance phenotype of the F2 population was combined with the genotype of the F2 population. PmKu-2013 The results showed that PmKu-2013 It was located at a genetic distance of 1.9 cM. PmKu-2013 Mapped to chromosome 5D of AL8 / 78 within the physical interval of 45.49-51.39 Mb, 5.90 Mb apart ( Picture 1 ).

[0013] Example 2 PmKu2013 Development of linked markers Through PmKu-2013 The initial location of the gene successfully locked it in a 5.9 Mb physical interval. Subsequently, the resequencing data of 10 Aegilops truncatula germplasms were compared with the genome database of the reference genome AL8 / 78, and a SNP site closely linked to the disease resistance phenotype was found in the locked interval. Specifically, the SNP site showed T type in 2 disease-resistant materials, and C type in 8 susceptible materials. Picture 2 The sequence information before and after the SNP site is displayed. Based on this discovery, a KASP marker was developed for this SNP site, named SDAU-kaspPm2013. The specific resistance and sensitivity typing test results of the marker are as follows Picture 3 shown.

[0014] Example 3 SDAU-kaspPm2013 Application of molecular assisted breeding in wheat resistance to powdery mildew pass SDAU-kaspPm2013 Genotyping analysis was performed on 40 randomly selected wheat varieties commonly used in wheat breeding from various parts of China and durum wheat Langdon, that is, genotyping of resistant and susceptible parents and common wheat varieties. The results showed that the genotypes of these 40 wheat varieties and durum wheat Langdon were consistent with the genotype of the susceptible control DH2147 ( Picture 4 This finding suggests that the designed KASP marker PmKu-2013 In the process of gene transfer to wheat breeding, it has potential molecular assisted selection, which can be used as PmKu-2013 Transfer of use of molecular breeding-assisted markers to wheat.

[0015] The present invention provides a molecular marker and primer set for wheat powdery mildew resistance, which can effectively identify and efficiently utilize resistance genes. PmKu-2013 The detection process of the offspring material transferred to wheat is convenient and fast, and is not affected by external environmental factors. It can accelerate the cultivation of disease-resistant varieties and reduce breeding costs, shorten the breeding cycle of wheat powdery mildew-resistant varieties, and improve the utilization efficiency of closely related wild germplasm materials.

Claims

1. A KASP marker for rapid identification of powdery mildew resistance in Aegilops truncatula, wherein the marker is SDAU-kaspPm2013 , Features: For amplification of the marker SDAU-kaspPm2013 The primer combinations and their corresponding primer sequences are as follows: The susceptible site binding primer FAM shown in SEQ ID NO:1: GAAGGTGACCAAGTTCATGCTCGAAGCTGGTGAAAAAATGATCGCC; The disease resistance site binding primer HEX shown in SEQ ID NO:2: GAAGGTCGGAGTCAACGGATTCCGAAGCTGGTGAAAAAATGATCGCT; Primer COM shown in SEQ ID NO:3: CACCCCAGTCTCAGTTTCTGCTAA.

2. The marker according to claim 1 is used for fine positioning of genes and cloning PmKu-2013 application.

3. The marker according to claim 1 is used to identify the powdery mildew resistance gene in Aegilops truncatula germplasm PmKu-2013 application.

4. The marker according to claim 1, wherein the powdery mildew resistance gene of Aegilops truncatula is selected PmKu-2013 Transferred to the application in molecular assisted breeding of wheat.

Images