Core SNP (Single Nucleotide Polymorphism) marker for tea tree variety identification

Abstract

The invention provides a core SNP (Single Nucleotide Polymorphism) marker for tea tree variety identification. Based on a simplified genome sequencing technology, a KASP system is adopted to carry out genetic typing on 48 tea tree varieties, the SNP fingerprint spectrum of each tea tree variety is constructed, and finally it is determined that the 48 tea tree varieties can be efficiently and accurately distinguished and identified only through 9 specific SNP markers. The 9 SNP markers provided by the invention not only enrich molecular markers of tea tree varieties, but also can be applied to genetic typing, identification, auxiliary identification and similarity detection of the tea tree varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and more specifically, relates to a core SNP marker for tea variety identification. Background Art

[0002] Tea tree variety resources are the foundation of tea tree breeding. At present, the tea tree varieties that have been collected and preserved are rich and diverse, but in the process of large-scale introduction and frequent exchange, there are occasional phenomena of homonymous and homonymous varieties, which leads to confusion of tea tree varieties and is not conducive to the smooth progress of tea tree breeding. Therefore, scientifically and accurately distinguishing and identifying tea tree varieties is crucial for tea tree breeding.

[0003] At present, the identification of tea varieties is no longer based solely on the morphological characteristics of the varieties, but more on the construction of DNA molecular fingerprints of tea varieties. In DNA molecular fingerprint technology, SSR (simple sequence repeat) and SNP (single nucleotide polymorphism) molecular markers have been identified as the two preferred marker methods by the International Union for the Protection of New Varieties of Plant Rights (UPOV) BMT Molecular Testing Guidelines and the domestic "General Principles of DNA Fingerprint Methods for Plant Variety Identification" (NY / T2594-2016). However, compared with the disadvantages of SSR markers, such as limited number and detection throughput, and time-consuming and labor-intensive data reading, SNP molecular markers have the advantages of large number, wide genome distribution, high detection throughput, high stability and heritability, and simple identification. They are more suitable for rapid and high-throughput genotyping analysis, so they are more widely used.

[0004] However, the existing known SNP molecular marker sites developed using tea tree genome information are still very limited, and not many tea tree varieties can be identified. For example, Zhou Lin et al. used EST-SNP genotyping technology to obtain 60 SNP markers, but could only identify 40 tea tree varieties (Zhou Lin. Development and Application of EST-SNP Molecular Marker Technology in Tea and Coffee [D]. Nanjing Agricultural University, 2017.), which cannot meet the identification needs of other tea tree varieties. Summary of the invention

[0005] In view of the deficiencies of the prior art, the present invention aims to provide core SNP markers for tea variety identification, which can efficiently and accurately complete the differentiation and identification of 48 tea varieties through only 9 SNP markers.

[0006] The first object of the present invention is to provide core SNP markers for tea plant variety identification.

[0007] The second object of the present invention is to provide the application of the above core SNP markers in constructing SNP fingerprints.

[0008] The third object of the present invention is to provide a substance for detecting the above-mentioned core SNP markers.

[0009] The fourth object of the present invention is to provide the use of the above-mentioned substance in genotyping, identification, auxiliary identification and / or similarity detection of tea varieties.

[0010] The fifth object of the present invention is to provide a set of PCR reagents for genotyping, identification, auxiliary identification and / or similarity detection of tea varieties.

[0011] The sixth object of the present invention is to provide the use of the above-mentioned set of PCR reagents in genotyping, identification, auxiliary identification and / or similarity detection of tea varieties.

[0012] The seventh object of the present invention is to provide a kit containing the above-mentioned set of PCR reagents.

[0013] The eighth object of the present invention is to provide the use of the above-mentioned kit in genotyping, identification, auxiliary identification and / or similarity detection of tea varieties.

