A molecular marker, primer-probe set for identifying Enteromorpha flaccida and its application
By using the characteristic 5S ribosomal RNA gene sequence of the fuzzy genus as a molecular marker and combining with qPCR technology, the problem of difficult to quickly identify the fuzzy genus in the existing technology is solved, and rapid and reliable identification is achieved, which has important guiding significance in the prevention and control of green tide disasters.
Patent Information
- Application Number
- CN202411667182.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-21
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2044-11-21
AI Technical Summary
The existing technology is difficult to quickly and effectively identify weak green tide disasters, which leads to difficulties in preventing and controlling green tide disasters.
The characteristic 5S ribosomal RNA gene sequence of the erectile dysfunction is used as a molecular marker, and specific primers and fluorescent probes are designed to quickly identify algae samples by real-time fluorescence quantitative PCR (qPCR) technology.
It has achieved rapid and reliable identification of soft and slutty, reduced operational complexity and cost, shortened identification time, and has important guiding significance in green tide disaster prevention and control.
Smart Images

Figure CN119162375B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker technology, specifically relating to a molecular marker, primer-probe set, and its application for identifying *Ulva prolifera*. Background Technology
[0002] Frequent green tides in nearshore waters have become a global marine ecological and environmental problem. A new species of green algae, *Ulva*, has been discovered among recent green tide disasters and named *Ulva lactuca*. Ulva delicatissima Its main morphological characteristics are: the thallus is bright green, weak and slender, less than 10 cm high, and the holdfast is composed of rhizoid-like filaments elongated from the basal cells, with underdeveloped rhizoids. The thallus is a hollow tubular structure of a single layer of cells, with an indistinct main branch, a diameter of 70-400 μm, usually less than 1 mm, no air sacs, numerous and dense branches, extremely easy to break, branching 4-5 times, the diameter of the main branch is larger than that of the secondary branches, and the tip of the thallus branch is usually a single row of cells, with up to 30 cells, 10-18 μm in diameter. In surface view, the thallus cells are rectangular or square, 14-35 µm long, 10-25 µm wide, and 12-25 µm high, with cells arranged longitudinally in a distinct manner, the chloroplasts are not fully filled, and the cells at the base of the main branch are irregularly arranged. In cross-section, the body cavity is composed of 4–76 cells, which are rectangular or oval in shape with a body wall thickness of 10–25 μm. The chloroplasts are concentrated within the cells on the outer edge of the body cavity, and there are 2–4 amylopectin nuclei. Traditional classification of green algae mainly relies on thallus morphology. However, due to the strong morphological plasticity of *Ulva* species, it is difficult to distinguish between many algae using only traditional morphological classification methods. With the rapid development of molecular biology, in recent years, the classification and identification of *Ulva* species has increasingly adopted a combination of morphological and molecular marker sequencing alignment methods. Currently, commonly used molecular markers for *Ulva* identification include ITS, rbcL, tufA, and 18S. Because the resolution of a single molecular marker is limited, multiple markers are often used in combination. Furthermore, due to the complex natural environment, difficulties in removing sample impurities, and primer universality issues, non-specific amplification frequently occurs, leading to sequencing failures. The identification process also requires PCR amplification, electrophoretic detection of amplified products, gel extraction and recovery, sequencing, and sequence alignment analysis, which is complex, costly, and time-consuming. In addition, the traditional method for detecting microscopic propagules in the environment involves statistical analysis of thallus after laboratory culture, and morphological and molecular biological identification of partial samples, which is time-consuming and labor-intensive.
[0003] Therefore, discovering the specific molecular markers of *Ulva prolifera* and developing a rapid and effective identification method for *Ulva prolifera* is of great significance for guiding the prevention and control of *Ulva prolifera* green tide disasters. Summary of the Invention
[0004] In view of this, the object of the present invention is to provide a molecular marker for identifying *Ulva prolifera*, which has high specificity and can be used to identify *Ulva prolifera*.
