KASP molecular marker related to grain length of japonica rice and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker related to grain length of japonica rice and application of the KASP molecular marker, and belongs to the technical field of rice genetic engineering. The number of the KASP molecular marker is one, the KASP molecular marker is KASP22840530, the polymorphism of the KASP molecular marker is G or A. The developed molecular marker can rapidly and accurately detect the long-grain genotype of japonica rice GL6.1, and the grain length of the genotype A / A is remarkably larger than that of the genotype G / G, so that the KASP molecular marker is suitable for molecular breeding of a new long-grain type japonica rice variety.

Description

Technical Field

[0001] The invention belongs to the technical field of rice genetic engineering, and particularly relates to a KASP molecular marker related to japonica rice grain length and an application thereof. Background Art

[0002] Indica and japonica are two subspecies of cultivated rice in Asia. The appearance and taste quality of the two are quite different. Generally, in terms of appearance, the length and width of indica rice are larger than those of japonica rice, while in terms of quality, the cooking and taste quality of japonica rice are better than those of indica rice. With the improvement of people's living standards, the market demand for high-quality rice continues to increase. In addition, with the influence of international brand rice, long-grain high-quality rice such as Thai fragrant rice, Basmati, KDML105, etc. are more popular among people. Therefore, the cultivation of long-grain japonica rice has become a trend in the selection and breeding of new japonica rice varieties.

[0003] Great progress has been made in the genetic and regulatory mechanisms of rice grain shape. Studies have shown that grain length, grain width and grain length-width ratio are regulated by multiple genes, and inheritance has an additive effect. At present, the cloned rice grain length genes or QTLs include OsLG3, GS3, PGL1, PGL2, AGP, qSW5, GL6, GL7, GLW7, GS2, TGW6, etc. GS3 is a major QTL regulating grain length, in which the OSR domain can negatively regulate grain length, TNFR / NGFR can positively regulate grain length, GS3 function loss leads to long grain phenotype, while overexpression leads to short grain phenotype. PGL1, PGL2, OsLG3, GL6, GL7 are positive regulatory factors of grain length, which increase rice grain length by increasing the number of cells in the husk, promoting the proliferation of grain cells, and increasing the division of longitudinal cells in the grain. The genes that have been cloned to significantly affect grain width include GW2, TGW2, GW5 / GSE5, GS5, GW8, GS6, etc. GW2 encodes an E3 ubiquitin ligase in the cytoplasm, which can negatively regulate grain width. TGW2 encodes the cell number regulator OsCNR1, which can negatively regulate rice grain width. GW5 regulates grain width by mediating brassinosteroid (BR) signal transduction. GSE5 encodes a calmodulin-binding protein, and the deletion of the promoter region is the genetic basis for the variation in grain width of rice varieties. GS5 encodes a serine carboxypeptidase, which can positively regulate rice grain width. GW8 increases grain width by inhibiting the expression of GW7.

[0004] Molecular marker-assisted selection is an important means to improve breeding efficiency. Therefore, the development and application of molecular markers of long-grain functional genes plays an important role in the breeding of new long-grain japonica rice varieties. Summary of the invention

[0005] The invention provides a KASP molecular marker related to japonica rice grain length. The physical position of the KASP molecular marker is determined based on the MSU7.0 version of the whole genome sequence of Nipponbare. The KASP molecular marker is located at 22840530 bp on chromosome 6, and the polymorphism is A and G.

[0006] The present invention also provides an application of a reagent for detecting the KASP molecular marker in identifying the grain length of japonica rice.