[0014] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0015] The present invention first provides a core SNP marker for tea variety identification, comprising 9 SNP markers, wherein the 9 SNP markers are SNP markers 1 to 9;

[0016] in:

[0017] The SNP marker 1 is the 10499834th base on chromosome 12 of the tea plant genome, which is C or T;

[0018] The SNP marker 2 is the 112201269th base on chromosome 1 of the tea plant genome, which is A or T;

[0019] The SNP marker 3 is the 15319304th base on chromosome 1 of the tea plant genome, which is A or T;

[0020] The SNP marker 4 is the 108293870th base on chromosome 15 of the tea plant genome, which is C or T;

[0021] The SNP marker 5 is the 82703rd base on the tea plant genome contig 3, which is A or G;

[0022] The SNP marker 6 is the 211875523rd base on chromosome 1 of the tea plant genome, which is C or T;

[0023] The SNP marker 7 is the 199948884th base on chromosome 2 of the tea plant genome, which is C or T;

[0024] The SNP marker 8 is the 171140457th base on chromosome 6 of the tea plant genome, which is A or G;

[0025] The SNP marker 9 is the 124330th base on the 1191st contig of the tea plant genome, which is C or T;

[0026] The tea varieties are: CK1, CK2, HH03, RN046, Z09, RN005, B02, RN109, Z01, Z03, HL01, CG22, RN056, HL03, RN131, RN009, Z04, A02, HL04, RN150, B01, RN113, RN107, A01, HL02, Z02, XC1, XC1 Tea varieties: 31-1, XC130-1, XC32-right 1, XC12-right 2, XC132-1, XC52-1, XC69-1, XC20-1, XC12-1, XC133-1, XC123-1, DYL3, DYL4, DYL1, DYL7, DYL2, DYL31, DYL15, YJ45-6567, SYS14, and SYS22.

[0027] The present invention is based on simplified genome sequencing technology, and uses the KASP (competitive allele-specific PCR, Kompetitive Allele-Specific PCR) system to perform genotyping on 48 tea tree varieties, construct the SNP fingerprint map of each tea tree variety, and finally determine that only 9 specific SNP markers can be used to efficiently and accurately complete the differentiation and identification of 48 tea tree varieties. These 9 SNP markers of the present invention not only enrich the molecular markers of tea tree varieties, but also can be applied to the genotyping, identification, auxiliary identification and similarity detection of tea tree varieties. Therefore, the application of the above-mentioned core SNP markers in the construction of SNP fingerprint maps, the substances for detecting the above-mentioned core SNP markers, and the application of the above-mentioned substances in genotyping, identification, auxiliary identification and / or similarity detection of tea tree varieties should all be within the scope of protection of the present invention.

[0028] Preferably, the substance comprises one or more of primers 1 to 27, and the nucleotide sequences of the primers 1 to 27 are shown in SEQ ID NO: 1 to SEQ ID NO: 27.

[0029] Preferably, the substance comprises one or more of primer combinations 1 to 9, wherein the primer combination 1 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO:1 to SEQ ID NO:3; the primer combination 2 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO:4 to SEQ ID NO:6; the primer combination 3 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO:7 to SEQ ID NO:9; the primer combination 4 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO:10 to SEQ ID NO:12; the primer combination 5 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO:13 to SEQ ID NO:15; the primer combination 6 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO:16 to SEQ ID NO:18; the primer combination 7 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO:19 to SEQ ID NO:21; the primer combination 8 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO:22 to SEQ ID NO:24; the primer combination 9 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO:25 to SEQ ID NO: Primer combination shown in NO:27.

[0030] Based on this, the present invention also provides a set of PCR reagents for genotyping, identification, auxiliary identification and / or similarity detection of tea varieties, the use of the above-mentioned set of PCR reagents in genotyping, identification, auxiliary identification and / or similarity detection of tea varieties, a kit containing the above-mentioned set of PCR reagents, and the use of the above-mentioned kit in genotyping, identification, auxiliary identification and / or similarity detection of tea varieties. Wherein, the set of PCR reagents comprises one or more of primers 1 to 27, and the nucleotide sequences of the primers 1 to 27 are shown in SEQ ID NO: 1 to SEQ ID NO: 27.

[0031] The present invention has the following beneficial effects:

[0032] The present invention is based on simplified genome sequencing technology, uses the KASP system to perform genotyping on 48 tea tree varieties, constructs the SNP fingerprint map of each tea tree variety, and finally determines that only 9 specific SNP markers can be used to efficiently and accurately complete the identification of 48 tea tree varieties. These 9 SNP markers of the present invention not only enrich the molecular markers of tea tree varieties, but also can be applied to genotyping, identification, auxiliary identification and similarity detection of tea tree varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Results of SNP marker identification efficiency analysis.