[0005] Another objective of this invention is to provide a primer and probe set for identifying *Ulva prolifera*, which has extremely high resolution, strong stability, and high probe specificity, enabling rapid and effective identification of *Ulva prolifera* species and quantitative detection of environmental DNA.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] The present invention provides a molecular marker for identifying *Ulva prolifera*, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0008] The present invention also provides a primer and probe set for identifying *Ulva prolifera*, wherein the primer and probe set comprises an upstream primer, a downstream primer, and a fluorescent probe designed based on the aforementioned molecular marker; the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3; and the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO. 4.
[0009] The present invention also provides a kit for identifying *Ulva prolifera*, the kit comprising the aforementioned molecular markers and primer-probe set.
[0010] The present invention also provides the application of the molecular marker, the primer-probe set, or the kit described herein in the identification of *Ulva prolifera*.
[0011] This invention also provides a method for identifying the delicate *Ulva prolifera*, comprising the following steps:
[0012] Extract genomic DNA from the sample to be tested;
[0013] Using the genomic DNA of the above samples as a template, qPCR amplification was performed using the primer and probe set or the kit described above. After the reaction, the amplification curve and Ct value were used to determine whether the *Ulva lactuca* in the sample was positive.
[0014] Preferably, the sample to be tested is a plant sample or an environmental sample.
[0015] Preferably, the reaction program for the qPCR amplification is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 15 s, annealing and extension at 55~63℃ for 60 s, for 40 cycles; fluorescence intensity is measured after each cycle.
[0016] Preferably, the qPCR amplification reaction system, in 25 μL, comprises: 2 μL DNA template, 12.5 μL 2×PCR mix, 1 μL 10 μM upstream primer, 1 μL 10 μM downstream primer, 0.5 μL 10 μM fluorescent probe, and 8 μL sterile double-distilled water.
[0017] Preferably, when the sample to be tested is a plant sample, the identification criteria are as follows: if no amplification curve is detected or the Ct value is greater than the Ct value at 100 copies in the standard series, then the sample to be tested is non-weak Ulva; if the detected Ct value is less than or equal to the Ct value at 100 copies in the standard series, then the sample to be tested is weak Ulva.
[0018] Preferably, when the sample to be tested is an environmental sample, the identification criteria are as follows: if no amplification curve is detected or the Ct value is greater than the Ct value at 10 copies in the standard series, then the sample to be tested does not contain *Ulva prolifera*; if the detected Ct value is less than or equal to the Ct value at 10 copies in the standard series, then the sample to be tested contains *Ulva prolifera*.
[0019] Compared with the prior art, the present invention has the following advantages:
[0020] This invention utilizes the weak *Ulva prolifera* species, which are the main cause of the green tide in northern Yantai. Ulva.delicatissima Using the characteristic 5S ribosomal RNA gene sequence (5S rDNA) as a molecular marker, and by designing specific primers and TaqMan probes, the optimal PCR reaction conditions were determined. Algal samples can be rapidly identified using real-time quantitative PCR (qPCR). The qPCR method can quickly and efficiently identify whether a green alga is *Ulva prolifera*, and whether environmental samples contain *Ulva prolifera* microscopic propagules or DNA, within 5-8 hours. The identification method developed in this invention is more reliable and convenient than conventional methods, and has important guiding significance for the identification of dominant species in *Ulva prolifera* green tides, as well as for early warning of green tide disasters caused by this algae and research on the causes of green tides. Attached Figure Description
[0021] Figure 1 This is a schematic diagram showing the positions of primers and probes on molecular markers. In the diagram, SEQ1 is the molecular marker gene sequence, SEQ2 is the upstream primer sequence, SEQ3 is the reverse complementary sequence of the downstream primer, and SEQ4 is the fluorescent probe sequence.