[0007] The present invention also provides an application of a primer set for detecting the above-mentioned KASP molecular marker in identifying the grain length of japonica rice, wherein the primer set comprises two specific primers and one universal primer, wherein the nucleotide sequences of the two specific primers are respectively shown in SEQ ID NO.1-2, and the nucleotide sequence of the universal primer is shown in SEQ ID NO.3. Specifically as follows: Primer_AlleleFAM: GAAGGTGACCAAGTTCATGCTGTTCACAACTAGGTACGGGAG (SEQ ID NO.1);

[0008] Primer_AlleleHEX:GAAGGTCGGAGTCAACGGATTGTTCACAACTAGGTACGGGAA(SEQ IDNO.2);

[0009] Primer_Common: CGTCGAAGAAACAAGTACGAGAAGGC (SEQ ID NO. 3).

[0010] Furthermore, the two specific primers are respectively labeled with different fluorescent markers.

[0011] The present invention also provides a method for identifying the length of japonica rice grains, the method comprising the following steps:

[0012] Competitive allele-specific PCR was performed using the genomic DNA of the rice sample to be tested as a template using the primer set SEQ ID NO.1-3 to determine the genotype corresponding to the above-mentioned KASP molecular marker. The grain length of japonica rice with the genotype A / A was greater than that of G / G.

[0013] Furthermore, the method also includes a step of extracting genomic DNA from the rice sample to be tested.

[0014] The present invention also provides application of the method in japonica rice grain length breeding.

[0015] The present invention also provides an application of a product in identifying the grain length of japonica rice, wherein the product comprises a primer set having a nucleotide sequence as shown in SEQ ID NO.1-3.

[0016] Furthermore, the product is a kit.

[0017] The present invention also provides an application of a gene chip in identifying the grain length of japonica rice. The gene chip comprises a primer set whose nucleotide sequence is shown as SEQ ID NO.1-3.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The invention provides a long-grain genotype of a KASP molecular marker, KASP_22840530. The KASP_22840530 genotype A / A is a long-grain dominant genotype and can be used in the molecular breeding of new long-grain japonica rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the molecular marker typing diagram of KASP_22840530 in Example 1.

[0021] Figure 2 The following are the statistical analysis results of grain length of 132 japonica rice genotypes in Example 1 over two years.

[0022] Figure 3 This is the verification result of the KASP_22840530 dominant genotype in Example 1 in the Rice SNP-Seek Database (snp-seek.irri.org / index.zul).

[0023] Figure 4 This is the verification result of the KASP_22840530 dominant genotype in Example 1 in the RiceVarMap v2.0 database (RiceVarMap2 (ncpgr.cn)). DETAILED DESCRIPTION

[0024] Example 1

[0025] 1. DNA Extraction

[0026] 132 rice leaves were taken as test samples and stored in a -80°C ultra-low temperature freezer. (2) The frozen samples were transferred to 2 ml centrifuge tubes, small steel balls were added, and after freezing with liquid nitrogen, the leaves were ground into powder using a tissue grinder. (3) Add CTAB extraction solution, incubate at 65°C for 2 hours, then centrifuge at 12,000×g for 10 minutes at 4°C; (4) Take the supernatant and add an equal volume of chloroform, mix thoroughly, and centrifuge at 12,000×g for 10 minutes at 4°C; (5) Take the supernatant and transfer it to a new centrifuge tube, add 2 times the volume of anhydrous ethanol, mix, place at -20°C for 30 minutes, centrifuge at 12,000×g for 10 minutes at 4°C, and discard the supernatant; (6) Add 1 ml of pre-cooled 70% ethanol, centrifuge at 12,000×g for 10 minutes at 4°C, and discard the supernatant (repeat this step twice); (6) Dry at room temperature until the precipitate is colorless and transparent, add sterile ddH2O to dissolve the DNA precipitate, and freeze at -20°C for later use.

[0027] 2. DNA Dilution

[0028] The DNA concentration and quality of the samples were measured using the BioDrop uLite nucleic acid micro-analyzer, and all samples were diluted to a suitable concentration for the instrument (about 5-10 ng / μl) according to the test results.

[0029] 3. Primer Design

[0030] GL6.1 (LOC_Os06g38550) is located in the interval 22836854–22839540 on chromosome 6. Then, the KASP site in the interval 150 kb upstream and downstream of this interval was mined, and the online primer design website BatchPrimer3 was used.