[0034] Figure 2 It is the SNP fingerprint of each test material. DETAILED DESCRIPTION

[0035] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0036] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0037] One bud and two leaves of 48 tea tree materials without diseases and insect pests were used as test materials, which were quickly frozen in liquid nitrogen and stored in a -80℃ ultra-low temperature refrigerator for later use. The detailed information of each tea tree material is shown in Table 1, among which 2 bred varieties and 46 excellent strains (lines) were planted in the tea germplasm resource gardens of Rongshui County and Sanjiang County of Liuzhou City, and the seeds were stored in the Liuzhou Forestry Science Research Institute.

[0038] Table 1

[0039]

[0040]

[0041] Example 1 DNA extraction and genomic library construction

[0042] (1) The genomic DNA of each test material was extracted using the Plant Genomic DNA Kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the purity and concentration of the DNA were measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA).

[0043] (2) Take 500 ng of genomic DNA from each test material, add 0.6 U EcoRI (NEB), T4 DNA ligase (NEB), ATP (NEB) and EcoRI adapter (containing the index sequence for distinguishing samples), react at 37°C for 3 h, and then anneal at 65°C for 1 h.

[0044] (3) Add restriction endonuclease NlaIII (NEB) and NlaIII linker, react at 37°C for 3 h, and then place in a 65°C PCR instrument for 30 min to inactivate the endonuclease.

[0045] (4) Fragment selection was performed by agarose gel electrophoresis, and the 400-600 bp fragment was selected to recover the enzyme digestion product.

[0046] (5) DNA quantification of the recovered products was performed using Qubit 3.0 (Life Technology), and the recovered products of 48 test materials were mixed in equal amounts.

[0047] (6) The mixed product was subjected to DNA library construction using the Illumina TruSeq kit, and then sequenced using the Illumina Novasek 6000 sequencer. The sequencing mode was paired-end sequencing, and the sequencing read length was 150 bp.

[0048] Example 2 Identification of SNPs

[0049] (1) Use bwa mem software to align the reads of each test material obtained by sequencing to the reference genome to obtain high-quality clean reads.

[0050] (2) Based on the positioning results of clean reads in the reference genome, single nucleotide polymorphism (SNP) was detected using GATK (version: 4.1.4.1) to obtain the original SNP site.

[0051] Example 3 SNP screening

[0052] (1) The original SNP loci were screened to obtain 2,072,112 high-quality SNPs. The screening conditions were as follows: ① average sequencing depth ≥ 5X; ② MAF (Minor allele frequency) ≥ 0.05; ③ sample SNP information completeness ≥ 0.70; ④ SNP quality value Q ≥ 30; ⑤ the number of alleles was 2.

[0053] (2) The 2,072,112 high-quality SNPs were further screened, and 208 SNPs were finally obtained. The screening conditions were as follows: ① SNPs with a sequence conservation of more than 50 bp before and after the DNA chain; ② SNPs with an average depth of 5X or above, a quality value greater than 30, a minimum integrity greater than 0.9, a minimum allele frequency greater than 0.05, and belonging to double alleles; ③ 100 bp sequence upstream and downstream of the SNP marker, and then using blast software (version: 2.10.1+) to align the sequence to the reference genome, and remove markers with positions ≥ 2 in the alignment; ④ markers with a polymorphic information content (PIC) greater than 0.35.

[0054] The calculation formula of PIC is: Among them, P i and P j is the frequency of occurrence of the two alleles of the SNP in all the test materials, and l is the number of test materials (i.e. 48).

[0055] Example 4 KASP primer design and SNP marker selection

[0056] Primer design software primer3 (version: 2.4.0) was used to design primers for the 208 SNP markers filtered, and the distribution statistics of the SNP markers with successful primer design were performed to screen out 55 SNP markers located in the exon region. These SNP markers were typed and verified, and after genotyping 48 test materials using the KASP system, the identification efficiency of these SNP markers was analyzed using a Perl language program. Among them, the reaction system of KASP is as follows:

[0057] (1) Primers corresponding to 55 SNP markers located in the exon region were diluted to 10 μM with TE buffer (pH 8.0) and then mixed in a volume ratio of "upstream typing primer 1: upstream typing primer 2: downstream universal primer = 1:1:3".