[0022] Figure 2 This is the qPCR standard curve of the present invention;
[0023] Figure 3 This is the standard series 10 of the qPCR detection system of the present invention. 7 10 6 10 5 10 4 10 310 2 10 1 Copy the amplification curve;
[0024] Figure 4 These are the amplification curves of 9 green algae samples, 9 blank controls, and 7 environmental samples under the detection system of this invention. Detailed Implementation
[0025] The present invention provides a molecular marker for identifying *Ulva prolifera*, the nucleotide sequence of which is 5'-TGCAGGTGGTGGCGAAAACGGCTGCGGCCGCTAGCGAGCCAACGGGAACGGCGCCGTGAAGCTCTGGCAGATGCTTGAAGAGAGAGTTGGCTGGCATGAA-3' (SEQ ID NO.1).
[0026] This invention utilizes the significant differences in the 5S rDNA sequences of the genus *Ulva* to select *Ulva spp.*, a species that is a major cause of the green tide in northern Yantai. Ulva.delicatissima The characteristic 5S ribosomal RNA gene sequence (5S rDNA) was used as a molecular marker. This molecular marker is highly specific and is highly homologous only to *Ulva pulvinata* in NCBI Genbank.
[0027] This invention also provides a primer-probe set for identifying *Ulva prolifera*, wherein the primer-probe set comprises an upstream primer, a downstream primer, and a fluorescent probe designed based on the aforementioned molecular markers; the nucleotide sequence of the upstream primer is 5'-TGCAGGTGGTGGCGAAAAC-3' (SEQ ID NO.2); the nucleotide sequence of the downstream primer is 5'-TTCATGCCAGCCAACTCTCTCT-3' (SEQ ID NO.3); and the nucleotide sequence of the fluorescent probe is 5'-CTGCGGCCGCTAGCGAGCCA-3' (SEQ ID NO.4). This invention designs specific primers and TaqMan probes based on the aforementioned molecular markers, determines optimal PCR reaction conditions, and can rapidly identify algal samples using real-time quantitative PCR (qPCR) technology. It can also detect microscopic propagation samples and environmental DNA samples, making it more reliable and convenient than conventional methods.
[0028] In this invention, the fluorescent probe is labeled with a reporter group at its 5' end and a quencher group at its 3' end. The 5'-end reporter group includes, but is not limited to, FAM, FITC, TET, HEX, and JOE. The 5'-end reporter group is further preferably the FAM group; the 3'-end quencher group includes, but is not limited to, DABCYL, TAMRA, MGB, BHQ-0, BHQ-1, BHQ-2, or BHQ-3, and the 3'-end quencher group is further preferably the BHQ-1 group.
[0029] This invention also provides a kit for identifying *Ulva prolifera*, the kit preferably comprising the aforementioned molecular marker and primer-probe set; more preferably comprising a pMV vector plasmid standard series of the aforementioned molecular marker sequence and the primer-probe set. In this invention, the kit further comprises 2×PCR mix, sterile double-distilled water, a positive control, and a negative control. In this invention, the sterile double-distilled water is free of DNase and RNase. In this invention, the positive control is a DNA sequence containing the *Ulva prolifera* molecular marker; the negative control is sterile double-distilled water.
[0030] The present invention also provides the application of the molecular marker, the primer-probe set, or the kit described herein in the identification of *Ulva prolifera*.
[0031] The present invention also provides a method for identifying the delicate *Ulva prolifera*, preferably comprising the following steps:
[0032] Extract genomic DNA from the sample to be tested;
[0033] Using the genomic DNA of the above samples as a template, qPCR amplification was performed using the primer and probe set or the kit described above. After the reaction, the amplification curve and Ct value were used to determine whether the *Ulva lactuca* in the sample was positive.
[0034] In this invention, the sample to be tested is preferably a plant sample or an environmental sample.
[0035] In this invention, as one possible implementation method, when the environmental sample is seawater, the seawater sample to be tested is filtered with a hydrophilic filter membrane, and the total DNA enriched in the filter membrane is extracted; using the total DNA of the above sample as a template, qPCR amplification is performed using the primer and probe set or the kit described above; after the reaction, the presence of weak seaweed micropropagules or DNA in the sample to be tested is determined based on the amplification curve and Ct value.