[0031] 4. KASP (competitive allele-specific PCR) typing test

[0032] Configure the reaction system as follows:

[0033] Table 1

[0034] Volume (μl) DNA template 0.8 2xKASPMastermix+Assay 0.8 Total volume 1.6

[0035] The program was compiled using IntelliQube's SNP gene detection platform, and the 384 array tape, DNA sample plate, and KASP genotyping mixture were placed into the machine in sequence. The machine was operated to execute the program, and the DNA sample dilution solution and KASP genotyping mixture were automatically dispensed into the 384-well array tape and sealed. The PCR reaction was performed in a water bath, and the specific procedure was as follows:

[0036] Table 2

[0037]

[0038]

[0039] Finally, pre-denaturation was performed at 94°C for 15 min; in the first amplification reaction, denaturation was performed at 94°C for 20 s, annealing and extension were performed at 61°C-55°C for 60 s, and 10 cycles were performed, with the annealing and extension temperature decreasing by 0.6°C in each cycle; in the second amplification reaction, denaturation was performed at 94°C for 20 s, annealing and extension were performed at 57°C for 60 s, and 3 cycles were performed.

[0040] 5. KASP molecular marker verification

[0041] The grain length of 132 japonica rice accessions was measured for 2 years. The results showed that the grain length of KASP_22840530 genotype A / A was significantly higher than that of genotype G / G. In addition, after screening, the grain length of KASP_22840530 marker of 104 japonica rice accessions in the Rice SNP-Seek Database (Table 4) and 138 japonica rice accessions in the RiceVarMap v2.0 database (Table 5) was statistically analyzed. The results verified that the grain length of genotype A / A was significantly higher than that of genotype G / G.

[0042] Table 3

[0043]

[0044]

[0045]

[0046]

[0047] Table 4

[0048]

[0049]

[0050]

[0051] Table 5

[0052]

[0053]

[0054]

[0055]

[0056] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A KASP molecular marker associated with japonica rice grain length, characterized in that: The physical position of the KASP molecular marker was determined based on the MSU7.0 version of the whole genome sequence of Nipponbare. The KASP molecular marker was located at 22840530 bp on chromosome 6, and the polymorphisms were A and G.

2. Use of a reagent for detecting the KASP molecular marker according to claim 1 in identifying the grain length of japonica rice.

3. Use of a primer set for detecting the KASP molecular marker described in claim 1 in identifying the grain length of japonica rice, characterized in that: The primer set includes 2 specific primers and 1 universal primer, wherein the nucleotide sequences of the 2 specific primers are respectively shown as SEQ ID NO.1-2, and the nucleotide sequence of the 1 universal primer is shown as SEQ ID NO.

3.

4. The use according to claim 3, characterized in that: The two specific primers are respectively labeled with different fluorescent markers.

5. A method for identifying the length of japonica rice grains, characterized in that: The method comprises the following steps: The genomic DNA of the japonica rice sample to be tested is used as a template, and the primer set SEQ ID NO.1-3 is used to perform competitive allele-specific PCR, thereby determining the genotype corresponding to the KASP molecular marker in claim 1, and the grain length of the japonica rice with the genotype A / A is greater than that of G / G.

6. The method according to claim 5, characterized in that The method also includes a step of extracting genomic DNA of the rice sample to be tested.

7. Use of the method according to claim 5 or 6 in the breeding of japonica rice grain length.

8. Application of a product in identifying the length of japonica rice grains, characterized in that: The product includes a primer set with nucleotide sequences as shown in SEQ ID NO. 1-3.

9. The use according to claim 8, characterized in that: The product is a test kit.

10. An application of a gene chip in identifying japonica rice grain length, characterized in that: The gene chip includes a primer set with nucleotide sequences as shown in SEQ ID NO.1-3.

Images