[0058] (2) The DNA sample was diluted 5-fold and then subjected to PCR reaction (PCR reaction system: the total amplification reaction volume in the 96-well plate was 5 μL, consisting of 2.5 μL V4 2×KASP master mix, 1.25 μL KASP primer mix, and 1.25 μL DNA sample).

[0059] (3) The PCR reaction plate was sealed, shaken, and centrifuged to ensure that the reaction system was evenly mixed, and then the PCR reaction was performed (the PCR reaction conditions are shown in Table 2).

[0060] (4) If the typing results are not ideal, increase the PCR reaction optimization (PCR reaction conditions are shown in Table 3).

[0061] Table 2

[0062]

[0063] Table 3

[0064]

[0065] The results of SNP marker identification efficiency analysis are shown in Figure 1 As shown, it can be seen that all samples can be completely distinguished using only 9 SNP markers, and the identification efficiency is 100%, indicating that these 9 SNP markers can be used for genotyping, identification, auxiliary identification and similarity detection of tea varieties.

[0066] The location information of these 9 SNP markers on the tea plant genome, the differential bases and the nucleotide sequence numbers of their corresponding primers are shown in Table 4.

[0067] Table 4

[0068]

[0069]

[0070] Among them, the nucleotide sequences of each primer are corresponding as follows:

[0071] SEQ ID NO:1: GAAGGTGACCAAGTTCATGCTcatacaagtcgtgatgtccataatctaaT. SEQ ID NO:2: GAAGGTCGGAGTCAACGGATTcatacaagtcgtgatgtccataatctaaC. SEQ ID NO:3: cacatgaatgttctggttttaattcctc.

[0072] SEQ ID NO:4: GAAGGTGACCAAGTTCATGCTatagcactgactatgtctccattgcgT. SEQ ID NO:5: GAAGGTCGGAGTCAACGGATTatagcactgactatgtctccattgcgA. SEQ ID NO:6: gtatcaaggagcaaagctgtcaag.

[0073] SEQ ID NO:7: GAAGGTGACCAAGTTCATGCTaggtcactcaagagaaagtactctgcA. SEQ ID NO:8: GAAGGTCGGAGTCAACGGATTaggtcactcaagagaaagtactctgcT. SEQ ID NO:9: cccgcatttctagatgaaaatgaaac.

[0074] SEQ ID NO:10: GAAGGTGACCAAGTTCATGCTcacgaagacaagaatgtgttgccagT. SEQ ID NO:11: GAAGGTCGGAGTCAACGGATTcacgaagacaagaatgtgttgccagC. SEQ ID NO:12: tttcatttcctgctgagaaaatggg.

[0075] SEQ ID NO:13:GAAGGTGACCAAGTTCATGCTtaggccaattgctagtgatcattctgaaaC。SEQID NO:14:GAAGGTCGGAGTCAACGGATTtaggccaattgctagtgatcattctgaaaT。SEQ ID NO:15:gattcattccactccactcatacaaaaaC。

[0076] SEQ ID NO:16:GAAGGTGACCAAGTTCATGCTcaacaacccaccatctaagcttc。SEQ IDNO:17:GAAGGTCGGAGTCAACGGATTcaacaacccaccatctaagcttcT。SEQ ID NO:18:aaagtcgatatggctc

[0077] SEQ ID NO:19:GAAGGTGACCAAGTTCATGCTggtagtgaaaactcgagttttagagacA。SEQID NO:20:GAAGGTCGGAGTCAACGGATTggtagtgaaaactcgagttttagagacG。SEQ ID NO:21:GAAGGTGACCATGCTGCTGTTGTA

[0078] SEQ ID NO:22:GAAGGTGACCAAGTTCATGCTaaaaatcgctaaccagacaaatcgG。SEQ IDNO:23:GAAGGTCGGAGTCAACGGATTTaaaaatcgctaaccagacaaatcgA。SEQ ID NO:24:cttggtaccagaagcctc

[0079] SEQ ID NO:25:GAAGGTGACCAAGTTCATGCTcggcaatattgttttcaccaagaccT。SEQ IDNO:26:GAAGGTCGGAGTCAACGGATTcggcaatattgttttcaccaagaccC。

[0080] SEQ ID NO:27:caatctgcaaggtttcttcgagtac。

[0081] The 5SNP is the most commonly used

[0082] The SNP fingerprints of each test material were constructed using the above 9 SNP markers. Figure 2 The corresponding KASP genotypes are shown in Table 5 (1 to 9 in the table are the same as 1 to 9 in Example 4).