[0036] In this invention, the preferred reaction program for qPCR amplification is: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 15 s, annealing and extension at 55-63℃ for 60 s, for 40 cycles; fluorescence intensity is measured after each cycle. In this invention, annealing and extension are performed simultaneously in the qPCR amplification program, and the annealing and extension temperature is more preferably 60.5℃.
[0037] In this invention, the qPCR amplification reaction system is preferably calculated in 25 μL as follows: 2 μL DNA template, 12.5 μL 2×PCR mix, 1 μL 10 μM upstream primer, 1 μL 10 μM downstream primer, 0.5 μL 10 μM fluorescent probe, and 8 μL sterile double-distilled water.
[0038] In this invention, the preferred identification criteria for plant samples are as follows: if no amplification curve is detected or the Ct value is greater than the Ct value at 100 copies in the standard series, the sample is not *Ulva prolifera*; if the Ct value is less than or equal to the Ct value at 100 copies in the standard series, the sample is *Ulva prolifera*. The preferred identification criteria for environmental samples are as follows: if no amplification curve is detected or the Ct value is greater than the Ct value at 10 copies in the standard series, the sample does not contain *Ulva prolifera*; if the Ct value is less than or equal to the Ct value at 10 copies in the standard series, the sample contains *Ulva prolifera*. In actual testing, due to differences in Ct values measured by different qPCR reagents and experimental batches, this invention uses a standard series with a DNA content of 100 copies to identify whether plant samples contain *Ulva prolifera*, and a standard series with a DNA content of 10 copies to identify whether environmental samples contain *Ulva prolifera*.
[0039] In this invention, as one feasible approach, after obtaining the Ct value, the template DNA content of each sample can be calculated using a standard curve to identify whether the sample is *Ulva prolifera* or whether it contains *Ulva prolifera*. In this invention, the calculation formula is as follows: X0 = 10 (Y-Ct) / A In the formula: X0 represents the template DNA content (copy) in the qPCR system; Y represents the intercept; Ct represents the sample Ct value; and A represents the slope. In this invention, the preferred criteria for identifying *Ulva prolifera* as positive based on the template DNA content in the sample are as follows: a plant DNA sample (single green algae sample) with a content of 50 copies / μL or higher can be identified as *Ulva prolifera*; an environmental DNA sample with a content of 5 copies / μL or higher can be identified as containing *Ulva prolifera* microscopic propagules or DNA.
[0040] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0041] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available products.
[0042] Example 1
[0043] A molecular marker for identifying *Ulva prolifera*, the specific sequence of which is:
[0044] 5'-TGCAGGTGGTGGCGAAAACGGCTGCGGCCGCTAGCGAGCCAACGGGAACGGCGCTGAAGCTCTGGCAGATGCTTGAAGAGAGAGTTGGCTGGCATGAA-3' (100 bp).
[0045] This invention utilizes the weak *Ulva prolifera* species, which are the main cause of the green tide in northern Yantai. Ulva.delicatissima The characteristic 5S ribosomal RNA gene sequence (5S rDNA) was used as a molecular marker, which is highly homologous to only *Ulva pulvinata* in Genbank.
[0046] Example 2
[0047] A primer-probe set for identifying *Ulva prolifera*, wherein the primer-probe set comprises upstream primers, downstream primers, and a fluorescent probe designed according to the molecular markers described in Example 1, with the specific sequences as follows:
[0048] Upstream primer (19bp): 5'-TGCAGGTGGTGGCGAAAAC-3';
[0049] Downstream primer sequence (22bp): 5'-TTCATGCCAGCCAACTCTCTCT-3';
[0050] Fluorescent probe and modification (20bp): 5'-FAM-CTGCGGCCGCTAGCGAGCCA-BHQ1-3'.
[0051] The positions of primers and probes on molecular markers are shown in the figure. Figure 1 In the figure, SEQ1 is the molecular marker gene sequence SEQ ID NO.1, SEQ2 is the upstream primer sequence SEQ ID NO.2, SEQ3 is the reverse complementary sequence of the downstream primer SEQ ID NO.3, and SEQ4 is the fluorescent probe sequence SEQ ID NO.4.
[0052] Example 3
[0053] A kit for identifying *Ulva prolifera*, the kit comprising the molecular markers of Example 1, the primer and probe set of Example 2, 2×PCR mix and sterile double-distilled water, negative control and positive control.
[0054] Example 4
[0055] A method for identifying the delicate *Ulva prolifera*, the specific steps of which are as follows:
[0056] The gene sequence of the molecular marker from Example 1 was synthesized, cloned into the pMV vector, and the gene concentration (copy / μL) was measured using a nucleic acid analyzer after plasmid extraction. The sample was then diluted with sterile double-distilled water to a concentration of 5 × 10⁻⁶. 6 5×10 5 5×10 4 5×10 3 5×10 2 5×10 1 5×10 0 Seven concentration gradients (copy / μL) were used as templates, with three replicates for each concentration, to create a qPCR standard curve. Figure 2 According to the standard qPCR working curve, the primer amplification efficiency was 95.01%, R... 2 The value was 0.994, and the slope was -3.448. The qPCR amplification results are shown below. Figure 3 , Figure 3 The amplification curves of the first 6 groups were 5×10. 6 5×10 5 5×10 4 5×10 3 5×10 2 5×10 1 Amplification curves obtained at 6 concentration ranges (copy / μL) show small differences in Ct values among parallel samples at the same concentration, indicating accurate quantification; the amplification curves of groups 7 and 8 are 5×10⁻⁶. 0 The amplification curves of the copy / μL concentration group show that the relative deviation of Ct values between parallel samples is large at this concentration, indicating inaccurate quantification.
[0057] Using the DNA of the sample to be tested as a template, absolute quantitative qPCR amplification was performed on the sample using the primer and probe set described in Example 2, with at least two replicates for each sample.
[0058] The qPCR reaction system, in 25 μL, includes: 12.5 μL of 2×PCR mix, 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 0.5 μL of 10 μM fluorescent probe, 8.0 μL of sterile double-distilled water, and 2 μL of template DNA.
[0059] The qPCR amplification reaction program included: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 60.5℃ annealing and extension for 60 s, for 40 cycles; fluorescence intensity was measured after each cycle.
[0060] qPCR method: absolute fluorescence quantitative method, with Ct value as the quantitative cycling method.
[0061] Judgment criteria: When the sample to be tested is a plant sample, the criteria for identification are as follows: if no amplification curve is detected or the Ct value is greater than the Ct value at 100 copies in the standard series, then the sample to be tested is not *Ulva prolifera*; if the Ct value is less than or equal to the Ct value at 100 copies in the standard series, then the sample to be tested is *Ulva prolifera*. When the sample to be tested is an environmental sample, the criteria for identification are as follows: if no amplification curve is detected or the Ct value is greater than the Ct value at 10 copies in the standard series, then the sample to be tested does not contain *Ulva prolifera*; if the Ct value is less than or equal to the Ct value at 10 copies in the standard series, then the sample to be tested contains *Ulva prolifera*.
[0062] After determining the Ct value, the template DNA content (copy / μL) of each sample was calculated using a standard curve. The calculation formula is: X0 = 10 (Y-Ct) / A In the formula: X0 represents the template DNA content (copy) in the qPCR system; Y represents the intercept; Ct represents the sample Ct value; A represents the slope.
[0063] If the DNA content of a single green algae sample is above 50 copies / μL, the sample can be identified as *Ulva prolifera*. If the DNA content of an environmental DNA sample is above 5 copies / μL, the sample can be identified as containing microscopic propagules or DNA of *Ulva prolifera*.