[0083] Table 5

[0084]

[0085]

[0086] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A core SNP marker for tea variety identification, characterized in that: Comprising 9 SNP markers, wherein the 9 SNP markers are SNP markers 1 to 9; in: The SNP marker 1 is the 10499834th base on chromosome 12 of the tea plant genome, which is C or T; The SNP marker 2 is the 112201269th base on chromosome 1 of the tea plant genome, which is A or T; The SNP marker 3 is the 15319304th base on chromosome 1 of the tea plant genome, which is A or T; The SNP marker 4 is the 108293870th base on chromosome 15 of the tea plant genome, which is C or T; The SNP marker 5 is the 82703rd base on the tea plant genome contig 3, which is A or G; The SNP marker 6 is the 211875523rd base on chromosome 1 of the tea plant genome, which is C or T; The SNP marker 7 is the 199948884th base on chromosome 2 of the tea plant genome, which is C or T; The SNP marker 8 is the 171140457th base on chromosome 6 of the tea plant genome, which is A or G; The SNP marker 9 is the 124330th base on the 1191st contig of the tea plant genome, which is C or T; The tea varieties are: CK1, CK2, HH03, RN046, Z09, RN005, B02, RN109, Z01, Z03, HL01, CG22, RN056, HL03, RN131, RN009, Z04, A02, HL04, RN150, B01, RN113, RN107, A01, HL02, Z02, XC1, XC1 Tea varieties: 31-1, XC130-1, XC32-right 1, XC12-right 2, XC132-1, XC52-1, XC69-1, XC20-1, XC12-1, XC133-1, XC123-1, DYL3, DYL4, DYL1, DYL7, DYL2, DYL31, DYL15, YJ45-6567, SYS14, and SYS22.

2. Application of the core SNP markers described in claim 1 in constructing a SNP fingerprint.

3. A substance for detecting the core SNP marker of claim 1.

4. The substance according to claim 3, characterized in that It comprises one or more of primers 1 to 27, and the nucleotide sequences of the primers 1 to 27 are shown in SEQ ID NO: 1 to SEQ ID NO:

27.

5. The substance according to claim 4, characterized in that The invention comprises one or more of primer combinations 1 to 9, wherein the primer combination 1 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO: 1 to SEQ ID NO: 3; the primer combination 2 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO: 4 to SEQ ID NO: 6; the primer combination 3 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO: 7 to SEQ ID NO: 9; the primer combination 4 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO: 10 to SEQ ID NO: 12; the primer combination 5 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO: 13 to SEQ ID NO: 15; the primer combination 6 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO: 16 to SEQ ID NO: 18; the primer combination 7 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO: 19 to SEQ ID NO: 21; the primer combination 8 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO: 22 to SEQ ID NO: 24; the primer combination 9 comprises a primer combination having a nucleotide sequence as shown in SEQ ID NO: 25 to SEQ ID NO: Primer combination shown in NO:

27.

6. Use of the substance according to any one of claims 3 to 5 in genotyping, identification, auxiliary identification and / or similarity detection of tea varieties.

7. A set of PCR reagents for genotyping, identification, auxiliary identification and / or similarity detection of tea varieties, characterized in that: It comprises one or more of primers 1 to 27, and the nucleotide sequences of the primers 1 to 27 are shown in SEQ ID NO: 1 to SEQ ID NO:

27.

8. Use of the set of PCR reagents according to claim 7 in genotyping, identification, auxiliary identification and / or similarity detection of tea varieties.

9. A kit comprising the complete set of PCR reagents according to claim 7.

10. Use of the kit according to claim 9 in genotyping, identification, auxiliary identification and / or similarity detection of tea varieties.

Images