[0064] Example 5
[0065] In this embodiment, the primer and probe composition of Example 2 was used to detect nine green algae samples. The steps are as follows:
[0066] Genomic DNA was obtained from nine green algae samples. Using the genomic DNA as templates, absolute quantitative qPCR amplification was performed using the molecular marker standard series from Example 1, the primer and probe combination from Example 2, and the reaction system and procedure from Example 4. Information on the nine green algae samples is shown in Table 1.
[0067] Table 1 Information on 9 types of green algae
[0068]
[0069] Among them, 1 is a positive sample, and 2-9 are negative samples.
[0070] according to Figure 4As can be seen from the results in Table 2, all positive green algae samples of the present invention showed obvious amplification curves, and the Ct values were all less than or equal to the Ct value at 100 copies in the standard series (28.989); negative samples did not show obvious amplification curves or the Ct value at 100 copies in the standard series (28.989).
[0071] Table 2. Ct value results of the standard series of this invention, 9 green algae samples, and blank control.
[0072]
[0073] Example 6
[0074] This embodiment detects the presence of *Ulva prolifera* in environmental samples, and the specific steps are as follows:
[0075] More than 1L of seawater was collected from the nearshore waters north of Yantai using clean sample bottles. After filtration through a 0.45μm pore size filter membrane, the total DNA from the filter membrane was extracted as an environmental sample template. Absolute quantitative qPCR amplification was performed using the molecular marker standard series of Example 1, the primer and probe combination of Example 2, the reaction system and reaction procedure of Example 4.
[0076] Table 3. Ct value results of the standard series, 7 groups of environmental samples, and blank control of this invention.
[0077]
[0078] according to Figure 4 As can be seen from the results in Table 3, all environmental positive samples of the present invention showed obvious amplification curves, and the Ct values were all less than or equal to the Ct value at 10 copies in the standard series (32.626); the negative samples did not show obvious amplification curves or the Ct values were higher than the Ct value at 10 copies in the standard series (32.626).
[0079] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A use of a 5S ribosomal gene as a molecular marker in identifying Enteromorpha tenuifolia, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; The primer probe set designed based on the molecular marker is an upstream primer, a downstream primer and a fluorescent probe, and the nucleotide sequences are shown in SEQ ID NO.2-4 in sequence; The sample to be identified is a plant sample or an environmental sample.
2. A method for identifying Enteromorpha tenuifolia, characterized in that: The steps include: Extracting genomic DNA from the sample to be tested; Using the genomic DNA of the sample as a template, qPCR amplification is performed using the primer probe set described in claim 1; after the reaction is completed, judging whether the Enteromorpha tenuifolia in the sample to be tested is positive according to the amplification curve and the Ct value; The sample to be tested is a plant sample or an environmental sample.
3. The identification method according to claim 2, characterized in that: The reaction procedure of the qPCR amplification is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 55-63°C for 60 s, 40 cycles; and measuring the fluorescence intensity after each cycle.
4. The identification method according to claim 2, characterized in that: The reaction system of the qPCR amplification is calculated as 25 μL: 2 μL of DNA template, 12.5 μL of 2×PCR mix, 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 0.5 μL of 10 μM fluorescent probe, and 8 μL of sterile double distilled water.
5. The identification method according to claim 2, characterized in that: When the sample to be tested is a plant sample, the identification criteria are as follows: if the test does not show an amplification curve or the Ct value is greater than the Ct value at 100 copies in the standard series, the sample to be tested is not Enteromorpha tenuifolia; if the test Ct value is ≤ the Ct value at 100 copies in the standard series, the sample to be tested is Enteromorpha tenuifolia.
6. The identification method according to claim 2, characterized in that: When the sample to be tested is an environmental sample, the identification criteria are as follows: if no amplification curve appears in the test or the Ct value is greater than the Ct value at 10 copies in the standard series, the sample to be tested does not contain Enteromorpha tenuifolia; if the detected Ct value is ≤ the Ct value at 100 copies in the standard series, the sample to be tested contains Enteromorpha tenuifolia.
Citation Information
Patent Citations
Method for rapidly identifying green tide enteromorpha algae
CN104561333A